Homologs in group_305

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11620 FBDBKF_11620 91.8 Morganella morganii S1 ligA NAD-dependent DNA ligase LigA
EHELCC_17540 EHELCC_17540 91.8 Morganella morganii S2 ligA NAD-dependent DNA ligase LigA
NLDBIP_18750 NLDBIP_18750 91.8 Morganella morganii S4 ligA NAD-dependent DNA ligase LigA
LHKJJB_17980 LHKJJB_17980 91.8 Morganella morganii S3 ligA NAD-dependent DNA ligase LigA
HKOGLL_18670 HKOGLL_18670 91.8 Morganella morganii S5 ligA NAD-dependent DNA ligase LigA
F4V73_RS14615 F4V73_RS14615 28.5 Morganella psychrotolerans ligB NAD-dependent DNA ligase LigB
PMI_RS08995 PMI_RS08995 76.8 Proteus mirabilis HI4320 ligA NAD-dependent DNA ligase LigA

Distribution of the homologs in the orthogroup group_305

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_305

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZR2 0.0 1072 76 0 670 3 ligA DNA ligase Proteus mirabilis (strain HI4320)
A4WD23 0.0 1060 76 1 669 3 ligA DNA ligase Enterobacter sp. (strain 638)
A1JLA4 0.0 1058 77 1 668 3 ligA DNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7MBH2 0.0 1057 77 0 663 3 ligA DNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GHF2 0.0 1053 76 1 670 3 ligA DNA ligase Serratia proteamaculans (strain 568)
A4TMG4 0.0 1053 76 1 668 3 ligA DNA ligase Yersinia pestis (strain Pestoides F)
Q1CJV7 0.0 1053 76 1 668 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZH0 0.0 1053 76 1 668 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q7CJF3 0.0 1053 76 1 668 3 ligA DNA ligase Yersinia pestis
Q1C5X9 0.0 1053 76 1 668 3 ligA DNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
Q668M6 0.0 1051 76 1 668 3 ligA DNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K917 0.0 1051 76 1 668 3 ligA DNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q0TF55 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R8W1 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LMK5 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
Q8FFC1 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADS8 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli O1:K1 / APEC
B7MHR5 0.0 1051 75 1 668 3 ligA DNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1JFZ0 0.0 1050 76 1 668 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FGC2 0.0 1050 76 1 668 3 ligA DNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q8ZN89 0.0 1049 76 1 667 3 ligA DNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8ADI2 0.0 1049 75 1 668 3 ligA DNA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LL73 0.0 1048 75 1 668 3 ligA DNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2VE40 0.0 1048 76 1 668 3 ligA DNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P15042 0.0 1048 75 1 668 1 ligA DNA ligase Escherichia coli (strain K12)
B1IX60 0.0 1048 75 1 668 3 ligA DNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XA82 0.0 1048 75 1 668 3 ligA DNA ligase Escherichia coli (strain K12 / DH10B)
A8A2Q7 0.0 1048 75 1 668 3 ligA DNA ligase Escherichia coli O9:H4 (strain HS)
B5BB72 0.0 1047 76 1 667 3 ligA DNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNE2 0.0 1047 76 1 667 3 ligA DNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7NPU7 0.0 1047 75 1 668 3 ligA DNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A7MKW4 0.0 1047 75 0 669 3 ligA DNA ligase Cronobacter sakazakii (strain ATCC BAA-894)
A9MIG0 0.0 1046 76 1 667 3 ligA DNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6TC47 0.0 1046 76 1 667 3 ligA DNA ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B6I4Y8 0.0 1046 75 1 668 3 ligA DNA ligase Escherichia coli (strain SE11)
B7M6S1 0.0 1046 75 1 668 3 ligA DNA ligase Escherichia coli O8 (strain IAI1)
B7MY64 0.0 1046 75 1 668 3 ligA DNA ligase Escherichia coli O81 (strain ED1a)
B7LCF6 0.0 1046 75 1 668 3 ligA DNA ligase Escherichia coli (strain 55989 / EAEC)
A7ZPL2 0.0 1046 75 1 668 3 ligA DNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32DE2 0.0 1046 75 1 668 3 ligA DNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
B7UGB2 0.0 1045 75 1 668 3 ligA DNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4TQF8 0.0 1045 76 1 668 3 ligA DNA ligase Salmonella schwarzengrund (strain CVM19633)
B7N602 0.0 1045 75 1 668 3 ligA DNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3YZD1 0.0 1044 74 1 668 3 ligA DNA ligase Shigella sonnei (strain Ss046)
Q8Z4W4 0.0 1044 76 1 667 3 ligA DNA ligase Salmonella typhi
C0PZB4 0.0 1044 76 1 667 3 ligA DNA ligase Salmonella paratyphi C (strain RKS4594)
A9N362 0.0 1044 76 1 667 3 ligA DNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F0F5 0.0 1044 76 1 668 3 ligA DNA ligase Salmonella agona (strain SL483)
B4SZU5 0.0 1043 76 1 667 3 ligA DNA ligase Salmonella newport (strain SL254)
B5YZV8 0.0 1043 74 1 668 3 ligA DNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBL5 0.0 1043 74 1 668 3 ligA DNA ligase Escherichia coli O157:H7
Q6D165 0.0 1043 75 1 672 3 ligA DNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4TCF6 0.0 1042 76 1 667 3 ligA DNA ligase Salmonella heidelberg (strain SL476)
Q57LT1 0.0 1042 76 1 667 3 ligA DNA ligase Salmonella choleraesuis (strain SC-B67)
B5R3V4 0.0 1041 76 1 667 3 ligA DNA ligase Salmonella enteritidis PT4 (strain P125109)
B5RCP9 0.0 1040 75 1 667 3 ligA DNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5XVT4 0.0 1040 76 1 667 3 ligA DNA ligase Klebsiella pneumoniae (strain 342)
Q31Y68 0.0 1040 74 1 668 3 ligA DNA ligase Shigella boydii serotype 4 (strain Sb227)
B5FQB9 0.0 1040 75 1 667 3 ligA DNA ligase Salmonella dublin (strain CT_02021853)
Q83K81 0.0 1038 74 1 668 3 ligA DNA ligase Shigella flexneri
Q0T298 0.0 1038 74 1 668 3 ligA DNA ligase Shigella flexneri serotype 5b (strain 8401)
Q2NSC2 0.0 955 70 2 670 3 ligA DNA ligase Sodalis glossinidius (strain morsitans)
Q5E3L1 0.0 892 64 2 669 3 ligA DNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGU7 0.0 892 64 2 669 3 ligA DNA ligase Aliivibrio fischeri (strain MJ11)
Q6LTU5 0.0 867 62 3 672 3 ligA DNA ligase Photobacterium profundum (strain SS9)
Q65RN7 0.0 863 62 3 670 3 ligA DNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q87RJ4 0.0 860 62 2 669 3 ligA DNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7VIK3 0.0 860 62 3 673 3 ligA DNA ligase Vibrio atlanticus (strain LGP32)
