Homologs in group_340

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11620 FBDBKF_11620 78.7 Morganella morganii S1 ligA NAD-dependent DNA ligase LigA
EHELCC_17540 EHELCC_17540 78.7 Morganella morganii S2 ligA NAD-dependent DNA ligase LigA
NLDBIP_18750 NLDBIP_18750 78.7 Morganella morganii S4 ligA NAD-dependent DNA ligase LigA
LHKJJB_17980 LHKJJB_17980 78.7 Morganella morganii S3 ligA NAD-dependent DNA ligase LigA
HKOGLL_18670 HKOGLL_18670 78.7 Morganella morganii S5 ligA NAD-dependent DNA ligase LigA
F4V73_RS08060 F4V73_RS08060 76.8 Morganella psychrotolerans ligA NAD-dependent DNA ligase LigA
F4V73_RS14615 F4V73_RS14615 28.5 Morganella psychrotolerans ligB NAD-dependent DNA ligase LigB

Distribution of the homologs in the orthogroup group_340

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_340

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZR2 0.0 1382 100 0 675 3 ligA DNA ligase Proteus mirabilis (strain HI4320)
A6TC47 0.0 1087 77 1 669 3 ligA DNA ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P15042 0.0 1084 76 1 669 1 ligA DNA ligase Escherichia coli (strain K12)
B1IX60 0.0 1084 76 1 669 3 ligA DNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA82 0.0 1084 76 1 669 3 ligA DNA ligase Escherichia coli (strain K12 / DH10B)
B7LL73 0.0 1083 76 1 669 3 ligA DNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NPU7 0.0 1082 76 1 669 3 ligA DNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6I4Y8 0.0 1081 76 1 669 3 ligA DNA ligase Escherichia coli (strain SE11)
B7M6S1 0.0 1081 76 1 669 3 ligA DNA ligase Escherichia coli O8 (strain IAI1)
B7LCF6 0.0 1081 76 1 669 3 ligA DNA ligase Escherichia coli (strain 55989 / EAEC)
A7ZPL2 0.0 1081 76 1 669 3 ligA DNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
A8A2Q7 0.0 1080 76 1 669 3 ligA DNA ligase Escherichia coli O9:H4 (strain HS)
Q3YZD1 0.0 1079 76 1 669 3 ligA DNA ligase Shigella sonnei (strain Ss046)
B1LMK5 0.0 1079 76 1 669 3 ligA DNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FFC1 0.0 1079 76 1 669 3 ligA DNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B4TQF8 0.0 1079 76 1 668 3 ligA DNA ligase Salmonella schwarzengrund (strain CVM19633)
B5YZV8 0.0 1079 76 1 669 3 ligA DNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBL5 0.0 1079 76 1 669 3 ligA DNA ligase Escherichia coli O157:H7
A9N362 0.0 1078 77 1 667 3 ligA DNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B7N602 0.0 1078 76 1 669 3 ligA DNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32DE2 0.0 1077 76 1 669 3 ligA DNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R8W1 0.0 1077 76 1 669 3 ligA DNA ligase Escherichia coli (strain UTI89 / UPEC)
Q0TF55 0.0 1077 76 1 669 3 ligA DNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADS8 0.0 1077 76 1 669 3 ligA DNA ligase Escherichia coli O1:K1 / APEC
B7MHR5 0.0 1077 76 1 669 3 ligA DNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5F0F5 0.0 1077 76 1 668 3 ligA DNA ligase Salmonella agona (strain SL483)
Q8ZN89 0.0 1076 76 1 667 3 ligA DNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BB72 0.0 1075 76 1 667 3 ligA DNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNE2 0.0 1075 76 1 667 3 ligA DNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7MY64 0.0 1075 76 1 669 3 ligA DNA ligase Escherichia coli O81 (strain ED1a)
Q8Z4W4 0.0 1075 76 1 667 3 ligA DNA ligase Salmonella typhi
Q57LT1 0.0 1075 76 1 667 3 ligA DNA ligase Salmonella choleraesuis (strain SC-B67)
B7UGB2 0.0 1075 76 1 669 3 ligA DNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31Y68 0.0 1075 76 1 669 3 ligA DNA ligase Shigella boydii serotype 4 (strain Sb227)
C0PZB4 0.0 1075 76 1 667 3 ligA DNA ligase Salmonella paratyphi C (strain RKS4594)
B5R3V4 0.0 1073 76 1 667 3 ligA DNA ligase Salmonella enteritidis PT4 (strain P125109)
Q83K81 0.0 1073 76 1 669 3 ligA DNA ligase Shigella flexneri
Q0T298 0.0 1073 76 1 669 3 ligA DNA ligase Shigella flexneri serotype 5b (strain 8401)
B4SZU5 0.0 1073 76 1 667 3 ligA DNA ligase Salmonella newport (strain SL254)
B4TCF6 0.0 1073 76 1 667 3 ligA DNA ligase Salmonella heidelberg (strain SL476)
B5RCP9 0.0 1072 76 1 667 3 ligA DNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FQB9 0.0 1072 76 1 667 3 ligA DNA ligase Salmonella dublin (strain CT_02021853)
A9MIG0 0.0 1072 76 1 667 3 ligA DNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XVT4 0.0 1071 76 1 669 3 ligA DNA ligase Klebsiella pneumoniae (strain 342)
A8GHF2 0.0 1070 76 1 670 3 ligA DNA ligase Serratia proteamaculans (strain 568)
A8ADI2 0.0 1068 75 1 669 3 ligA DNA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7MKW4 0.0 1066 75 0 671 3 ligA DNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
A4WD23 0.0 1066 75 1 670 3 ligA DNA ligase Enterobacter sp. (strain 638)
Q7MBH2 0.0 1065 77 0 671 3 ligA DNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4TMG4 0.0 1062 75 1 669 3 ligA DNA ligase Yersinia pestis (strain Pestoides F)
Q1CJV7 0.0 1062 75 1 669 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH0 0.0 1062 75 1 669 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q7CJF3 0.0 1062 75 1 669 3 ligA DNA ligase Yersinia pestis
Q1C5X9 0.0 1062 75 1 669 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JLA4 0.0 1062 76 1 672 3 ligA DNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q668M6 0.0 1059 75 1 669 3 ligA DNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K917 0.0 1059 75 1 669 3 ligA DNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JFZ0 0.0 1057 75 1 669 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FGC2 0.0 1057 75 1 669 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D165 0.0 1052 76 1 668 3 ligA DNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VE40 0.0 1021 73 1 671 3 ligA DNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NSC2 0.0 989 70 2 675 3 ligA DNA ligase Sodalis glossinidius (strain morsitans)
Q9KTD1 0.0 896 65 2 668 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B5FGU7 0.0 894 64 2 669 3 ligA DNA ligase Aliivibrio fischeri (strain MJ11)
P43813 0.0 892 65 3 666 1 ligA DNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C3LTL9 0.0 892 65 2 668 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain M66-2)
