Homologs in group_1961

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14305 FBDBKF_14305 75.4 Morganella morganii S1 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
EHELCC_07975 EHELCC_07975 75.4 Morganella morganii S2 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
NLDBIP_08300 NLDBIP_08300 75.4 Morganella morganii S4 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
LHKJJB_05965 LHKJJB_05965 75.4 Morganella morganii S3 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
HKOGLL_04950 HKOGLL_04950 75.4 Morganella morganii S5 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
PMI_RS08805 PMI_RS08805 53.9 Proteus mirabilis HI4320 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC

Distribution of the homologs in the orthogroup group_1961

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1961

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A1JKL6 0.0 765 56 1 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JGH2 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TM73 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis (strain Pestoides F)
Q1CHL1 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7V8 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD36 0.0 762 56 5 675 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis
Q1C669 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGL1 0.0 762 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q668W0 0.0 761 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K8I4 0.0 761 56 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q7N2A3 0.0 745 55 2 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D2N1 0.0 744 54 1 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GH77 0.0 741 56 2 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Serratia proteamaculans (strain 568)
Q8XCQ7 0.0 729 54 4 669 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O157:H7
A7ZPE0 0.0 726 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83QQ8 0.0 723 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri
Q8FFH0 0.0 723 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32DL2 0.0 722 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella dysenteriae serotype 1 (strain Sd197)
Q3YZN7 0.0 721 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella sonnei (strain Ss046)
B2TWA6 0.0 721 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IXC1 0.0 721 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2J3 0.0 721 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O9:H4 (strain HS)
Q0T2G1 0.0 720 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri serotype 5b (strain 8401)
P77182 0.0 720 54 4 669 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12)
B1X935 0.0 720 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12 / DH10B)
Q31YD4 0.0 718 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 4 (strain Sb227)
B1LLT0 0.0 718 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain SMS-3-5 / SECEC)
Q0TFC2 0.0 717 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R988 0.0 716 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain UTI89 / UPEC)
A1ADH3 0.0 716 54 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O1:K1 / APEC
A9N465 0.0 708 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PCW7 0.0 707 53 5 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZNB2 0.0 707 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MJ47 0.0 705 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q57LX5 0.0 704 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella choleraesuis (strain SC-B67)
Q8Z4Z3 0.0 702 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhi
A8ADQ4 0.0 701 53 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WCV7 0.0 700 52 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Enterobacter sp. (strain 638)
A7MH59 0.0 698 54 2 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cronobacter sakazakii (strain ATCC BAA-894)
A6TC10 0.0 696 54 5 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q5E450 0.0 616 45 5 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7MS81 0.0 607 46 6 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio campbellii (strain ATCC BAA-1116)
Q9CNT7 0.0 607 46 4 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pasteurella multocida (strain Pm70)
Q87MN6 0.0 605 46 6 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MIT5 0.0 605 46 8 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain YJ016)
A5F6E9 0.0 603 46 6 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DB38 0.0 602 46 7 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain CMCP6)
C3LP59 0.0 602 46 6 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ91 0.0 602 46 6 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A4SNE3 0.0 598 47 7 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas salmonicida (strain A449)
Q0I2W9 0.0 595 44 4 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 129Pt)
Q65S61 0.0 593 44 4 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44246 0.0 592 45 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UCC9 0.0 592 45 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittEE)
Q4QKP6 0.0 592 45 6 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain 86-028NP)
A0KJJ9 0.0 588 46 7 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A5UEH1 0.0 587 44 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittGG)
B0UT85 0.0 584 43 4 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 2336)