B0USD9 0.0 860 61 3 668 3 ligA DNA ligase Histophilus somni (strain 2336)
Q0I2H6 0.0 859 61 3 668 3 ligA DNA ligase Histophilus somni (strain 129Pt)
A6VR16 0.0 859 61 3 670 3 ligA DNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4K4K4 0.0 857 60 4 689 3 ligA DNA ligase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A5UD04 0.0 857 62 4 669 3 ligA DNA ligase Haemophilus influenzae (strain PittEE)
A5UIM6 0.0 856 62 4 669 3 ligA DNA ligase Haemophilus influenzae (strain PittGG)
Q9CKA9 0.0 856 62 3 668 3 ligA DNA ligase Pasteurella multocida (strain Pm70)
P43813 0.0 855 62 4 669 1 ligA DNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B6EJQ6 0.0 855 60 2 669 3 ligA DNA ligase Aliivibrio salmonicida (strain LFI1238)
Q4QLJ0 0.0 853 62 4 669 3 ligA DNA ligase Haemophilus influenzae (strain 86-028NP)
B8F314 0.0 849 61 4 671 3 ligA DNA ligase Glaesserella parasuis serovar 5 (strain SH0165)
A0KHL9 0.0 843 64 4 660 3 ligA DNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8DFK5 0.0 842 61 2 663 3 ligA DNA ligase Vibrio vulnificus (strain CMCP6)
A8H376 0.0 842 60 4 670 3 ligA DNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0BQN6 0.0 842 62 4 664 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q7MMT5 0.0 841 61 2 663 3 ligA DNA ligase Vibrio vulnificus (strain YJ016)
Q9KTD1 0.0 841 62 2 670 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B3H275 0.0 840 62 4 664 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
C3LTL9 0.0 838 62 2 670 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain M66-2)
A5F2W3 0.0 838 62 2 670 3 ligA DNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MT54 0.0 837 61 2 664 3 ligA DNA ligase Vibrio campbellii (strain ATCC BAA-1116)
B0TKB2 0.0 836 60 4 670 3 ligA DNA ligase Shewanella halifaxensis (strain HAW-EB4)
Q15UZ1 0.0 835 59 4 666 3 ligA DNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4SKA6 0.0 835 63 3 662 3 ligA DNA ligase Aeromonas salmonicida (strain A449)
A3N1V2 0.0 833 61 4 664 3 ligA DNA ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3QFJ5 0.0 831 60 4 669 3 ligA DNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q3IKB8 0.0 831 59 2 669 3 ligA DNA ligase Pseudoalteromonas translucida (strain TAC 125)
A8FU26 0.0 817 59 4 669 3 ligA DNA ligase Shewanella sediminis (strain HAW-EB3)
B1KJT5 0.0 815 59 4 667 3 ligA DNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A0KVI4 0.0 813 58 4 671 3 ligA DNA ligase Shewanella sp. (strain ANA-3)
Q7VMX7 0.0 813 59 5 679 3 ligA DNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8GTL0 0.0 812 60 1 670 3 ligA DNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q0HWD2 0.0 812 58 4 671 3 ligA DNA ligase Shewanella sp. (strain MR-7)
B8CN91 0.0 810 58 4 669 3 ligA DNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0HK31 0.0 808 58 4 671 3 ligA DNA ligase Shewanella sp. (strain MR-4)
B3PGQ8 0.0 803 57 3 670 3 ligA DNA ligase Cellvibrio japonicus (strain Ueda107)
Q8ED70 0.0 803 58 4 665 3 ligA DNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6WPS5 0.0 802 58 4 665 3 ligA DNA ligase Shewanella baltica (strain OS185)
A9L5Z1 0.0 802 58 4 665 3 ligA DNA ligase Shewanella baltica (strain OS195)
Q5QUK1 0.0 800 58 4 670 3 ligA DNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B8EEK5 0.0 799 58 4 665 3 ligA DNA ligase Shewanella baltica (strain OS223)
A1RII7 0.0 798 58 4 670 3 ligA DNA ligase Shewanella sp. (strain W3-18-1)
A4Y802 0.0 798 58 4 670 3 ligA DNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q21JI8 0.0 795 58 2 665 3 ligA DNA ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1S5R7 0.0 794 58 5 673 3 ligA DNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q2SD47 0.0 791 57 4 669 3 ligA DNA ligase Hahella chejuensis (strain KCTC 2396)
Q1QZP4 0.0 783 60 3 661 3 ligA DNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q080K9 0.0 783 56 4 670 3 ligA DNA ligase Shewanella frigidimarina (strain NCIMB 400)
Q12L82 0.0 777 57 4 669 3 ligA DNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q470D2 0.0 764 58 4 676 3 ligA DNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q47YI0 0.0 756 55 5 685 3 ligA DNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1LU20 0.0 749 53 4 670 3 ligA DNA ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
B6J878 0.0 748 53 2 669 3 ligA DNA ligase Coxiella burnetii (strain CbuK_Q154)
B6J1C6 0.0 747 53 2 669 3 ligA DNA ligase Coxiella burnetii (strain CbuG_Q212)
A9KCS0 0.0 745 53 2 669 3 ligA DNA ligase Coxiella burnetii (strain Dugway 5J108-111)
A6W0S9 0.0 744 56 4 659 3 ligA DNA ligase Marinomonas sp. (strain MWYL1)
Q1LNG5 0.0 744 56 4 695 3 ligA DNA ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q83DZ6 0.0 743 53 2 669 3 ligA DNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NC33 0.0 743 53 2 669 3 ligA DNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A1TZT9 0.0 741 55 2 672 3 ligA DNA ligase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0KA11 0.0 739 57 5 669 3 ligA DNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q13XB0 0.0 736 57 3 665 3 ligA DNA ligase Paraburkholderia xenovorans (strain LB400)
B3R2C2 0.0 732 56 4 669 3 ligA DNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B2JID1 0.0 730 56 2 660 3 ligA DNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B2T5K0 0.0 728 56 2 665 3 ligA DNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A4SYV5 0.0 728 54 4 677 3 ligA DNA ligase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q5WXV3 0.0 726 54 3 673 3 ligA DNA ligase Legionella pneumophila (strain Lens)
Q5ZWX6 0.0 726 54 4 675 3 ligA DNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6E6 0.0 723 54 4 675 3 ligA DNA ligase Legionella pneumophila (strain Paris)
A5IFV1 0.0 722 54 4 675 3 ligA DNA ligase Legionella pneumophila (strain Corby)
A9AIK9 0.0 722 56 2 668 3 ligA DNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
B1XTU0 0.0 720 54 4 677 3 ligA DNA ligase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q31G89 0.0 719 52 4 665 3 ligA DNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q63T07 0.0 719 56 2 668 3 ligA DNA ligase Burkholderia pseudomallei (strain K96243)
Q604U8 0.0 719 55 4 663 3 ligA DNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1V575 0.0 718 56 2 668 3 ligA DNA ligase Burkholderia mallei (strain SAVP1)
Q62JB9 0.0 718 56 2 668 3 ligA DNA ligase Burkholderia mallei (strain ATCC 23344)