A5F2W3 0.0 892 65 2 668 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5UIM6 0.0 890 65 3 666 3 ligA DNA ligase Haemophilus influenzae (strain PittGG)
A5UD04 0.0 890 64 3 666 3 ligA DNA ligase Haemophilus influenzae (strain PittEE)
Q5E3L1 0.0 889 64 2 669 3 ligA DNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65RN7 0.0 886 64 3 673 3 ligA DNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I2H6 0.0 885 63 3 668 3 ligA DNA ligase Histophilus somni (strain 129Pt)
B0USD9 0.0 885 63 3 668 3 ligA DNA ligase Histophilus somni (strain 2336)
Q4QLJ0 0.0 885 64 3 666 3 ligA DNA ligase Haemophilus influenzae (strain 86-028NP)
Q87RJ4 0.0 885 63 2 672 3 ligA DNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C4K4K4 0.0 884 62 4 695 3 ligA DNA ligase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A6VR16 0.0 881 63 3 670 3 ligA DNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q9CKA9 0.0 879 63 3 669 3 ligA DNA ligase Pasteurella multocida (strain Pm70)
B8F314 0.0 873 62 4 670 3 ligA DNA ligase Glaesserella parasuis serovar 5 (strain SH0165)
Q6LTU5 0.0 868 61 2 673 3 ligA DNA ligase Photobacterium profundum (strain SS9)
B0BQN6 0.0 865 63 4 665 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N1V2 0.0 865 63 4 665 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7MMT5 0.0 864 63 2 671 3 ligA DNA ligase Vibrio vulnificus (strain YJ016)
Q8DFK5 0.0 864 62 3 674 3 ligA DNA ligase Vibrio vulnificus (strain CMCP6)
B7VIK3 0.0 863 62 2 671 3 ligA DNA ligase Vibrio atlanticus (strain LGP32)
B3H275 0.0 862 63 4 665 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A7MT54 0.0 861 62 2 671 3 ligA DNA ligase Vibrio campbellii (strain ATCC BAA-1116)
B6EJQ6 0.0 854 61 2 669 3 ligA DNA ligase Aliivibrio salmonicida (strain LFI1238)
Q3IKB8 0.0 852 60 2 673 3 ligA DNA ligase Pseudoalteromonas translucida (strain TAC 125)
Q15UZ1 0.0 851 60 3 667 3 ligA DNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A0KHL9 0.0 850 63 5 667 3 ligA DNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q0HWD2 0.0 842 60 4 674 3 ligA DNA ligase Shewanella sp. (strain MR-7)
A4SKA6 0.0 839 63 3 652 3 ligA DNA ligase Aeromonas salmonicida (strain A449)
Q0HK31 0.0 838 60 4 674 3 ligA DNA ligase Shewanella sp. (strain MR-4)
A0KVI4 0.0 835 60 4 671 3 ligA DNA ligase Shewanella sp. (strain ANA-3)
Q5QUK1 0.0 835 61 4 672 3 ligA DNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8ED70 0.0 834 60 4 671 3 ligA DNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B8GTL0 0.0 832 61 1 671 3 ligA DNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q7VMX7 0.0 832 61 4 669 3 ligA DNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0TKB2 0.0 831 59 4 671 3 ligA DNA ligase Shewanella halifaxensis (strain HAW-EB4)
A8H376 0.0 828 59 4 669 3 ligA DNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1RII7 0.0 824 59 4 671 3 ligA DNA ligase Shewanella sp. (strain W3-18-1)
A4Y802 0.0 824 59 4 671 3 ligA DNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WPS5 0.0 824 59 4 666 3 ligA DNA ligase Shewanella baltica (strain OS185)
A9L5Z1 0.0 823 59 4 666 3 ligA DNA ligase Shewanella baltica (strain OS195)
B8EEK5 0.0 820 59 4 666 3 ligA DNA ligase Shewanella baltica (strain OS223)
Q2SD47 0.0 818 58 4 673 3 ligA DNA ligase Hahella chejuensis (strain KCTC 2396)
A1S5R7 0.0 817 59 6 674 3 ligA DNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QFJ5 0.0 816 60 4 671 3 ligA DNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q1QZP4 0.0 808 60 3 670 3 ligA DNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q080K9 0.0 807 58 4 670 3 ligA DNA ligase Shewanella frigidimarina (strain NCIMB 400)
B8CN91 0.0 806 58 4 666 3 ligA DNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q21JI8 0.0 804 57 2 666 3 ligA DNA ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8FU26 0.0 802 58 4 669 3 ligA DNA ligase Shewanella sediminis (strain HAW-EB3)
Q12L82 0.0 801 59 5 669 3 ligA DNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B3PGQ8 0.0 798 57 2 668 3 ligA DNA ligase Cellvibrio japonicus (strain Ueda107)
B1KJT5 0.0 791 56 4 671 3 ligA DNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A6W0S9 0.0 782 57 4 668 3 ligA DNA ligase Marinomonas sp. (strain MWYL1)
Q470D2 0.0 776 57 5 681 3 ligA DNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q47YI0 0.0 768 56 5 685 3 ligA DNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q13XB0 0.0 767 57 2 666 3 ligA DNA ligase Paraburkholderia xenovorans (strain LB400)
B6J878 0.0 766 54 2 668 3 ligA DNA ligase Coxiella burnetii (strain CbuK_Q154)
B6J1C6 0.0 764 54 2 668 3 ligA DNA ligase Coxiella burnetii (strain CbuG_Q212)
B2T5K0 0.0 764 57 2 666 3 ligA DNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A9KCS0 0.0 763 53 2 668 3 ligA DNA ligase Coxiella burnetii (strain Dugway 5J108-111)
Q1LU20 0.0 762 54 5 672 3 ligA DNA ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q63T07 0.0 761 57 2 669 3 ligA DNA ligase Burkholderia pseudomallei (strain K96243)
Q83DZ6 0.0 761 53 2 668 3 ligA DNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A1V575 0.0 761 57 2 669 3 ligA DNA ligase Burkholderia mallei (strain SAVP1)
Q62JB9 0.0 761 57 2 669 3 ligA DNA ligase Burkholderia mallei (strain ATCC 23344)
A2SB66 0.0 761 57 2 669 3 ligA DNA ligase Burkholderia mallei (strain NCTC 10229)
A3MKU9 0.0 761 57 2 669 3 ligA DNA ligase Burkholderia mallei (strain NCTC 10247)
A9NC33 0.0 760 53 2 668 3 ligA DNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A4JF81 0.0 759 57 2 669 3 ligA DNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A3NWN7 0.0 759 57 2 669 3 ligA DNA ligase Burkholderia pseudomallei (strain 1106a)
B2JID1 0.0 758 57 3 665 3 ligA DNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A3NAV3 0.0 758 57 2 669 3 ligA DNA ligase Burkholderia pseudomallei (strain 668)
Q3JR23 0.0 758 57 2 669 3 ligA DNA ligase Burkholderia pseudomallei (strain 1710b)
A6SZQ8 0.0 757 56 4 662 3 ligA DNA ligase Janthinobacterium sp. (strain Marseille)
B4ECN6 0.0 757 57 2 669 3 ligA DNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A9AIK9 0.0 756 57 2 669 3 ligA DNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
A4G4R4 0.0 756 56 3 662 3 ligA DNA ligase Herminiimonas arsenicoxydans
