Homologs in group_1923

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14305 FBDBKF_14305 54.5 Morganella morganii S1 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
EHELCC_07975 EHELCC_07975 54.5 Morganella morganii S2 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
NLDBIP_08300 NLDBIP_08300 54.5 Morganella morganii S4 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
LHKJJB_05965 LHKJJB_05965 54.5 Morganella morganii S3 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
HKOGLL_04950 HKOGLL_04950 54.5 Morganella morganii S5 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
F4V73_RS02600 F4V73_RS02600 53.9 Morganella psychrotolerans mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC

Distribution of the homologs in the orthogroup group_1923

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1923

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N2A3 0.0 818 59 4 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JKL6 0.0 805 56 2 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JGH2 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TM73 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis (strain Pestoides F)
Q1CHL1 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7V8 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD36 0.0 800 55 4 684 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis
Q1C669 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGL1 0.0 800 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q668W0 0.0 798 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K8I4 0.0 798 55 4 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A8GH77 0.0 786 57 4 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Serratia proteamaculans (strain 568)
Q6D2N1 0.0 776 55 3 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YZN7 0.0 728 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella sonnei (strain Ss046)
P77182 0.0 728 53 6 677 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12)
B1IXC1 0.0 728 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2J3 0.0 728 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O9:H4 (strain HS)
B1X935 0.0 728 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12 / DH10B)
Q31YD4 0.0 728 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 4 (strain Sb227)
B2TWA6 0.0 726 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LLT0 0.0 725 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain SMS-3-5 / SECEC)
Q83QQ8 0.0 724 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri
Q0T2G1 0.0 724 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri serotype 5b (strain 8401)
A7ZPE0 0.0 724 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0TFC2 0.0 723 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FFH0 0.0 721 53 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32DL2 0.0 720 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella dysenteriae serotype 1 (strain Sd197)
Q1R988 0.0 719 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain UTI89 / UPEC)
A1ADH3 0.0 719 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O1:K1 / APEC
Q8XCQ7 0.0 717 52 6 677 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O157:H7
A4WCV7 0.0 715 52 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Enterobacter sp. (strain 638)
A7MH59 0.0 696 52 5 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cronobacter sakazakii (strain ATCC BAA-894)
A9MJ47 0.0 687 51 7 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZNB2 0.0 681 50 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9N465 0.0 681 50 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8ADQ4 0.0 680 51 7 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57LX5 0.0 679 50 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella choleraesuis (strain SC-B67)
Q5PCW7 0.0 678 50 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4Z3 0.0 676 50 6 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhi
A6TC10 0.0 664 50 7 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q5E450 0.0 649 47 6 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LP59 0.0 627 46 7 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ91 0.0 627 46 7 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MN6 0.0 625 46 8 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MS81 0.0 625 46 8 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio campbellii (strain ATCC BAA-1116)
A5F6E9 0.0 622 45 7 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MIT5 0.0 613 47 10 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain YJ016)
Q8DB38 0.0 612 46 8 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain CMCP6)
A0KJJ9 0.0 607 46 10 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q65S61 0.0 602 45 7 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A4SNE3 0.0 597 46 11 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas salmonicida (strain A449)
Q0I2W9 0.0 596 45 7 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 129Pt)
Q9CNT7 0.0 594 45 8 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pasteurella multocida (strain Pm70)
B0UT85 0.0 593 45 7 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 2336)
P44246 0.0 586 45 7 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKP6 0.0 582 44 6 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain 86-028NP)
A5UEH1 0.0 579 44 7 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittGG)
A5UCC9 0.0 577 44 7 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittEE)
A6VMR0 0.0 566 43 8 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BPE2 0.0 555 44 8 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0L8 0.0 553 44 8 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VM59 0.0 549 43 7 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1SW96 0.0 538 41 10 693 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q6LNT9 4.5e-166 495 40 9 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photobacterium profundum (strain SS9)
Q3IF34 1.8e-152 459 37 7 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas translucida (strain TAC 125)
Q15QE8 2.78e-142 434 37 11 705 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A4XXB7 6.99e-140 427 39 16 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas mendocina (strain ymp)
Q47XJ9 9.81e-138 422 35 13 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0KTW1 2.43e-137 420 37 14 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain GB-1)
Q5QUE0 3.9e-137 418 38 18 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4VMX4 2.63e-135 415 40 13 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Stutzerimonas stutzeri (strain A1501)
Q02QU5 3.31e-133 409 39 16 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HYF0 4.06e-133 409 39 16 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1H1H9 4.97e-133 409 38 15 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q886E0 2.44e-132 407 37 19 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3K8R9 1.9e-131 405 38 19 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain Pf0-1)
A6V1X0 9.14e-130 400 38 16 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain PA7)
Q48LF6 9.66e-130 400 36 19 686 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4K8K9 1.31e-129 400 37 14 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5W7H7 7.79e-129 398 36 13 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q4ZPZ9 1.14e-128 398 36 20 692 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. syringae (strain B728a)
Q88M24 1.93e-127 394 35 13 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1QZP3 1.67e-126 394 36 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7NWN9 8.16e-125 388 38 14 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1IDB9 2.38e-120 376 36 15 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas entomophila (strain L48)
B1J5F1 5.91e-116 365 34 14 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain W619)
A6W0S5 1.13e-113 359 34 17 705 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinomonas sp. (strain MWYL1)
Q5X531 3.38e-108 345 32 13 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Paris)
Q5ZVA8 3.01e-107 342 32 13 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IC27 2.48e-106 340 31 13 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Corby)
A4Y884 7.17e-106 339 33 14 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q5WWF9 8.21e-106 338 32 13 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Lens)
Q2SD50 6.58e-105 335 32 18 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hahella chejuensis (strain KCTC 2396)
A1RIA5 6.5e-104 334 33 14 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain W3-18-1)