A2SB66 0.0 718 56 2 668 3 ligA DNA ligase Burkholderia mallei (strain NCTC 10229)
A3MKU9 0.0 718 56 2 668 3 ligA DNA ligase Burkholderia mallei (strain NCTC 10247)
Q3JR23 0.0 717 56 2 668 3 ligA DNA ligase Burkholderia pseudomallei (strain 1710b)
A3NWN7 0.0 717 56 2 668 3 ligA DNA ligase Burkholderia pseudomallei (strain 1106a)
A4G4R4 0.0 717 55 3 662 3 ligA DNA ligase Herminiimonas arsenicoxydans
B4ECN6 0.0 717 55 2 668 3 ligA DNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q3JAI1 0.0 716 53 5 667 3 ligA DNA ligase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A3NAV3 0.0 716 55 2 668 3 ligA DNA ligase Burkholderia pseudomallei (strain 668)
A6SZQ8 0.0 716 55 4 662 3 ligA DNA ligase Janthinobacterium sp. (strain Marseille)
Q1BHI7 0.0 716 55 2 668 3 ligA DNA ligase Burkholderia orbicola (strain AU 1054)
A0K8E8 0.0 716 55 2 668 3 ligA DNA ligase Burkholderia cenocepacia (strain HI2424)
A4JF81 0.0 714 55 2 668 3 ligA DNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q2SX03 0.0 714 55 2 661 3 ligA DNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B1JUF5 0.0 714 55 2 668 3 ligA DNA ligase Burkholderia orbicola (strain MC0-3)
B1YSH2 0.0 713 55 2 668 3 ligA DNA ligase Burkholderia ambifaria (strain MC40-6)
Q0BE10 0.0 709 55 2 668 3 ligA DNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q39F38 0.0 707 54 2 668 3 ligA DNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C1D4R5 0.0 704 55 6 672 3 ligA DNA ligase Laribacter hongkongensis (strain HLHK9)
Q1H1G6 0.0 690 52 8 677 3 ligA DNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q7W0T4 0.0 686 52 8 694 3 ligA DNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WCJ7 0.0 685 52 8 694 3 ligA DNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9II69 0.0 684 53 8 694 3 ligA DNA ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7VRX7 0.0 682 52 8 694 3 ligA DNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0AAV2 0.0 680 53 4 664 3 ligA DNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q12AD4 0.0 679 52 8 679 3 ligA DNA ligase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q82TW6 0.0 679 51 4 674 3 ligA DNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AHH6 0.0 679 51 4 675 3 ligA DNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2KUU5 0.0 675 51 8 687 3 ligA DNA ligase Bordetella avium (strain 197N)
A1VN98 0.0 670 52 7 679 3 ligA DNA ligase Polaromonas naphthalenivorans (strain CJ2)
Q5NYU3 0.0 669 52 6 669 3 ligA DNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q0VR01 0.0 669 56 3 600 3 ligA DNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VR01 1.18e-16 87 36 4 175 3 ligA DNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q47FA0 0.0 667 53 4 669 3 ligA DNA ligase Dechloromonas aromatica (strain RCB)
A9BZW4 0.0 665 52 6 673 3 ligA DNA ligase Delftia acidovorans (strain DSM 14801 / SPH-1)
B0V8E4 0.0 662 50 6 674 3 ligA DNA ligase Acinetobacter baumannii (strain AYE)
A3M2U3 0.0 662 50 6 674 3 ligA DNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B7I790 0.0 662 50 6 674 3 ligA DNA ligase Acinetobacter baumannii (strain AB0057)
B7GZ71 0.0 662 50 6 674 3 ligA DNA ligase Acinetobacter baumannii (strain AB307-0294)
Q6FDW0 0.0 662 50 6 674 3 ligA DNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0VU02 0.0 661 49 6 674 3 ligA DNA ligase Acinetobacter baumannii (strain SDF)
B2HUJ5 0.0 661 50 6 670 3 ligA DNA ligase Acinetobacter baumannii (strain ACICU)
B1Y6D4 0.0 660 52 8 709 3 ligA DNA ligase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2YBB7 0.0 659 50 6 687 3 ligA DNA ligase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q21WC8 0.0 659 51 7 673 3 ligA DNA ligase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1K713 0.0 659 52 6 661 3 ligA DNA ligase Azoarcus sp. (strain BH72)
A1WRA7 0.0 658 53 6 672 3 ligA DNA ligase Verminephrobacter eiseniae (strain EF01-2)
Q3SL40 0.0 657 51 8 671 3 ligA DNA ligase Thiobacillus denitrificans (strain ATCC 25259)
B1JC06 0.0 650 57 3 587 3 ligA DNA ligase Pseudomonas putida (strain W619)
B1JC06 5.62e-22 104 39 4 180 3 ligA DNA ligase Pseudomonas putida (strain W619)
Q48KR2 0.0 650 55 4 601 3 ligA DNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KR2 4.88e-21 101 40 5 171 3 ligA DNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A1TR21 0.0 649 50 8 708 3 ligA DNA ligase Paracidovorax citrulli (strain AAC00-1)
A5EVZ5 0.0 647 50 2 668 3 ligA DNA ligase Dichelobacter nodosus (strain VCS1703A)
A4XVY5 0.0 645 54 4 596 3 ligA DNA ligase Pseudomonas mendocina (strain ymp)
A4XVY5 5.2e-23 108 41 4 173 3 ligA DNA ligase Pseudomonas mendocina (strain ymp)
Q4ZVF6 0.0 645 54 4 601 3 ligA DNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q4ZVF6 4.59e-21 102 40 5 170 3 ligA DNA ligase Pseudomonas syringae pv. syringae (strain B728a)
A5W0U0 0.0 645 56 3 585 3 ligA DNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W0U0 2.17e-22 106 30 9 340 3 ligA DNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KPX3 0.0 644 56 4 586 3 ligA DNA ligase Pseudomonas putida (strain GB-1)
B0KPX3 1.97e-21 103 39 4 179 3 ligA DNA ligase Pseudomonas putida (strain GB-1)
Q88F25 0.0 642 56 4 586 3 ligA DNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88F25 2.6e-22 105 30 9 340 3 ligA DNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C3JXX6 0.0 642 55 3 589 3 ligA DNA ligase Pseudomonas fluorescens (strain SBW25)
C3JXX6 4.88e-23 108 41 6 181 3 ligA DNA ligase Pseudomonas fluorescens (strain SBW25)
Q4KFH1 0.0 635 55 3 592 3 ligA DNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFH1 6.15e-24 110 42 4 170 3 ligA DNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1HTW6 0.0 632 48 5 671 3 ligA DNA ligase Lysinibacillus sphaericus (strain C3-41)
Q1QDW8 0.0 632 50 8 678 3 ligA DNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1ICK0 0.0 632 55 5 596 3 ligA DNA ligase Pseudomonas entomophila (strain L48)
Q1ICK0 9.03e-22 103 41 3 168 3 ligA DNA ligase Pseudomonas entomophila (strain L48)
A6V7X3 0.0 632 55 4 592 3 ligA DNA ligase Pseudomonas aeruginosa (strain PA7)
A6V7X3 1.38e-21 103 39 3 169 3 ligA DNA ligase Pseudomonas aeruginosa (strain PA7)
C1DN27 0.0 632 55 3 583 3 ligA DNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C1DN27 1.71e-17 90 36 3 169 3 ligA DNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1W7N4 0.0 630 50 7 707 3 ligA DNA ligase Acidovorax sp. (strain JS42)