B3R2C2 0.0 756 57 5 670 3 ligA DNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q2SX03 0.0 753 56 2 669 3 ligA DNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q1BHI7 0.0 753 57 2 669 3 ligA DNA ligase Burkholderia orbicola (strain AU 1054)
A0K8E8 0.0 753 57 2 669 3 ligA DNA ligase Burkholderia cenocepacia (strain HI2424)
A1TZT9 0.0 752 56 2 669 3 ligA DNA ligase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0KA11 0.0 752 57 5 675 3 ligA DNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1YSH2 0.0 751 56 2 669 3 ligA DNA ligase Burkholderia ambifaria (strain MC40-6)
Q1LNG5 0.0 751 55 5 693 3 ligA DNA ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B1JUF5 0.0 750 56 2 669 3 ligA DNA ligase Burkholderia orbicola (strain MC0-3)
Q604U8 0.0 748 55 3 671 3 ligA DNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0BE10 0.0 748 56 3 673 3 ligA DNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q39F38 0.0 743 56 2 669 3 ligA DNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5ZWX6 0.0 741 54 3 672 3 ligA DNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6E6 0.0 738 54 3 672 3 ligA DNA ligase Legionella pneumophila (strain Paris)
Q5WXV3 0.0 738 54 4 673 3 ligA DNA ligase Legionella pneumophila (strain Lens)
A5IFV1 0.0 735 54 3 672 3 ligA DNA ligase Legionella pneumophila (strain Corby)
A4SYV5 0.0 734 54 4 670 3 ligA DNA ligase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q31G89 0.0 730 53 3 669 3 ligA DNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0AAV2 0.0 729 55 4 668 3 ligA DNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B1XTU0 0.0 724 54 4 670 3 ligA DNA ligase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q3JAI1 0.0 721 54 5 672 3 ligA DNA ligase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
C1D4R5 0.0 719 55 6 672 3 ligA DNA ligase Laribacter hongkongensis (strain HLHK9)
Q0AHH6 0.0 717 54 5 671 3 ligA DNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q3SL40 0.0 713 54 7 671 3 ligA DNA ligase Thiobacillus denitrificans (strain ATCC 25259)
Q1H1G6 0.0 711 52 7 680 3 ligA DNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q82TW6 0.0 709 53 4 671 3 ligA DNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q21WC8 0.0 706 53 7 678 3 ligA DNA ligase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5NYU3 0.0 704 53 6 671 3 ligA DNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q7W0T4 0.0 700 53 7 693 3 ligA DNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WCJ7 0.0 700 53 7 693 3 ligA DNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0VR01 0.0 700 59 0 577 3 ligA DNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VR01 2.01e-17 90 57 0 83 3 ligA DNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1VN98 0.0 699 52 8 688 3 ligA DNA ligase Polaromonas naphthalenivorans (strain CJ2)
Q12AD4 0.0 698 52 9 688 3 ligA DNA ligase Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1K713 0.0 698 54 7 666 3 ligA DNA ligase Azoarcus sp. (strain BH72)
Q7VRX7 0.0 697 53 7 693 3 ligA DNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q47FA0 0.0 694 52 3 679 3 ligA DNA ligase Dechloromonas aromatica (strain RCB)
A9II69 0.0 691 53 9 694 3 ligA DNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2YBB7 0.0 689 51 7 688 3 ligA DNA ligase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B0V8E4 0.0 688 51 5 672 3 ligA DNA ligase Acinetobacter baumannii (strain AYE)
A3M2U3 0.0 688 51 5 672 3 ligA DNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I790 0.0 688 51 5 672 3 ligA DNA ligase Acinetobacter baumannii (strain AB0057)
B7GZ71 0.0 688 51 5 672 3 ligA DNA ligase Acinetobacter baumannii (strain AB307-0294)
B2HUJ5 0.0 688 51 5 669 3 ligA DNA ligase Acinetobacter baumannii (strain ACICU)
B0VU02 0.0 687 51 5 672 3 ligA DNA ligase Acinetobacter baumannii (strain SDF)
Q2KUU5 0.0 683 51 8 698 3 ligA DNA ligase Bordetella avium (strain 197N)
Q6FDW0 0.0 679 51 5 674 3 ligA DNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C3JXX6 0.0 678 56 3 592 3 ligA DNA ligase Pseudomonas fluorescens (strain SBW25)
C3JXX6 3.36e-24 111 41 5 190 3 ligA DNA ligase Pseudomonas fluorescens (strain SBW25)
A9BZW4 0.0 678 51 6 674 3 ligA DNA ligase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1WRA7 0.0 676 52 6 673 3 ligA DNA ligase Verminephrobacter eiseniae (strain EF01-2)
A4XVY5 0.0 676 55 4 597 3 ligA DNA ligase Pseudomonas mendocina (strain ymp)
A4XVY5 5.07e-21 101 40 4 169 3 ligA DNA ligase Pseudomonas mendocina (strain ymp)
B1Y6D4 0.0 671 50 7 708 3 ligA DNA ligase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1TR21 0.0 669 49 8 709 3 ligA DNA ligase Paracidovorax citrulli (strain AAC00-1)
Q48KR2 0.0 668 55 4 600 3 ligA DNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KR2 2.06e-24 112 42 4 176 3 ligA DNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B0KPX3 0.0 666 55 3 586 3 ligA DNA ligase Pseudomonas putida (strain GB-1)
B0KPX3 4.2e-23 108 40 3 196 3 ligA DNA ligase Pseudomonas putida (strain GB-1)
A5W0U0 0.0 666 56 3 587 3 ligA DNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W0U0 2.21e-22 105 42 3 175 3 ligA DNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B1JC06 0.0 665 55 3 589 3 ligA DNA ligase Pseudomonas putida (strain W619)
B1JC06 7.49e-23 107 41 3 177 3 ligA DNA ligase Pseudomonas putida (strain W619)
Q4ZVF6 0.0 664 55 4 600 3 ligA DNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q4ZVF6 1.22e-25 116 43 4 174 3 ligA DNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q88F25 0.0 663 55 3 587 3 ligA DNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88F25 1.89e-22 106 42 3 175 3 ligA DNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4KFH1 0.0 661 55 3 593 3 ligA DNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFH1 2.31e-24 112 43 5 178 3 ligA DNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A6V7X3 0.0 658 55 4 599 3 ligA DNA ligase Pseudomonas aeruginosa (strain PA7)
A6V7X3 1.37e-24 113 40 2 177 3 ligA DNA ligase Pseudomonas aeruginosa (strain PA7)
Q3KFB2 0.0 657 55 3 594 3 ligA DNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q3KFB2 5.93e-21 101 41 5 174 3 ligA DNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q9I3I4 0.0 655 55 3 598 3 ligA DNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I3I4 6.26e-26 117 41 2 177 3 ligA DNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ3 0.0 655 55 3 598 3 ligA DNA ligase Pseudomonas aeruginosa (strain LESB58)