Q31JE7 1.63e-102 330 34 20 692 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1K5J4 1.33e-100 324 33 14 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Azoarcus sp. (strain BH72)
Q0HKB8 1.54e-100 326 32 14 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-4)
A6WQ09 1.31e-99 323 32 13 651 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS185)
Q5NY30 2.12e-99 321 32 13 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A3D671 4.79e-99 322 32 14 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9KTV2 2.26e-97 318 31 13 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS195)
Q0HWM0 8.04e-97 316 31 16 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-7)
A0LA84 1.45e-96 314 34 18 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8XYP9 1.5e-96 314 32 14 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8ECR0 1.75e-96 315 32 17 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q13SL2 1.43e-95 311 31 13 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia xenovorans (strain LB400)
A0KV89 3.06e-95 311 32 15 660 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain ANA-3)
A1S7K4 1.21e-94 309 37 7 474 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q21KP6 1.42e-94 310 32 18 713 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8F0E4 1.84e-94 308 31 20 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72UK9 2.25e-94 308 31 20 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2Y7P9 3.15e-94 307 32 17 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2T7N8 1.94e-93 306 31 13 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A1TZU2 1.14e-91 300 32 14 649 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q04XS7 6.46e-91 299 32 22 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VP5 6.46e-91 299 32 22 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q47C51 5.19e-90 296 32 17 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dechloromonas aromatica (strain RCB)
A3QFM9 1.16e-89 296 32 11 578 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8H2Z3 2.51e-89 295 32 13 585 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q6F7Y9 6.12e-89 293 32 21 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q084S3 1.55e-88 294 31 13 656 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella frigidimarina (strain NCIMB 400)
B2HYP8 9.47e-88 290 32 18 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ACICU)
Q2T2K1 1.5e-87 290 32 17 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B2JJN6 4.95e-87 289 31 14 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A3M8T4 1.76e-86 286 32 19 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q472D5 2.01e-85 285 31 13 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1LM60 2.4e-85 285 31 13 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4J9Z5 7.58e-85 283 31 17 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia vietnamiensis (strain G4 / LMG 22486)
A8FTT1 3.18e-84 283 30 16 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sediminis (strain HAW-EB3)
A1V8X2 8.87e-84 280 31 15 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain SAVP1)
Q63Z34 2.5e-83 279 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain K96243)
Q0KBK6 2.7e-83 279 30 12 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9AJC5 3.1e-83 279 31 14 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia multivorans (strain ATCC 17616 / 249)
A3NPL7 3.75e-83 279 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1106a)
Q62FV6 3.75e-83 279 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain ATCC 23344)
A2S6N9 3.75e-83 279 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10229)
A3MQF7 3.75e-83 279 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10247)
Q3JXS0 5.81e-83 278 31 14 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1710b)
B0TL07 9.93e-83 277 32 18 643 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella halifaxensis (strain HAW-EB4)
B0V636 1.57e-82 276 31 18 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain AYE)
A3N3Y7 1.86e-82 277 31 15 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 668)
Q1Q999 1.17e-79 270 31 22 709 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q12P60 1.5e-79 271 35 6 425 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B1KKR3 2.27e-78 267 30 11 586 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella woodyi (strain ATCC 51908 / MS32)
Q4FR09 8.27e-78 265 30 24 705 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A5WGY8 1.67e-77 265 30 27 771 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter sp. (strain PRwf-1)
Q0BX22 1.81e-77 262 30 20 661 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hyphomonas neptunium (strain ATCC 15444)
A2SH83 4.92e-70 243 29 20 687 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A7H2B2 5.12e-69 239 27 20 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q9PN30 5.23e-69 239 28 21 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FMX4 1.03e-68 239 27 20 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HTJ5 3.91e-68 237 27 18 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni (strain RM1221)
A1W0Q3 5.89e-68 237 28 22 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7ZEX8 5e-67 234 28 18 658 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter concisus (strain 13826)
A5EWE5 2.5e-64 227 30 23 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dichelobacter nodosus (strain VCS1703A)
Q3SID4 2.83e-64 227 29 16 656 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Thiobacillus denitrificans (strain ATCC 25259)
Q39L16 4.07e-63 224 27 17 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A7I2T7 8.74e-63 224 27 20 706 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A0RQ83 6.6e-62 220 28 19 660 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter fetus subsp. fetus (strain 82-40)
A0K2U3 3.64e-58 211 28 15 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia cenocepacia (strain HI2424)
Q1BZN5 5.22e-58 210 28 15 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain AU 1054)
B1K1H7 2.3e-57 208 28 16 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain MC0-3)
B1YQ54 2.43e-57 209 27 18 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain MC40-6)
A1VQ03 2.22e-56 206 29 21 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas naphthalenivorans (strain CJ2)
Q0BJQ6 3.49e-56 205 27 19 681 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0ALP0 1.52e-53 197 35 6 333 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Maricaulis maris (strain MCS10)
Q9AA58 4.99e-53 195 28 20 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q2KVJ9 6.55e-53 196 27 20 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella avium (strain 197N)
B1Y222 2.52e-52 194 26 13 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1TRM7 4.45e-51 191 25 15 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paracidovorax citrulli (strain AAC00-1)
Q12B26 1.51e-46 178 29 25 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas sp. (strain JS666 / ATCC BAA-500)
A9C3G2 9.53e-46 176 27 17 659 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Delftia acidovorans (strain DSM 14801 / SPH-1)
A1W6V9 1.16e-44 172 26 18 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acidovorax sp. (strain JS42)
Q7WFU7 6.09e-43 167 41 6 231 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W4D9 6.75e-42 164 41 6 231 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A9I518 2.65e-40 160 24 18 655 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0SVF8 2.18e-37 151 38 6 242 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter sp. (strain K31)
P44247 6.39e-30 117 48 0 115 4 HI_1536 Uncharacterized protein HI_1536 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1WH84 3.55e-24 111 24 20 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Verminephrobacter eiseniae (strain EF01-2)
Q21WM8 1.11e-14 81 23 23 649 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08805
Feature type CDS
Gene mnmC
Product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
Location 1925983 - 1928022 (strand: 1)
Length 2040 (nucleotides) / 679 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1923
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01266 FAD dependent oxidoreductase
PF05430 S-adenosyl-L-methionine-dependent methyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4121 Translation, ribosomal structure and biogenesis (J) J tRNA U34 5-methylaminomethyl-2-thiouridine-forming methyltransferase MnmC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15461 tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein [EC:2.1.1.61 1.5.-.-] - -