Q3KFB2 0.0 629 55 4 590 3 ligA DNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q3KFB2 5.45e-22 104 39 5 181 3 ligA DNA ligase Pseudomonas fluorescens (strain Pf0-1)
Q9I3I4 0.0 629 55 4 592 3 ligA DNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I3I4 9.57e-22 103 39 3 169 3 ligA DNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVJ3 0.0 629 55 4 592 3 ligA DNA ligase Pseudomonas aeruginosa (strain LESB58)
B7UVJ3 9.57e-22 103 39 3 169 3 ligA DNA ligase Pseudomonas aeruginosa (strain LESB58)
Q63GS3 0.0 629 48 6 668 3 ligA DNA ligase Bacillus cereus (strain ZK / E33L)
Q87YY6 0.0 628 54 4 600 3 ligA DNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87YY6 3.21e-21 102 40 5 171 3 ligA DNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4VKN0 0.0 627 54 3 591 3 ligA DNA ligase Stutzerimonas stutzeri (strain A1501)
A4VKN0 3.17e-23 108 40 2 167 3 ligA DNA ligase Stutzerimonas stutzeri (strain A1501)
B9MIW4 0.0 627 49 7 707 3 ligA DNA ligase Acidovorax ebreus (strain TPSY)
Q02K12 0.0 627 55 4 592 3 ligA DNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02K12 9.57e-22 103 39 3 169 3 ligA DNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q6HP94 0.0 627 48 6 668 3 ligA DNA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EV74 0.0 627 48 6 668 3 ligA DNA ligase Bacillus cereus (strain 03BB102)
A0R906 0.0 627 48 6 668 3 ligA DNA ligase Bacillus thuringiensis (strain Al Hakam)
Q81ZG1 0.0 626 48 6 668 3 ligA DNA ligase Bacillus anthracis
C3L543 0.0 626 48 6 668 3 ligA DNA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBP1 0.0 626 48 6 668 3 ligA DNA ligase Bacillus anthracis (strain A0248)
A2SGT2 0.0 625 51 5 667 3 ligA DNA ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B7JM96 0.0 625 48 6 668 3 ligA DNA ligase Bacillus cereus (strain AH820)
B7H4U8 0.0 624 48 6 668 3 ligA DNA ligase Bacillus cereus (strain B4264)
A1WY80 0.0 624 48 6 706 3 ligA DNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q81IP2 0.0 624 48 6 668 3 ligA DNA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7IUW5 0.0 623 48 6 668 3 ligA DNA ligase Bacillus cereus (strain G9842)
A9VRG3 0.0 622 48 6 668 3 ligA DNA ligase Bacillus mycoides (strain KBAB4)
A5WCN7 0.0 622 49 9 668 3 ligA DNA ligase Psychrobacter sp. (strain PRwf-1)
Q73EM3 0.0 621 48 7 669 3 ligA DNA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
B9J1L6 0.0 621 48 7 669 3 ligA DNA ligase Bacillus cereus (strain Q1)
B7HSW5 0.0 621 48 7 669 3 ligA DNA ligase Bacillus cereus (strain AH187)
Q4FUW9 0.0 620 49 7 678 3 ligA DNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7GKJ1 0.0 619 48 6 672 3 ligA DNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B3E8F8 0.0 618 48 4 663 3 ligA DNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B5EP61 0.0 616 47 6 677 3 ligA DNA ligase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J653 0.0 616 47 6 677 3 ligA DNA ligase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B7GFV1 0.0 613 47 6 673 3 ligA DNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1D0P7 0.0 613 48 6 666 3 ligA DNA ligase Myxococcus xanthus (strain DK1622)
Q5L3B9 0.0 603 48 6 665 3 ligA DNA ligase Geobacillus kaustophilus (strain HTA426)
Q9KF37 0.0 602 46 6 673 3 ligA DNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8ETN6 0.0 602 48 8 685 3 ligA DNA ligase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q39S28 0.0 601 46 5 673 3 ligA DNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
O31498 0.0 600 48 6 664 3 ligA DNA ligase Bacillus subtilis (strain 168)
Q2LTN8 0.0 600 46 7 669 3 ligA DNA ligase Syntrophus aciditrophicus (strain SB)
Q3A2F5 0.0 599 47 7 664 3 ligA DNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q8CXK6 0.0 599 46 6 668 3 ligA DNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5WJ30 0.0 598 48 6 650 3 ligA DNA ligase Shouchella clausii (strain KSM-K16)
A7HVV8 0.0 597 48 10 688 3 ligA DNA ligase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B8D6X9 0.0 596 43 4 669 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57172 0.0 596 43 4 669 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B9KXM2 0.0 596 49 4 666 3 ligA DNA ligase Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
O87703 0.0 596 48 6 665 1 ligA DNA ligase Geobacillus stearothermophilus
B2IGH4 0.0 596 48 10 685 3 ligA DNA ligase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B9M861 0.0 595 47 5 665 3 ligA DNA ligase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q65MR2 0.0 595 47 7 667 3 ligA DNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C0QJ86 0.0 595 47 6 683 3 ligA DNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A4IJY6 0.0 594 48 5 659 3 ligA DNA ligase Geobacillus thermodenitrificans (strain NG80-2)
B8D8M5 0.0 594 43 4 669 3 ligA DNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A0Q7L0 0.0 594 44 4 664 3 ligA DNA ligase Francisella tularensis subsp. novicida (strain U112)
Q8PAB5 0.0 593 49 5 636 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PAB5 3.23e-17 89 39 3 168 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RUY2 0.0 593 49 5 636 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain B100)
B0RUY2 3.23e-17 89 39 3 168 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain B100)
Q4UTB0 0.0 593 49 5 636 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain 8004)
Q4UTB0 3.23e-17 89 39 3 168 3 ligA DNA ligase Xanthomonas campestris pv. campestris (strain 8004)
Q1QNT2 0.0 593 48 10 710 3 ligA DNA ligase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A4IWW8 0.0 592 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NF60 0.0 592 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
B2SFT1 0.0 592 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14GL3 0.0 592 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
B0TY02 0.0 590 43 4 665 3 ligA DNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q2A4C4 0.0 588 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A7NB34 0.0 588 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q01NV7 0.0 587 47 8 669 3 ligA DNA ligase Solibacter usitatus (strain Ellin6076)
B1YJ17 0.0 587 47 6 663 3 ligA DNA ligase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q0BMQ3 0.0 587 43 4 664 3 ligA DNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