B7UVJ3 6.26e-26 117 41 2 177 3 ligA DNA ligase Pseudomonas aeruginosa (strain LESB58)
A5EVZ5 0.0 654 51 3 670 3 ligA DNA ligase Dichelobacter nodosus (strain VCS1703A)
Q02K12 0.0 653 55 3 598 3 ligA DNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02K12 6.26e-26 117 41 2 177 3 ligA DNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
C1DN27 0.0 652 55 3 590 3 ligA DNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C1DN27 1.14e-17 91 37 4 166 3 ligA DNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1ICK0 0.0 650 54 3 595 3 ligA DNA ligase Pseudomonas entomophila (strain L48)
Q1ICK0 1.61e-21 103 39 3 173 3 ligA DNA ligase Pseudomonas entomophila (strain L48)
A1WY80 0.0 650 48 7 704 3 ligA DNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q87YY6 0.0 647 54 4 599 3 ligA DNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87YY6 2.04e-24 112 42 4 176 3 ligA DNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VKN0 0.0 644 54 3 592 3 ligA DNA ligase Stutzerimonas stutzeri (strain A1501)
A4VKN0 6.51e-24 110 40 2 175 3 ligA DNA ligase Stutzerimonas stutzeri (strain A1501)
B9M861 0.0 643 51 6 669 3 ligA DNA ligase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B9MIW4 0.0 643 48 7 707 3 ligA DNA ligase Acidovorax ebreus (strain TPSY)
A1W7N4 0.0 643 48 7 707 3 ligA DNA ligase Acidovorax sp. (strain JS42)
A2SGT2 0.0 640 50 6 672 3 ligA DNA ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5WCN7 0.0 637 50 9 679 3 ligA DNA ligase Psychrobacter sp. (strain PRwf-1)
B1HTW6 0.0 635 48 8 675 3 ligA DNA ligase Lysinibacillus sphaericus (strain C3-41)
Q1QDW8 0.0 633 50 8 662 3 ligA DNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B8D8M5 0.0 633 46 4 669 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B3E8F8 0.0 632 49 5 668 3 ligA DNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B8D6X9 0.0 631 45 5 674 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57172 0.0 630 45 4 669 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q39S28 0.0 630 49 7 675 3 ligA DNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5GA98 0.0 628 50 6 671 3 ligA DNA ligase Geotalea uraniireducens (strain Rf4)
Q1D0P7 0.0 628 49 6 664 3 ligA DNA ligase Myxococcus xanthus (strain DK1622)
Q3A2F5 0.0 627 48 8 671 3 ligA DNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8ETN6 0.0 627 49 8 679 3 ligA DNA ligase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q9KF37 0.0 627 47 6 670 3 ligA DNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7GFV1 0.0 625 47 7 676 3 ligA DNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q81ZG1 0.0 622 47 5 669 3 ligA DNA ligase Bacillus anthracis
C3L543 0.0 622 47 5 669 3 ligA DNA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBP1 0.0 622 47 5 669 3 ligA DNA ligase Bacillus anthracis (strain A0248)
Q6HP94 0.0 622 47 5 669 3 ligA DNA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EV74 0.0 622 47 5 669 3 ligA DNA ligase Bacillus cereus (strain 03BB102)
B7JM96 0.0 622 47 5 669 3 ligA DNA ligase Bacillus cereus (strain AH820)
A0R906 0.0 622 47 5 669 3 ligA DNA ligase Bacillus thuringiensis (strain Al Hakam)
Q4FUW9 0.0 621 49 7 662 3 ligA DNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7HVV8 0.0 621 50 11 690 3 ligA DNA ligase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q73EM3 0.0 620 47 5 669 3 ligA DNA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63GS3 0.0 620 47 5 669 3 ligA DNA ligase Bacillus cereus (strain ZK / E33L)
Q81IP2 0.0 620 47 5 669 3 ligA DNA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GKJ1 0.0 620 47 5 670 3 ligA DNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2LTN8 0.0 619 47 8 673 3 ligA DNA ligase Syntrophus aciditrophicus (strain SB)
Q1QNT2 0.0 619 49 8 702 3 ligA DNA ligase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B7IUW5 0.0 619 47 5 669 3 ligA DNA ligase Bacillus cereus (strain G9842)
B9J1L6 0.0 619 47 5 669 3 ligA DNA ligase Bacillus cereus (strain Q1)
B7HSW5 0.0 619 47 5 669 3 ligA DNA ligase Bacillus cereus (strain AH187)
B0TY02 0.0 618 45 4 669 3 ligA DNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B7H4U8 0.0 618 47 5 669 3 ligA DNA ligase Bacillus cereus (strain B4264)
B3QFL8 0.0 616 48 6 693 3 ligA DNA ligase Rhodopseudomonas palustris (strain TIE-1)
Q8PAB5 0.0 616 48 4 638 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PAB5 2.44e-16 87 56 0 76 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RUY2 0.0 616 48 4 638 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain B100)
B0RUY2 2.44e-16 87 56 0 76 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain B100)
Q4UTB0 0.0 616 48 4 638 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain 8004)
Q4UTB0 2.44e-16 87 56 0 76 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain 8004)
Q6N423 0.0 616 49 6 693 3 ligA DNA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A0Q7L0 0.0 616 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. novicida (strain U112)
A4IWW8 0.0 615 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NF60 0.0 615 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SFT1 0.0 615 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14GL3 0.0 615 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
Q3BV14 0.0 615 49 7 648 3 ligA DNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BV14 2.22e-17 90 38 4 171 3 ligA DNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5WJ30 0.0 614 48 6 658 3 ligA DNA ligase Shouchella clausii (strain KSM-K16)
Q8PM07 0.0 613 49 6 637 3 ligA DNA ligase Xanthomonas axonopodis pv. citri (strain 306)
Q8PM07 8.43e-17 88 34 9 256 3 ligA DNA ligase Xanthomonas axonopodis pv. citri (strain 306)
B5EP61 0.0 613 46 5 675 3 ligA DNA ligase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J653 0.0 613 46 5 675 3 ligA DNA ligase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q2A4C4 0.0 612 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A7NB34 0.0 611 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A9VRG3 0.0 611 46 5 669 3 ligA DNA ligase Bacillus mycoides (strain KBAB4)
A9A0L9 0.0 611 47 6 672 3 ligA DNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