Protein Sequence

MNNTAINTASLSWNELGTPISKQFDDIYFSNQDGLEETRHVFLHGNHFPSRFGTHVRSECVIAETGFGTGLNFLTLWQAFEQFRHHSPDAPLKRLHYVSFEKFPLTKADLQTAHSHWPELAQYSTALCAQWPLPIAGCHRLILANGAITLDLWFGDINTLLPQTRQALHNKVDAWFLDGFAPSKNPQMWSETLFQAMADSMRENGTFATFTAAGIVKRGLQHVGFEIKKIKGFGQKREMLTGVFPHPPANAFVPYYARPCATQRKDIAIIGGGIASTLTALACLKRGAKVTLYCEDTHPAANASGNRQGVLYPLLNGKSDELEHFFTSAFLYARRYYDELNHKGVNFSHQWSGVAQVIYNEKVRKKIARIIEHSTPFSQLAHYVHQDEMNSLCGLAINQDGLFYPQAGWLSPTELTTNALKYAQQQGLKLLFEHQVTQLTSQQQHWLLEVTHQATTYKTQHDCVILANGHRITDFIQSEKLPISAVRGQVSHISTTPDIAQLKAVLCYDGYFTPVDPQDNLHCVGASFRRDRLDLNVSIEEQQNNQWHLTHCLAQSPWAQQVDFSDNDARVGIRCTIRDHLPLLGEVPDFEKLVVAYTHLDRFKRRKQTPILAPSYHQLYIISALGSRGLCSAPLSAEILASQIFDEPFPVEDSVLNALHPNRFWVRPLLRGKAIELKS