A5GA98 0.0 586 46 5 668 3 ligA DNA ligase Geotalea uraniireducens (strain Rf4)
B5EIJ0 0.0 585 45 5 666 3 ligA DNA ligase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q74ER9 0.0 584 46 5 666 3 ligA DNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3STR7 0.0 583 47 8 698 3 ligA DNA ligase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A0AJL1 0.0 583 46 6 665 3 ligA DNA ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B6IRF1 0.0 582 47 9 690 3 ligA DNA ligase Rhodospirillum centenum (strain ATCC 51521 / SW)
B5ZWH9 0.0 582 46 11 707 3 ligA DNA ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3MGE7 0.0 582 45 7 670 3 ligA DNA ligase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A8FAQ1 0.0 582 46 6 667 3 ligA DNA ligase Bacillus pumilus (strain SAFR-032)
A3DE88 0.0 582 45 9 671 3 ligA DNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
C3MEL9 0.0 581 45 13 712 3 ligA DNA ligase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1ME47 0.0 581 46 12 699 3 ligA DNA ligase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8Y6D0 0.0 580 46 6 665 3 ligA DNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A9CIB3 0.0 580 45 13 722 3 ligA DNA ligase Agrobacterium fabrum (strain C58 / ATCC 33970)
B8DFG5 0.0 580 46 6 665 3 ligA DNA ligase Listeria monocytogenes serotype 4a (strain HCC23)
A6UB73 0.0 579 46 12 694 3 ligA DNA ligase Sinorhizobium medicae (strain WSM419)
B9E830 0.0 578 46 7 671 3 ligA DNA ligase Macrococcus caseolyticus (strain JCSC5402)
Q92AQ0 0.0 578 45 6 665 3 ligA DNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2RVV5 0.0 578 47 9 693 3 ligA DNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
C1KW57 0.0 578 45 6 665 3 ligA DNA ligase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q89FV8 0.0 577 45 10 697 3 ligA DNA ligase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B6JB45 0.0 576 47 6 678 3 ligA DNA ligase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
A0LI67 0.0 576 47 5 670 3 ligA DNA ligase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q71YR0 0.0 576 45 6 665 3 ligA DNA ligase Listeria monocytogenes serotype 4b (strain F2365)
B9JY41 0.0 576 44 12 716 3 ligA DNA ligase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8CRU0 0.0 575 44 7 671 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B8D122 0.0 575 45 9 673 3 ligA DNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A9A0L9 0.0 575 46 5 664 3 ligA DNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q5HN30 0.0 574 44 7 670 3 ligA DNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q0BV35 0.0 574 47 7 676 3 ligA DNA ligase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A5CZ68 0.0 573 46 9 671 3 ligA DNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A7Z261 0.0 573 46 7 664 3 ligA DNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B3PTU7 0.0 572 45 11 707 3 ligA DNA ligase Rhizobium etli (strain CIAT 652)
C0Z4D6 0.0 572 45 8 669 3 ligA DNA ligase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B9LHI6 0.0 572 46 4 686 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WCA1 0.0 572 46 4 686 3 ligA DNA ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B9DMU3 0.0 571 45 7 664 3 ligA DNA ligase Staphylococcus carnosus (strain TM300)
B3QFL8 0.0 570 46 7 698 3 ligA DNA ligase Rhodopseudomonas palustris (strain TIE-1)
Q6N423 0.0 570 46 6 696 3 ligA DNA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B1WZL6 0.0 570 44 7 675 3 ligA DNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q92NM8 0.0 570 46 12 693 3 ligA DNA ligase Rhizobium meliloti (strain 1021)
Q3BV14 0.0 569 48 8 637 3 ligA DNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BV14 8.83e-17 88 37 3 177 3 ligA DNA ligase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A4J703 0.0 569 44 7 664 3 ligA DNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q7A4Q5 0.0 568 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain N315)
Q99SY3 0.0 568 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEL8 0.0 568 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain COL)
A5IU71 0.0 568 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain JH9)
A6U309 0.0 568 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain JH1)
A7X432 0.0 568 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7A0H1 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain MW2)
Q9AIU7 0.0 567 44 8 667 1 ligA DNA ligase Staphylococcus aureus
A8Z2R8 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G829 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain MSSA476)
Q6GFF3 0.0 567 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain MRSA252)
A6QID2 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain Newman)
Q2G1Y0 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFJ1 0.0 567 44 8 667 3 ligA DNA ligase Staphylococcus aureus (strain USA300)
Q837V6 0.0 566 44 5 664 1 ligA DNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
A5EPJ2 0.0 566 44 8 696 3 ligA DNA ligase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B0U5G7 0.0 566 47 3 634 3 ligA DNA ligase Xylella fastidiosa (strain M12)
B0U5G7 2.68e-13 77 34 3 180 3 ligA DNA ligase Xylella fastidiosa (strain M12)
A5GWQ3 0.0 566 45 4 667 3 ligA DNA ligase Synechococcus sp. (strain RCC307)
A9IW95 0.0 566 44 10 708 3 ligA DNA ligase Bartonella tribocorum (strain CIP 105476 / IBS 506)
B8GAC1 0.0 565 46 4 681 3 ligA DNA ligase Chloroflexus aggregans (strain MD-66 / DSM 9485)
B7K0A2 0.0 565 44 6 654 3 ligA DNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q2K6D3 0.0 564 45 11 707 3 ligA DNA ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B5Y6V5 0.0 564 45 7 664 3 ligA DNA ligase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q8PM07 0.0 564 48 9 635 3 ligA DNA ligase Xanthomonas axonopodis pv. citri (strain 306)
Q8PM07 8.17e-17 88 37 3 170 3 ligA DNA ligase Xanthomonas axonopodis pv. citri (strain 306)
Q2YU70 0.0 564 44 8 672 3 ligA DNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6G2R5 0.0 564 44 12 709 3 ligA DNA ligase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q49YU8 0.0 563 44 7 671 3 ligA DNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2S459 0.0 563 48 6 659 3 ligA DNA ligase Salinibacter ruber (strain DSM 13855 / M31)