C0QJ86 0.0 611 48 7 679 3 ligA DNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
O31498 0.0 611 47 5 664 3 ligA DNA ligase Bacillus subtilis (strain 168)
Q8CXK6 0.0 610 46 8 670 3 ligA DNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0BMQ3 0.0 610 45 4 668 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
B5EIJ0 0.0 610 48 6 667 3 ligA DNA ligase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q5L3B9 0.0 610 47 6 675 3 ligA DNA ligase Geobacillus kaustophilus (strain HTA426)
Q3STR7 0.0 608 48 9 704 3 ligA DNA ligase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
B2IGH4 0.0 607 48 10 679 3 ligA DNA ligase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
A0LI67 0.0 607 47 6 678 3 ligA DNA ligase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B6JB45 0.0 606 48 9 694 3 ligA DNA ligase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2RVV5 0.0 605 48 7 682 3 ligA DNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q65MR2 0.0 605 47 5 669 3 ligA DNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A3DE88 0.0 605 46 8 675 3 ligA DNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q1ME47 0.0 604 47 12 696 3 ligA DNA ligase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B8D122 0.0 604 47 6 671 3 ligA DNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q133Y4 0.0 602 48 8 693 3 ligA DNA ligase Rhodopseudomonas palustris (strain BisB5)
B6IRF1 0.0 602 47 8 690 3 ligA DNA ligase Rhodospirillum centenum (strain ATCC 51521 / SW)
B9KXM2 0.0 602 47 4 673 3 ligA DNA ligase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q74ER9 0.0 602 47 6 674 3 ligA DNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q89FV8 0.0 601 46 10 695 3 ligA DNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A5EPJ2 0.0 601 47 8 692 3 ligA DNA ligase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
O87703 0.0 600 46 5 674 1 ligA DNA ligase Geobacillus stearothermophilus
B1YJ17 0.0 600 48 6 666 3 ligA DNA ligase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q01NV7 0.0 599 47 9 668 3 ligA DNA ligase Solibacter usitatus (strain Ellin6076)
C0Z4D6 0.0 598 46 6 671 3 ligA DNA ligase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q07PR9 0.0 598 47 6 692 3 ligA DNA ligase Rhodopseudomonas palustris (strain BisA53)
A4YZJ3 0.0 597 46 10 696 3 ligA DNA ligase Bradyrhizobium sp. (strain ORS 278)
B7K8U0 0.0 596 44 3 674 3 ligA DNA ligase Gloeothece citriformis (strain PCC 7424)
Q837V6 0.0 595 46 5 665 1 ligA DNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
A4J703 0.0 595 45 7 673 3 ligA DNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q67KI8 0.0 595 47 7 670 3 ligA DNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B3PTU7 0.0 594 46 12 706 3 ligA DNA ligase Rhizobium etli (strain CIAT 652)
A4IJY6 0.0 594 46 6 669 3 ligA DNA ligase Geobacillus thermodenitrificans (strain NG80-2)
A9CIB3 0.0 594 45 10 705 3 ligA DNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
A8FAQ1 0.0 594 46 6 671 3 ligA DNA ligase Bacillus pumilus (strain SAFR-032)
Q2W0G3 0.0 593 48 10 682 3 ligA DNA ligase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
B5ZWH9 0.0 593 46 11 706 3 ligA DNA ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B8GAC1 0.0 593 46 5 684 3 ligA DNA ligase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q2IYJ4 0.0 592 47 7 694 3 ligA DNA ligase Rhodopseudomonas palustris (strain HaA2)
Q2K6D3 0.0 592 46 12 706 3 ligA DNA ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A8IGY0 0.0 591 47 9 707 3 ligA DNA ligase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A0AJL1 0.0 589 45 6 668 3 ligA DNA ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B1WZL6 0.0 589 45 6 672 3 ligA DNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
C1KW57 0.0 589 45 6 668 3 ligA DNA ligase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y6D0 0.0 588 45 6 668 3 ligA DNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B9LHI6 0.0 588 46 5 684 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WCA1 0.0 588 46 5 684 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A7Z261 0.0 588 46 5 664 3 ligA DNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8DFG5 0.0 587 45 6 668 3 ligA DNA ligase Listeria monocytogenes serotype 4a (strain HCC23)
Q11GT5 0.0 587 46 11 691 3 ligA DNA ligase Chelativorans sp. (strain BNC1)
A6WZR6 0.0 587 46 13 712 3 ligA DNA ligase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B9JY41 0.0 587 45 12 709 3 ligA DNA ligase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
B2A5W5 0.0 587 45 6 667 3 ligA DNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B9E830 0.0 586 45 7 670 3 ligA DNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q71YR0 0.0 586 45 6 668 3 ligA DNA ligase Listeria monocytogenes serotype 4b (strain F2365)
Q3MGE7 0.0 586 44 6 670 3 ligA DNA ligase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q92AQ0 0.0 586 45 6 668 3 ligA DNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
C3MEL9 0.0 585 45 12 697 3 ligA DNA ligase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5N2P4 0.0 585 46 7 677 3 ligA DNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RL0 0.0 585 46 7 677 3 ligA DNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B8FP44 0.0 584 47 6 668 3 ligA DNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B4RFE9 0.0 584 48 8 674 3 ligA DNA ligase Phenylobacterium zucineum (strain HLK1)
Q24QL5 0.0 584 47 6 668 3 ligA DNA ligase Desulfitobacterium hafniense (strain Y51)
Q8CRU0 0.0 583 44 6 667 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A6UB73 0.0 583 46 12 694 3 ligA DNA ligase Sinorhizobium medicae (strain WSM419)
Q166E0 0.0 583 46 10 698 3 ligA DNA ligase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A5CZ68 0.0 583 46 6 664 3 ligA DNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q49YU8 0.0 583 45 6 667 3 ligA DNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HN30 0.0 582 44 6 667 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5F9Z9 0.0 582 47 7 645 3 ligA DNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F9Z9 2.82e-16 86 61 0 71 3 ligA DNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P49421 0.0 581 47 5 672 1 ligA DNA ligase Rhodothermus marinus