Flanking regions ( +/- flanking 50bp)

AGAACAGCGTTAAGATAGCCCATTATTTTTGGTAAAATACAGGTAGTTCCGTGAATAACACTGCTATAAATACCGCCTCTTTAAGTTGGAATGAACTTGGTACTCCGATTTCAAAACAGTTTGATGATATCTATTTTTCCAACCAAGATGGTCTTGAAGAAACTCGACATGTATTCCTACATGGAAATCATTTTCCATCTCGTTTTGGTACACATGTACGCTCTGAGTGTGTTATAGCAGAAACCGGATTTGGCACAGGATTAAACTTTTTAACACTGTGGCAAGCCTTCGAGCAATTTCGTCATCACTCACCTGATGCGCCATTAAAGCGTTTACATTATGTCAGTTTTGAAAAATTTCCTCTGACTAAAGCTGATTTGCAAACAGCCCATAGCCATTGGCCAGAACTAGCACAATATTCAACAGCGCTTTGTGCACAGTGGCCTTTACCTATTGCCGGTTGTCATCGTCTTATTCTTGCTAATGGCGCGATAACGCTTGATTTATGGTTCGGTGATATCAATACATTACTGCCACAAACTCGCCAAGCTTTACATAATAAAGTTGATGCGTGGTTTCTTGACGGCTTTGCACCAAGTAAAAACCCACAAATGTGGAGTGAAACATTATTTCAAGCAATGGCAGACTCGATGCGTGAAAATGGCACTTTTGCCACCTTTACCGCAGCTGGGATAGTAAAACGAGGATTGCAACATGTTGGTTTTGAAATAAAGAAAATAAAAGGCTTTGGTCAAAAAAGAGAAATGTTAACAGGGGTATTTCCCCATCCTCCTGCCAATGCATTTGTTCCCTACTATGCCAGACCTTGTGCTACACAAAGAAAAGATATCGCTATTATCGGTGGGGGGATCGCCAGTACATTAACTGCACTCGCCTGCTTAAAAAGAGGCGCCAAAGTCACGCTCTATTGTGAAGATACACATCCTGCGGCAAATGCCTCAGGCAATCGGCAAGGTGTGTTATACCCATTACTTAATGGCAAATCTGATGAGTTAGAACACTTTTTCACTAGCGCTTTTTTATATGCCCGCCGTTATTATGATGAGTTAAACCATAAAGGCGTAAACTTTTCACATCAATGGTCTGGTGTTGCCCAAGTTATCTATAATGAAAAAGTACGCAAAAAAATAGCGCGAATAATCGAGCATTCCACACCTTTTTCTCAACTTGCTCATTATGTTCATCAAGATGAAATGAATTCACTTTGTGGATTAGCCATCAACCAAGATGGTCTTTTTTATCCTCAAGCAGGTTGGCTTTCTCCCACAGAGTTAACCACCAATGCATTAAAATACGCACAACAACAAGGTCTCAAGCTACTCTTTGAACATCAAGTCACTCAATTAACCTCACAACAACAGCATTGGCTGTTAGAGGTGACTCACCAAGCAACAACGTATAAAACACAACATGATTGCGTTATTTTAGCTAATGGGCACCGTATTACTGATTTTATACAAAGTGAAAAACTGCCTATCAGTGCAGTAAGGGGTCAAGTTAGCCATATTTCAACGACACCTGATATCGCACAATTAAAAGCGGTGCTCTGCTATGATGGCTATTTTACGCCGGTTGATCCTCAAGATAATCTGCATTGTGTTGGGGCAAGCTTTCGTCGTGATCGACTAGATTTAAATGTTTCAATTGAAGAGCAACAAAATAATCAATGGCACCTCACGCACTGTTTAGCACAATCACCTTGGGCACAGCAGGTAGATTTTAGTGATAACGATGCACGTGTCGGGATCCGCTGTACAATAAGAGATCACCTTCCTTTATTAGGTGAAGTACCCGATTTTGAAAAATTAGTTGTCGCCTATACGCATTTAGATCGATTTAAGCGTAGAAAGCAAACACCTATTTTGGCACCGAGTTATCATCAGCTTTATATTATTAGTGCATTAGGTTCACGTGGTTTATGCTCTGCACCTTTATCTGCGGAGATCTTAGCAAGCCAAATCTTTGATGAGCCATTTCCTGTAGAAGATAGTGTGTTAAATGCCTTACATCCAAATCGTTTCTGGGTAAGACCATTACTACGCGGAAAAGCTATTGAATTAAAATCATAGGATCAGTCACTGAAATTACGGTTGATATTTAAGTAACTATTGTTAATGGG