Q133Y4 0.0 563 46 5 697 3 ligA DNA ligase Rhodopseudomonas palustris (strain BisB5)
A4YZJ3 0.0 563 44 10 698 3 ligA DNA ligase Bradyrhizobium sp. (strain ORS 278)
P28719 0.0 562 46 10 694 3 ligA DNA ligase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q87A88 0.0 562 47 3 634 3 ligA DNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q87A88 1.63e-14 80 35 3 180 3 ligA DNA ligase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9S4 0.0 562 47 3 634 3 ligA DNA ligase Xylella fastidiosa (strain M23)
B2I9S4 1.63e-14 80 35 3 180 3 ligA DNA ligase Xylella fastidiosa (strain M23)
Q166E0 0.0 562 45 10 700 3 ligA DNA ligase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8YW98 0.0 562 44 7 670 3 ligA DNA ligase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6WZR6 0.0 561 45 12 712 3 ligA DNA ligase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B0K3S1 0.0 561 44 6 663 3 ligA DNA ligase Thermoanaerobacter sp. (strain X514)
Q0C577 0.0 560 46 7 676 3 ligA DNA ligase Hyphomonas neptunium (strain ATCC 15444)
A8IGY0 0.0 560 45 8 714 3 ligA DNA ligase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B1I551 0.0 560 45 5 663 3 ligA DNA ligase Desulforudis audaxviator (strain MP104C)
Q6MRL9 0.0 560 44 7 668 3 ligA DNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B7K8U0 0.0 559 42 3 673 3 ligA DNA ligase Gloeothece citriformis (strain PCC 7424)
Q9PAG2 0.0 559 47 3 634 3 ligA DNA ligase Xylella fastidiosa (strain 9a5c)
Q9PAG2 1.67e-13 77 35 2 166 3 ligA DNA ligase Xylella fastidiosa (strain 9a5c)
B0JTW2 0.0 559 43 3 667 3 ligA DNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B0KBN6 0.0 558 44 6 663 3 ligA DNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B9JH39 0.0 558 45 12 694 3 ligA DNA ligase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q5N2P4 0.0 558 45 7 671 3 ligA DNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RL0 0.0 558 45 7 671 3 ligA DNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1IQR7 0.0 558 47 7 638 3 ligA DNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1IQR7 5.43e-15 82 45 1 100 3 ligA DNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q2W0G3 0.0 557 46 9 686 3 ligA DNA ligase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2IYJ4 0.0 556 46 5 694 3 ligA DNA ligase Rhodopseudomonas palustris (strain HaA2)
B2J3P0 0.0 556 43 5 668 3 ligA DNA ligase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A1KSS7 0.0 556 47 7 638 3 ligA DNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1KSS7 3.75e-15 83 46 1 100 3 ligA DNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q6FZ81 0.0 556 43 10 710 3 ligA DNA ligase Bartonella quintana (strain Toulouse)
Q9K0E3 0.0 556 46 8 649 3 ligA DNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0E3 3.81e-15 83 46 1 100 3 ligA DNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M2U7 0.0 556 46 8 649 3 ligA DNA ligase Neisseria meningitidis serogroup C (strain 053442)
A9M2U7 3.81e-15 83 46 1 100 3 ligA DNA ligase Neisseria meningitidis serogroup C (strain 053442)
Q8FZQ3 0.0 556 44 11 710 3 ligA DNA ligase Brucella suis biovar 1 (strain 1330)
B0CHK8 0.0 556 44 11 710 3 ligA DNA ligase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M679 0.0 556 44 11 710 3 ligA DNA ligase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57C89 0.0 556 44 11 710 3 ligA DNA ligase Brucella abortus biovar 1 (strain 9-941)
Q2YLZ6 0.0 556 44 11 710 3 ligA DNA ligase Brucella abortus (strain 2308)
B2S6P4 0.0 556 44 11 710 3 ligA DNA ligase Brucella abortus (strain S19)
Q492G5 0.0 556 45 2 579 3 ligA DNA ligase Blochmanniella pennsylvanica (strain BPEN)
A5VRG5 0.0 556 44 11 710 3 ligA DNA ligase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YI56 0.0 556 44 11 710 3 ligA DNA ligase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE59 0.0 556 44 11 710 3 ligA DNA ligase Brucella melitensis biotype 2 (strain ATCC 23457)
Q4L7L9 0.0 555 44 8 677 3 ligA DNA ligase Staphylococcus haemolyticus (strain JCSC1435)
B5YIF8 0.0 555 43 7 670 3 ligA DNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q5F9Z9 0.0 555 46 9 648 3 ligA DNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5F9Z9 2.12e-14 80 44 1 102 3 ligA DNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5V1U3 0.0 554 45 6 687 3 ligA DNA ligase Roseiflexus sp. (strain RS-1)
Q07PR9 0.0 554 45 6 697 3 ligA DNA ligase Rhodopseudomonas palustris (strain BisA53)
A1UTB5 0.0 554 43 10 707 3 ligA DNA ligase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P49421 0.0 553 45 5 669 1 ligA DNA ligase Rhodothermus marinus
Q0AZZ5 0.0 553 45 9 667 3 ligA DNA ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q30ZK6 0.0 553 45 9 677 3 ligA DNA ligase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B4RJQ9 0.0 552 46 9 648 3 ligA DNA ligase Neisseria gonorrhoeae (strain NCCP11945)
B4RJQ9 7.18e-15 82 45 1 102 3 ligA DNA ligase Neisseria gonorrhoeae (strain NCCP11945)
P72588 0.0 551 44 7 661 3 ligA DNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1IHJ4 0.0 551 45 7 668 3 ligA DNA ligase Koribacter versatilis (strain Ellin345)
Q67KI8 0.0 551 44 7 666 3 ligA DNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A5VFJ8 0.0 551 47 12 709 3 ligA DNA ligase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q3AD38 0.0 551 45 7 667 3 ligA DNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
C1F7S7 0.0 550 45 5 669 3 ligA DNA ligase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q8RC42 0.0 550 44 7 664 3 ligA DNA ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q64TM7 0.0 550 41 6 671 3 ligA DNA ligase Bacteroides fragilis (strain YCH46)
B2A5W5 0.0 548 43 6 664 3 ligA DNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A7IG64 0.0 548 46 8 685 3 ligA DNA ligase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q5LCI0 0.0 548 41 6 671 3 ligA DNA ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A7NHP6 0.0 547 45 5 675 3 ligA DNA ligase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q8XZJ7 0.0 547 48 7 612 3 ligA DNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XZJ7 2.8e-18 93 41 3 168 3 ligA DNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q72BM7 0.0 547 45 8 670 3 ligA DNA ligase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B8FP44 0.0 547 44 6 669 3 ligA DNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A1VDM7 0.0 546 45 8 670 3 ligA2 DNA ligase 2 Nitratidesulfovibrio vulgaris (strain DP4)