Q5H057 0.0 581 45 6 652 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H057 4.36e-17 89 39 4 170 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P334 0.0 581 45 6 652 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P334 2.34e-17 90 39 4 170 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2J3P0 0.0 581 44 5 672 3 ligA DNA ligase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B9JH39 0.0 579 46 13 695 3 ligA DNA ligase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
C1F7S7 0.0 579 47 5 672 3 ligA DNA ligase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q92NM8 0.0 579 46 12 694 3 ligA DNA ligase Rhizobium meliloti (strain 1021)
Q8YW98 0.0 579 44 6 674 3 ligA DNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A1KSS7 0.0 578 46 7 647 3 ligA DNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1KSS7 1.88e-17 90 64 0 71 3 ligA DNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B4RJQ9 0.0 578 47 7 645 3 ligA DNA ligase Neisseria gonorrhoeae (strain NCCP11945)
B4RJQ9 9.26e-17 88 63 0 71 3 ligA DNA ligase Neisseria gonorrhoeae (strain NCCP11945)
Q1IHJ4 0.0 578 47 8 671 3 ligA DNA ligase Koribacter versatilis (strain Ellin345)
Q8YI56 0.0 578 44 10 709 3 ligA DNA ligase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q30ZK6 0.0 578 46 9 681 3 ligA DNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8FZQ3 0.0 578 44 10 709 3 ligA DNA ligase Brucella suis biovar 1 (strain 1330)
B0CHK8 0.0 578 44 10 709 3 ligA DNA ligase Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRG5 0.0 578 44 10 709 3 ligA DNA ligase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M679 0.0 578 44 10 709 3 ligA DNA ligase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57C89 0.0 578 44 10 709 3 ligA DNA ligase Brucella abortus biovar 1 (strain 9-941)
Q2YLZ6 0.0 578 44 10 709 3 ligA DNA ligase Brucella abortus (strain 2308)
B2S6P4 0.0 578 44 10 709 3 ligA DNA ligase Brucella abortus (strain S19)
Q6MRL9 0.0 578 44 8 666 3 ligA DNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C0RE59 0.0 577 44 10 709 3 ligA DNA ligase Brucella melitensis biotype 2 (strain ATCC 23457)
Q6GFF3 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain MRSA252)
A1IQR7 0.0 577 47 7 647 3 ligA DNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1IQR7 2.9e-17 89 63 0 71 3 ligA DNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q7A4Q5 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain N315)
Q99SY3 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEL8 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain COL)
A5IU71 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain JH9)
A6U309 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain JH1)
A7X432 0.0 577 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7A0H1 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain MW2)
Q9AIU7 0.0 576 45 6 666 1 ligA DNA ligase Staphylococcus aureus
A8Z2R8 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G829 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain MSSA476)
A6QID2 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain Newman)
Q2G1Y0 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFJ1 0.0 576 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain USA300)
B7K0A2 0.0 576 44 4 652 3 ligA DNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9K0E3 0.0 576 46 7 647 3 ligA DNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0E3 2.07e-17 90 64 0 71 3 ligA DNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M2U7 0.0 576 46 7 647 3 ligA DNA ligase Neisseria meningitidis serogroup C (strain 053442)
A9M2U7 2.07e-17 90 64 0 71 3 ligA DNA ligase Neisseria meningitidis serogroup C (strain 053442)
Q2YU70 0.0 575 45 6 666 3 ligA DNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
B0U5G7 0.0 575 46 4 637 3 ligA DNA ligase Xylella fastidiosa (strain M12)
B0U5G7 1.42e-15 84 35 2 166 3 ligA DNA ligase Xylella fastidiosa (strain M12)
B9DMU3 0.0 575 45 6 663 3 ligA DNA ligase Staphylococcus carnosus (strain TM300)
Q4L7L9 0.0 575 45 7 667 3 ligA DNA ligase Staphylococcus haemolyticus (strain JCSC1435)
A7IG64 0.0 574 46 9 689 3 ligA DNA ligase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
B5Y6V5 0.0 573 45 7 666 3 ligA DNA ligase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q87A88 0.0 572 46 4 637 3 ligA DNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87A88 3.44e-16 86 35 2 166 3 ligA DNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9S4 0.0 572 46 4 637 3 ligA DNA ligase Xylella fastidiosa (strain M23)
B2I9S4 3.44e-16 86 35 2 166 3 ligA DNA ligase Xylella fastidiosa (strain M23)
Q1AZ75 0.0 571 46 9 668 3 ligA DNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q0BV35 0.0 570 46 5 660 3 ligA DNA ligase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q492G5 0.0 570 46 3 586 3 ligA DNA ligase Blochmanniella pennsylvanica (strain BPEN)
Q9PAG2 0.0 570 46 4 637 3 ligA DNA ligase Xylella fastidiosa (strain 9a5c)
Q9PAG2 2.43e-15 83 35 2 166 3 ligA DNA ligase Xylella fastidiosa (strain 9a5c)
A5GWQ3 0.0 570 45 5 677 3 ligA DNA ligase Synechococcus sp. (strain RCC307)
Q0AZZ5 0.0 569 46 7 670 3 ligA DNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B5YIF8 0.0 568 44 7 671 3 ligA DNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P72588 0.0 568 44 2 652 3 ligA DNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1I551 0.0 568 46 5 669 3 ligA DNA ligase Desulforudis audaxviator (strain MP104C)
Q180F3 0.0 568 43 6 671 3 ligA DNA ligase Clostridioides difficile (strain 630)
B8JD56 0.0 568 45 8 684 3 ligA DNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q7NR81 0.0 566 47 6 615 3 ligA DNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NR81 7.86e-15 82 61 0 70 3 ligA DNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A4WRP6 0.0 566 46 8 679 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A9IW95 0.0 566 44 9 707 3 ligA DNA ligase Bartonella tribocorum (strain CIP 105476 / IBS 506)
B2FKJ1 0.0 566 56 1 483 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
B2FKJ1 7.88e-20 98 63 1 85 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
B2FKJ1 8.33e-11 68 35 0 93 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
Q6FZ81 0.0 566 43 9 709 3 ligA DNA ligase Bartonella quintana (strain Toulouse)
B4UDH6 0.0 566 44 8 684 3 ligA DNA ligase Anaeromyxobacter sp. (strain K)
B0KBN6 0.0 565 45 6 666 3 ligA DNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5VFJ8 0.0 565 48 10 693 3 ligA DNA ligase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
B0K3S1 0.0 564 45 6 666 3 ligA DNA ligase Thermoanaerobacter sp. (strain X514)
A1UTB5 0.0 564 44 12 708 3 ligA DNA ligase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B0JTW2 0.0 564 43 3 667 3 ligA DNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0C577 0.0 564 46 10 678 3 ligA DNA ligase Hyphomonas neptunium (strain ATCC 15444)
B1XLV0 0.0 563 45 5 660 3 ligA DNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q2INT9 0.0 563 44 9 683 3 ligA DNA ligase Anaeromyxobacter dehalogenans (strain 2CP-C)
A1VC99 0.0 563 46 9 677 3 ligA1 DNA ligase 1 Nitratidesulfovibrio vulgaris (strain DP4)
A5GPI9 0.0 562 43 6 689 3 ligA DNA ligase Synechococcus sp. (strain WH7803)
B4SP88 0.0 562 56 1 478 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
B4SP88 1.63e-19 97 63 1 85 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
B4SP88 5.46e-11 69 35 0 93 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
Q3AD38 0.0 562 45 7 670 3 ligA DNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1VDM7 0.0 562 44 8 682 3 ligA2 DNA ligase 2 Nitratidesulfovibrio vulgaris (strain DP4)
Q8XZJ7 0.0 561 47 8 610 3 ligA DNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZJ7 5.12e-21 101 37 5 208 3 ligA DNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q72BM7 0.0 561 44 8 678 3 ligA DNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A8LK52 0.0 561 46 9 672 3 ligA DNA ligase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
P28719 0.0 560 44 9 699 3 ligA DNA ligase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q6G2R5 0.0 560 44 10 706 3 ligA DNA ligase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A7H8A2 0.0 560 45 11 691 3 ligA DNA ligase Anaeromyxobacter sp. (strain Fw109-5)
Q3ZX08 0.0 559 44 8 679 3 ligA DNA ligase Dehalococcoides mccartyi (strain CBDB1)
A4XK85 0.0 558 45 7 671 3 ligA DNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q64TM7 0.0 558 41 6 670 3 ligA DNA ligase Bacteroides fragilis (strain YCH46)
B0TDL0 0.0 558 47 7 676 3 ligA DNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q8KF74 0.0 558 45 10 680 3 ligA DNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q0AMX9 0.0 557 45 7 677 3 ligA DNA ligase Maricaulis maris (strain MCS10)
A5FRL4 0.0 557 44 7 677 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q5LCI0 0.0 556 41 6 670 3 ligA DNA ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A3PJ74 0.0 556 46 9 681 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A5V1U3 0.0 555 45 6 690 3 ligA DNA ligase Roseiflexus sp. (strain RS-1)
Q3J355 0.0 555 46 9 681 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B8DJT6 0.0 555 44 11 686 3 ligA DNA ligase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B0C308 0.0 555 43 5 670 3 ligA DNA ligase Acaryochloris marina (strain MBIC 11017)
Q8DKK2 0.0 554 44 6 683 3 ligA DNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C0QVE5 0.0 554 43 7 665 3 ligA DNA ligase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
A6L5G8 0.0 554 42 6 668 3 ligA DNA ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A9AXP4 0.0 553 45 6 663 3 ligA DNA ligase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q2G7J5 0.0 553 44 11 705 3 ligA DNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2RGY0 0.0 553 45 7 669 3 ligA DNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B9KRK2 0.0 552 46 9 681 3 ligA DNA ligase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q8RC42 0.0 552 45 8 666 3 ligA DNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q2S459 0.0 551 46 6 659 3 ligA DNA ligase Salinibacter ruber (strain DSM 13855 / M31)
A2C5E6 0.0 551 43 10 693 3 ligA DNA ligase Prochlorococcus marinus (strain NATL1A)
A9H0L6 0.0 551 45 8 680 3 ligA DNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3AGK2 0.0 551 45 7 672 3 ligA DNA ligase Synechococcus sp. (strain CC9605)
Q2N9V6 0.0 550 45 11 709 3 ligA DNA ligase Erythrobacter litoralis (strain HTCC2594)
B2UB00 0.0 549 47 8 609 3 ligA DNA ligase Ralstonia pickettii (strain 12J)
B2UB00 1.53e-18 94 70 0 72 3 ligA DNA ligase Ralstonia pickettii (strain 12J)
A5FE87 0.0 549 42 7 674 3 ligA DNA ligase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B9MK54 0.0 549 43 9 673 3 ligA DNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A7NHP6 0.0 547 45 6 677 3 ligA DNA ligase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q46IA9 0.0 547 42 8 692 3 ligA DNA ligase Prochlorococcus marinus (strain NATL2A)
B3DWU2 0.0 546 42 8 670 3 ligA DNA ligase Methylacidiphilum infernorum (isolate V4)
Q38VC5 0.0 546 43 5 664 3 ligA DNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q98KC4 0.0 545 44 10 708 3 ligA DNA ligase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3Z8W1 0.0 545 43 7 679 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8A9C1 0.0 545 41 8 674 3 ligA DNA ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q3AUH7 0.0 545 44 5 672 3 ligA DNA ligase Synechococcus sp. (strain CC9902)
Q7U3P1 0.0 545 43 6 675 3 ligA DNA ligase Parasynechococcus marenigrum (strain WH8102)
Q88XQ0 0.0 543 44 6 665 3 ligA DNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7VRU2 0.0 543 44 5 585 3 ligA DNA ligase Blochmanniella floridana
Q2JLU3 0.0 542 43 6 670 3 ligA DNA ligase Synechococcus sp. (strain JA-2-3B'a(2-13))
A1B9F5 0.0 542 44 10 723 3 ligA DNA ligase Paracoccus denitrificans (strain Pd 1222)
A0LDY1 0.0 542 50 5 567 3 ligA DNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LDY1 9.6e-21 100 48 0 96 3 ligA DNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B2GDS9 0.0 542 43 6 665 3 ligA DNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B3QLI5 0.0 542 43 9 679 3 ligA DNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1H072 0.0 540 43 7 665 3 ligA DNA ligase Endomicrobium trichonymphae
Q11VI1 0.0 540 41 5 669 3 ligA DNA ligase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q5FUI5 0.0 539 43 7 668 3 ligA DNA ligase Gluconobacter oxydans (strain 621H)