B4RFE9 0.0 545 44 7 691 3 ligA DNA ligase Phenylobacterium zucineum (strain HLK1)
Q24QL5 0.0 545 44 6 668 3 ligA DNA ligase Desulfitobacterium hafniense (strain Y51)
B0C308 0.0 545 43 5 668 3 ligA DNA ligase Acaryochloris marina (strain MBIC 11017)
Q1WSH6 0.0 544 42 5 674 3 ligA DNA ligase Ligilactobacillus salivarius (strain UCC118)
Q7NR81 0.0 544 48 5 615 3 ligA DNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NR81 1.41e-13 78 57 0 70 3 ligA DNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A7H8A2 0.0 544 45 11 700 3 ligA DNA ligase Anaeromyxobacter sp. (strain Fw109-5)
Q98KC4 0.0 543 44 12 725 3 ligA DNA ligase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A1VC99 0.0 543 45 10 672 3 ligA1 DNA ligase 1 Nitratidesulfovibrio vulgaris (strain DP4)
B4UDH6 0.0 541 45 11 688 3 ligA DNA ligase Anaeromyxobacter sp. (strain K)
Q2INT9 0.0 541 45 11 687 3 ligA DNA ligase Anaeromyxobacter dehalogenans (strain 2CP-C)
B1XLV0 0.0 541 44 4 658 3 ligA DNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B8JD56 0.0 541 45 11 688 3 ligA DNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q0AMX9 0.0 541 45 7 679 3 ligA DNA ligase Maricaulis maris (strain MCS10)
A0LDY1 0.0 539 51 4 566 3 ligA DNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LDY1 8.74e-22 104 48 0 96 3 ligA DNA ligase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5FUI5 0.0 539 45 9 669 3 ligA DNA ligase Gluconobacter oxydans (strain 621H)
Q11GT5 0.0 538 45 13 696 3 ligA DNA ligase Chelativorans sp. (strain BNC1)
Q2G7J5 0.0 537 43 11 718 3 ligA DNA ligase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4XK85 0.0 536 42 6 663 3 ligA DNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B0TDL0 0.0 536 45 5 664 3 ligA DNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A2C5E6 0.0 535 40 6 681 3 ligA DNA ligase Prochlorococcus marinus (strain NATL1A)
Q9CIE4 0.0 535 43 6 667 3 ligA DNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
B3QSH0 0.0 535 43 7 686 3 ligA DNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A8LK52 0.0 535 45 9 697 3 ligA DNA ligase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q3ZX08 0.0 535 43 8 676 3 ligA DNA ligase Dehalococcoides mccartyi (strain CBDB1)
B1LA51 0.0 534 43 9 667 3 ligA DNA ligase Thermotoga sp. (strain RQ2)
A5IKX0 0.0 534 43 9 667 3 ligA DNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A6L5G8 0.0 534 41 6 665 3 ligA DNA ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A9H0L6 0.0 534 44 7 678 3 ligA DNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A5FRL4 0.0 533 43 8 676 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q180F3 0.0 533 40 7 675 3 ligA DNA ligase Clostridioides difficile (strain 630)
Q2JW63 0.0 532 43 6 662 3 ligA DNA ligase Synechococcus sp. (strain JA-3-3Ab)
Q2RGY0 0.0 532 45 6 664 3 ligA DNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q7VRU2 0.0 531 43 5 587 3 ligA DNA ligase Blochmanniella floridana
Q2JLU3 1.05e-180 533 44 7 667 3 ligA DNA ligase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9WXV5 1.12e-180 533 43 9 667 3 ligA DNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8DKK2 1.27e-180 532 43 5 678 3 ligA DNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3AGK2 1.4e-180 532 44 7 674 3 ligA DNA ligase Synechococcus sp. (strain CC9605)
A4WRP6 2.04e-180 532 44 7 677 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
C0QVE5 2.94e-180 530 41 8 666 3 ligA DNA ligase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B2UB00 5.38e-180 535 48 7 608 3 ligA DNA ligase Ralstonia pickettii (strain 12J)
B2UB00 3.72e-18 92 44 5 163 3 ligA DNA ligase Ralstonia pickettii (strain 12J)
B9MK54 7.61e-180 530 41 6 663 3 ligA DNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q3Z8W1 8.38e-180 530 43 7 674 3 ligA DNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q38VC5 8.65e-180 530 43 6 660 3 ligA DNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
B9K734 1.32e-179 530 42 9 667 3 ligA DNA ligase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B2FKJ1 1.84e-179 534 55 1 470 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
B2FKJ1 3.48e-16 86 60 0 74 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
B2FKJ1 5.62e-10 66 39 0 92 3 ligA DNA ligase Stenotrophomonas maltophilia (strain K279a)
A9AXP4 2.82e-179 528 43 6 664 3 ligA DNA ligase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
B1H072 3.14e-179 528 42 8 666 3 ligA DNA ligase Endomicrobium trichonymphae
B4SP88 4.66e-179 533 55 1 477 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
B4SP88 5.37e-16 85 60 0 74 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
B4SP88 3.42e-10 67 39 0 92 3 ligA DNA ligase Stenotrophomonas maltophilia (strain R551-3)
Q1AZ75 6.74e-179 528 44 7 666 3 ligA DNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B2GDS9 6.91e-179 528 44 7 667 3 ligA DNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q46IA9 7.74e-179 528 40 6 681 3 ligA DNA ligase Prochlorococcus marinus (strain NATL2A)
Q8KF74 1.92e-178 526 42 6 675 3 ligA DNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A6H0N9 3.1e-178 525 40 7 665 3 ligA DNA ligase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q03JF6 3.43e-178 525 44 8 662 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q3AUH7 3.66e-178 526 43 7 683 3 ligA DNA ligase Synechococcus sp. (strain CC9902)
Q2N9V6 4.6e-178 528 43 12 728 3 ligA DNA ligase Erythrobacter litoralis (strain HTCC2594)
Q2P334 5.18e-178 531 44 7 650 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P334 2.93e-16 86 38 3 167 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5H057 5.23e-178 531 44 7 650 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H057 5.51e-16 85 38 3 167 3 ligA DNA ligase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
A5FE87 7.77e-178 525 40 7 671 3 ligA DNA ligase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A6LN55 8.77e-178 524 41 8 670 3 ligA DNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q1RK40 1.16e-177 525 40 7 692 3 ligA DNA ligase Rickettsia bellii (strain RML369-C)
A8GXT8 1.2e-177 525 40 7 692 3 ligA DNA ligase Rickettsia bellii (strain OSU 85-389)
Q88XQ0 1.46e-177 524 43 5 657 3 ligA DNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q7MV47 1.71e-177 524 41 5 664 3 ligA DNA ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q5M382 3.92e-177 522 44 8 661 3 ligA DNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYL9 3.92e-177 522 44 8 661 3 ligA DNA ligase Streptococcus thermophilus (strain CNRZ 1066)
B2RKL2 5.63e-177 522 41 5 664 3 ligA DNA ligase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q8E084 1.3e-176 521 42 9 668 3 ligA DNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A3PJ74 1.33e-176 523 43 7 699 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q7U3P1 1.42e-176 521 43 7 672 3 ligA DNA ligase Parasynechococcus marenigrum (strain WH8102)
Q3J355 1.46e-176 523 44 7 678 3 ligA DNA ligase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2J6U3 1.57e-176 523 44 4 657 3 ligA DNA ligase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B8J0Q0 1.73e-176 523 43 10 680 3 ligA DNA ligase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q3K1K8 2.75e-176 520 42 9 668 3 ligA DNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q0RDH8 2.85e-176 524 44 5 665 3 ligA DNA ligase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
B9KRK2 3.24e-176 521 44 7 678 3 ligA DNA ligase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
C1A6H2 7.39e-176 520 44 6 665 3 ligA DNA ligase Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
B2G8T9 8.2e-176 520 42 4 662 3 ligA DNA ligase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VLG6 8.2e-176 520 42 4 662 3 ligA DNA ligase Limosilactobacillus reuteri (strain DSM 20016)
Q1GVQ2 3.42e-175 519 45 16 712 3 ligA DNA ligase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q8E5W1 4e-175 517 42 9 668 3 ligA DNA ligase Streptococcus agalactiae serotype III (strain NEM316)
A0LSQ7 6.4e-175 518 43 6 672 3 ligA DNA ligase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
B8DJT6 1.42e-174 521 43 11 687 3 ligA DNA ligase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B3DWU2 2.02e-174 516 40 8 669 3 ligA DNA ligase Methylacidiphilum infernorum (isolate V4)
Q8A9C1 3.17e-174 515 40 7 673 3 ligA DNA ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B7IDX6 4.12e-174 515 40 7 661 3 ligA DNA ligase Thermosipho africanus (strain TCF52B)
A8F541 4.96e-174 515 42 9 672 3 ligA DNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B2KE31 1.53e-173 513 41 8 670 3 ligA DNA ligase Elusimicrobium minutum (strain Pei191)
A6LA55 2.71e-173 513 41 10 674 3 ligA DNA ligase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q112N5 3.09e-173 516 39 7 763 3 ligA DNA ligase Trichodesmium erythraeum (strain IMS101)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS08060
Feature type CDS
Gene ligA
Product NAD-dependent DNA ligase LigA
Location 1672225 - 1674255 (strand: -1)
Length 2031 (nucleotides) / 676 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_305
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00533 BRCA1 C Terminus (BRCT) domain
PF01653 NAD-dependent DNA ligase adenylation domain
PF03119 NAD-dependent DNA ligase C4 zinc finger domain
PF03120 NAD-dependent DNA ligase OB-fold domain
PF12826 Helix-hairpin-helix motif
PF14520 Helix-hairpin-helix domain
PF22745 DNA ligase-like, N-terminal NAD+-binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0272 Replication, recombination and repair (L) L NAD-dependent DNA ligase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01972 DNA ligase (NAD+) [EC:6.5.1.2] DNA replication
Base excision repair
Nucleotide excision repair
Mismatch repair
-

Protein Sequence

MPKNNENNIENDIEQLRATLRHHEYCYHVLDNPQVPDAEYDRLMQRLKAMEAENPALITPDSPTQRVGAAPLGAFEQVRHEIPMLSLDNVFDEESYLAFDNRVRDRLKDTQDLTFCCELKLDGLAVSLLYVNGSLVQAATRGDGTTGENITANVRTIRAIPLKLRGDNIPDRIEIRGEVFMPLKGFEAMNDEARRTGGKVFANPRNAAAGSLRQLDPRITAKRPLTFFCYGVGVTEGAVLPGSHYDRLQQFKEWGLPVSDRVQRCTGSQAVLDFYHQVEESRPQLGFDIDGVVIKVDSVAQQEILGFVSRAPRWATAFKFPAQEQMTIVRDVEFQVGRTGAITPVARLEPVLVAGVIVSNASLHNADEISRLGLKIGDTVVIRRAGDVIPQVVGVVESERPDDAREIVFPLHCPVCGSDIERVEGEAVARCTGGLICGAQRKEALKHFVSRRAMDVDGLGDKIIDQLVDAEYVQTPADLWRLTPGKLTGLDRMGPKSAEKLTDALAASKQTTFARFLYALGIREVGESTAANLAEHFRTLDALQAADTDVLKTVPDVGDVVAKHVVNFLRETHNRDVITDLTQNIGIHWPEVVAVDAAALDNPFAGKVVVLTGSLQILTRDEAKDRLTALGAKVTGSVSKKTDLVIAGEAAGSKRAKAEELGIRVIDENEFIAMLN

Flanking regions ( +/- flanking 50bp)

AGCTGTAGTCAGGTATAATCAGGTATAAAACAGACTGACAGATAACGATCATGCCAAAAAATAACGAAAACAACATCGAAAACGATATAGAACAACTGCGCGCCACGCTGCGCCATCACGAGTACTGTTATCACGTGCTGGATAACCCGCAGGTACCGGATGCGGAATATGACCGTCTGATGCAGCGCCTGAAAGCAATGGAAGCGGAAAATCCGGCACTGATCACCCCTGATTCTCCGACACAGCGTGTCGGTGCGGCACCGCTGGGTGCATTTGAGCAGGTGCGCCATGAAATTCCTATGCTGTCACTCGATAATGTCTTCGATGAAGAGAGCTATCTGGCATTTGACAACCGCGTACGCGACCGCCTGAAAGATACACAGGATCTGACATTTTGCTGTGAACTGAAACTGGATGGTCTGGCGGTCAGTCTGCTTTATGTCAACGGCAGCCTGGTTCAGGCAGCAACCCGGGGTGACGGCACCACCGGCGAAAATATTACGGCAAATGTCCGGACTATCCGCGCTATCCCGCTGAAACTACGCGGGGATAATATCCCGGATCGTATTGAGATCCGCGGGGAAGTCTTTATGCCGCTGAAAGGCTTTGAGGCAATGAATGACGAAGCACGGCGCACCGGCGGAAAAGTATTTGCCAATCCGCGTAATGCCGCTGCCGGTTCATTGCGCCAGCTTGATCCTCGCATTACCGCCAAACGCCCGCTGACCTTTTTCTGTTACGGCGTTGGTGTAACTGAGGGCGCAGTATTGCCCGGCAGCCATTATGATCGTCTGCAACAATTTAAAGAGTGGGGATTACCGGTCAGTGACCGGGTTCAGCGCTGCACCGGCAGTCAGGCGGTACTGGATTTTTATCATCAGGTGGAAGAGAGTCGTCCGCAACTGGGTTTTGATATCGACGGTGTGGTCATAAAAGTGGACTCTGTCGCGCAGCAGGAAATACTGGGCTTTGTGTCCCGCGCACCGCGCTGGGCAACCGCGTTTAAATTCCCCGCACAGGAGCAGATGACGATTGTCCGCGATGTGGAATTCCAGGTCGGCAGGACAGGGGCAATTACCCCTGTGGCACGCCTTGAGCCGGTTCTGGTGGCGGGTGTCATCGTCAGTAATGCCTCACTGCATAATGCAGATGAAATCAGCCGCCTGGGGCTTAAAATCGGCGATACCGTGGTTATCCGCCGTGCCGGTGATGTTATCCCGCAGGTTGTGGGCGTGGTTGAATCAGAACGTCCGGATGATGCGCGTGAGATAGTCTTTCCGCTGCATTGCCCGGTGTGCGGGTCTGATATTGAGCGGGTCGAAGGCGAAGCGGTGGCGCGCTGTACCGGCGGGCTGATTTGCGGTGCGCAGCGCAAAGAAGCGCTCAAGCACTTTGTCTCCCGCCGTGCCATGGATGTTGACGGGCTGGGTGATAAAATTATCGATCAACTGGTGGACGCTGAGTATGTACAGACACCGGCAGATTTATGGCGTCTGACCCCGGGAAAACTCACGGGGCTGGACAGGATGGGACCAAAATCGGCAGAAAAACTGACCGATGCACTGGCGGCGTCAAAGCAGACTACGTTTGCCCGCTTTCTTTATGCCCTGGGGATCCGTGAAGTCGGGGAGTCCACGGCAGCGAACCTGGCGGAGCACTTTAGAACCCTTGATGCATTACAGGCCGCAGATACCGATGTACTGAAAACAGTACCGGATGTGGGAGACGTAGTTGCAAAACATGTTGTGAATTTCCTGCGGGAAACGCATAACCGGGATGTAATTACCGATCTGACACAAAATATCGGTATTCACTGGCCGGAGGTTGTGGCTGTGGATGCTGCCGCGCTGGATAATCCGTTTGCCGGAAAAGTCGTGGTACTGACCGGGTCATTACAGATACTGACCCGTGATGAGGCAAAAGATCGCCTGACCGCGCTGGGGGCAAAAGTGACCGGCAGTGTGTCTAAGAAAACCGACCTTGTGATTGCCGGTGAAGCGGCGGGCTCTAAACGGGCAAAAGCCGAAGAACTGGGTATCCGCGTGATAGATGAAAATGAATTTATTGCGATGCTGAACTGATGTTCTGAACGGACGTGACAGAATAAAAAACGGTCTTCTGAGGAAGACCG