Q03JF6 0.0 538 44 9 670 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q2J6U3 0.0 538 43 5 665 3 ligA DNA ligase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B8HV17 0.0 538 42 5 706 3 ligA DNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q5M382 0.0 537 43 8 669 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYL9 0.0 537 43 8 669 3 ligA DNA ligase Streptococcus thermophilus (strain CNRZ 1066)
B8J0Q0 0.0 537 43 9 687 3 ligA DNA ligase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
B4SCX5 0.0 536 43 6 674 3 ligA DNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
Q9CIE4 0.0 536 43 7 670 3 ligA DNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
B4U8X0 0.0 535 43 9 672 3 ligA DNA ligase Hydrogenobaculum sp. (strain Y04AAS1)
Q2JW63 0.0 535 43 6 665 3 ligA DNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q9ZFY8 0.0 533 45 9 674 3 ligA DNA ligase Thermus sp. (strain AK16D)
Q1WSH6 0.0 533 41 6 677 3 ligA DNA ligase Ligilactobacillus salivarius (strain UCC118)
A6LN55 0.0 533 42 7 670 3 ligA DNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A6H0N9 0.0 532 40 7 669 3 ligA DNA ligase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q8E084 0.0 532 42 9 671 3 ligA DNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1K8 1.15e-180 531 42 9 671 3 ligA DNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1RK40 1.24e-180 532 43 8 677 3 ligA DNA ligase Rickettsia bellii (strain RML369-C)
A9BDC5 1.82e-180 532 40 7 695 3 ligA DNA ligase Prochlorococcus marinus (strain MIT 9211)
Q1GVQ2 2.02e-180 533 47 14 689 3 ligA DNA ligase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A0LSQ7 4.72e-180 531 43 7 673 3 ligA DNA ligase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A8AY10 4.9e-180 530 43 8 663 3 ligA DNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A3CNX3 1.13e-179 528 43 9 670 3 ligA DNA ligase Streptococcus sanguinis (strain SK36)
Q8E5W1 1.29e-179 528 42 9 671 3 ligA DNA ligase Streptococcus agalactiae serotype III (strain NEM316)
P49422 1.68e-179 529 45 11 677 1 ligA DNA ligase Thermus scotoductus
A5FWJ5 3.72e-179 528 46 10 655 3 ligA DNA ligase Acidiphilium cryptum (strain JF-5)
A8GXT8 3.95e-179 528 42 8 677 3 ligA DNA ligase Rickettsia bellii (strain OSU 85-389)
Q03DT9 6.21e-179 528 43 7 664 3 ligA DNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B9DRS2 7.52e-179 526 42 7 667 3 ligA DNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q9A0J5 8.29e-179 526 42 9 675 3 ligA DNA ligase Streptococcus pyogenes serotype M1

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08995
Feature type CDS
Gene ligA
Product NAD-dependent DNA ligase LigA
Location 1960076 - 1962103 (strand: -1)
Length 2028 (nucleotides) / 675 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_340
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00533 BRCA1 C Terminus (BRCT) domain
PF01653 NAD-dependent DNA ligase adenylation domain
PF03119 NAD-dependent DNA ligase C4 zinc finger domain
PF03120 NAD-dependent DNA ligase OB-fold domain
PF12826 Helix-hairpin-helix motif
PF14520 Helix-hairpin-helix domain
PF22745 DNA ligase-like, N-terminal NAD+-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0272 Replication, recombination and repair (L) L NAD-dependent DNA ligase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01972 DNA ligase (NAD+) [EC:6.5.1.2] DNA replication
Base excision repair
Nucleotide excision repair
Mismatch repair
-

Protein Sequence

MNQNIQQQIDELRVTLRHHEYLYHVMDAPEIPDAEYDRLMNKLKALEAEHPELITPDSPTQRVGALPLTAFEQVRHEIPMLSLDNAFDETTYLAFDKRLRERLKNNEEITFCCELKLDGLAVSLLYENGRLVQAATRGDGTTGENITENVRTIKAIPLRLYGDNIPARIEIRGEVFMTEKGFEHLNEEARRTGGKVFANPRNAAAGSLRQLDPRITAKRPLTFFCYGVGVLEGGELPTSHYARLQQFKKWGLPVSDAIKLCTGTKAVLDFYHHVAEIRPNLGFDIDGVVIKVDDIALQEELGFVSRAPRWAIAYKFQAQEQMTVIKDVEFQVGRTGAITPVARLDPVQVAGVIVSNATLHNADEIERLGLRIGDTVVIRRAGDVIPQVVSVIEEKRPENAQEIVFPTQCPICQSDIERIEGEAVARCTGGLICAAQRKEALKHFVSRRAMDVDGMGDKIIDQLVEKEYVKTPADLFRLDEKILSGLERMGEKSAKKLLNALEKAKSTTFARFIYALGIREVGEATANGLTAHFVSLEALREANIEALKAVPDVGDIVAKHVVNFFQEEHNKNVIDQLVNDIGITWPAPVVATHEAGDNPFAGKTVVLTGSLSQLTRDEAKDRLVALGAKVSGSVSKKTDMVIAGEAAGSKLAKANELGITVIDEDEMIRLLDQSK

Flanking regions ( +/- flanking 50bp)

ACAACCTCAGCCCCCGCTTGCGGGGGCTTTTCTTTCTTTGGTGATACCTCATGAATCAAAATATTCAACAACAAATTGATGAACTTCGCGTTACACTACGTCACCATGAATATCTCTATCATGTCATGGACGCACCTGAAATTCCTGATGCTGAATACGATCGCTTAATGAATAAGCTAAAAGCATTAGAAGCCGAACATCCTGAACTCATTACCCCAGATTCTCCTACTCAACGGGTAGGGGCATTACCTTTAACGGCTTTTGAGCAAGTTAGACATGAAATTCCAATGCTCTCTTTAGATAATGCTTTTGATGAAACAACCTATTTAGCATTTGATAAACGTTTACGTGAACGTCTGAAAAATAATGAAGAGATCACTTTTTGTTGTGAATTAAAATTAGATGGACTTGCGGTAAGTCTACTGTATGAAAATGGTCGCTTAGTACAAGCTGCAACCCGTGGTGATGGTACCACTGGAGAAAATATTACTGAGAATGTCAGAACCATTAAAGCCATTCCTTTGCGTTTATATGGCGATAATATCCCCGCACGAATTGAAATTCGTGGAGAAGTCTTTATGACTGAAAAAGGGTTTGAGCATTTAAATGAAGAAGCTCGACGCACGGGAGGAAAAGTATTTGCTAATCCTCGTAATGCAGCAGCGGGTTCATTACGTCAGTTAGATCCTCGTATTACAGCCAAGCGCCCTTTGACTTTCTTCTGTTATGGTGTTGGCGTGCTTGAAGGCGGTGAATTACCGACAAGTCATTATGCACGCTTACAGCAATTTAAAAAATGGGGATTACCTGTTAGTGATGCTATTAAATTATGTACCGGAACTAAAGCTGTACTTGATTTTTACCATCATGTAGCAGAAATTCGCCCTAATCTAGGCTTTGATATTGATGGTGTGGTTATCAAAGTAGATGATATAGCTCTACAAGAAGAGTTGGGATTTGTGTCTCGTGCTCCCCGTTGGGCGATTGCTTACAAATTCCAAGCCCAAGAGCAGATGACGGTGATTAAAGATGTTGAATTTCAAGTGGGGCGTACAGGGGCGATTACACCTGTCGCTCGTTTAGATCCCGTACAAGTGGCAGGGGTAATAGTCAGTAATGCCACACTTCATAATGCTGATGAAATTGAACGTTTAGGATTACGTATTGGTGATACGGTGGTTATTCGCCGTGCAGGCGATGTTATTCCTCAGGTTGTGAGTGTGATTGAAGAAAAACGCCCTGAGAATGCACAAGAAATTGTTTTTCCAACCCAATGCCCTATTTGTCAATCTGATATTGAGCGTATAGAAGGTGAGGCTGTTGCCCGCTGCACGGGGGGATTAATTTGTGCAGCGCAACGTAAAGAGGCGCTTAAACATTTCGTTTCTCGTCGTGCGATGGATGTTGACGGCATGGGAGATAAAATTATCGACCAATTGGTTGAAAAAGAGTATGTCAAAACACCGGCTGATTTATTCCGTTTAGATGAAAAGATCTTATCTGGTTTAGAACGTATGGGGGAGAAATCAGCCAAAAAACTGCTTAATGCATTAGAAAAAGCAAAATCAACCACTTTTGCCCGTTTTATCTATGCCCTTGGTATTCGTGAAGTAGGAGAAGCAACGGCCAATGGATTAACCGCTCATTTTGTTTCATTAGAGGCATTACGTGAAGCAAATATTGAAGCCTTAAAGGCAGTTCCTGATGTGGGTGATATTGTTGCAAAGCATGTGGTTAATTTTTTCCAAGAAGAACATAATAAAAATGTGATTGATCAACTTGTTAATGACATTGGCATTACTTGGCCGGCACCGGTTGTGGCTACTCATGAAGCAGGTGATAATCCTTTTGCTGGTAAAACAGTCGTGCTGACAGGCTCTCTTTCTCAATTAACGCGAGATGAAGCAAAAGATAGATTAGTTGCACTTGGTGCAAAAGTGAGTGGTAGTGTTTCGAAAAAGACAGATATGGTCATTGCTGGTGAAGCGGCGGGTTCTAAATTAGCCAAAGCAAATGAATTAGGTATTACTGTTATTGATGAAGACGAAATGATCCGCTTGCTTGATCAATCTAAATAATCGTTTACAATAAACTTAGATGCTATTGAGAGCAGTTCTCAGTAGCATCT