A6VMR0 0.0 582 44 7 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VM59 0.0 539 42 7 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BPE2 0.0 536 42 5 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N0L8 0.0 532 42 5 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1SW96 2.57e-180 531 41 11 691 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q6LNT9 8.06e-163 487 40 9 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photobacterium profundum (strain SS9)
Q3IF34 1.55e-150 454 37 11 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas translucida (strain TAC 125)
Q15QE8 1.3e-143 437 37 12 712 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3K8R9 2.38e-135 415 39 14 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain Pf0-1)
A4XXB7 2.94e-135 414 39 13 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas mendocina (strain ymp)
A4VMX4 6.11e-135 414 39 12 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Stutzerimonas stutzeri (strain A1501)
Q1H1H9 3.68e-132 406 37 9 650 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9HYF0 5.37e-132 406 39 14 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q47XJ9 6.96e-132 407 34 13 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q02QU5 9.68e-132 405 39 14 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q886E0 4.45e-131 404 38 15 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6V1X0 1.02e-130 403 39 14 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain PA7)
Q4K8K9 2.05e-130 402 38 15 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5QUE0 1.8e-129 398 38 19 660 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7NWN9 6.85e-128 395 39 14 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q48LF6 9.34e-128 395 37 15 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZPZ9 4.76e-126 391 37 15 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. syringae (strain B728a)
B0KTW1 2.05e-123 384 35 17 681 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain GB-1)
Q88M24 1.01e-119 374 36 16 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W7H7 2.92e-118 370 35 16 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1IDB9 1.02e-116 366 37 16 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas entomophila (strain L48)
Q1QZP3 2.43e-114 362 35 13 663 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5ZVA8 1.7e-112 356 33 19 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IC27 4.62e-112 355 33 17 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Corby)
B1J5F1 5.07e-111 352 35 16 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain W619)
Q5WWF9 7.82e-111 352 33 19 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Lens)
Q5X531 9.47e-111 351 33 19 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Paris)
Q2SD50 9.62e-109 345 35 20 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hahella chejuensis (strain KCTC 2396)
Q47C51 1.86e-108 345 35 17 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dechloromonas aromatica (strain RCB)
A1RIA5 8.41e-107 341 34 13 640 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain W3-18-1)
A6W0S5 1.11e-106 341 34 19 703 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinomonas sp. (strain MWYL1)
Q5NY30 2.86e-106 338 35 14 663 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A4Y884 4.99e-106 339 34 14 640 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q31JE7 1.46e-105 338 35 20 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2Y7P9 4.4e-105 335 35 16 658 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A3D671 4.43e-101 327 33 16 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS155 / ATCC BAA-1091)
A6WQ09 6.74e-101 326 32 13 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS185)
A9KTV2 2.48e-100 325 32 13 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS195)
A1K5J4 3.31e-100 323 35 14 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Azoarcus sp. (strain BH72)
Q0HKB8 1.04e-99 323 33 16 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-4)
Q0HWM0 3.55e-99 322 33 19 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-7)
A8H2Z3 7.72e-99 319 35 12 564 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8ECR0 9.63e-99 321 31 11 663 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1LM60 9.96e-99 320 34 16 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q472D5 2.21e-98 319 33 15 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8XYP9 1.66e-97 316 34 15 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A0KV89 4.71e-97 316 32 14 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain ANA-3)
Q21KP6 1.37e-95 313 34 16 716 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q084S3 6.52e-95 310 33 14 643 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella frigidimarina (strain NCIMB 400)
B2T7N8 7.57e-93 304 31 15 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q8F0E4 4.77e-92 301 30 17 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72UK9 8.69e-92 301 30 17 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A1S7K4 2e-91 300 37 9 473 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0KBK6 1.31e-89 295 33 17 683 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B2JJN6 2.4e-89 295 33 19 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A4J9Z5 6.13e-89 293 33 17 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q13SL2 3.13e-88 292 31 15 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia xenovorans (strain LB400)
Q04XS7 4.38e-88 291 29 17 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VP5 4.38e-88 291 29 17 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
B0TL07 1.48e-86 287 34 10 552 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella halifaxensis (strain HAW-EB4)
B1KKR3 1.75e-85 286 34 17 579 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella woodyi (strain ATCC 51908 / MS32)
A9AJC5 4.95e-85 283 32 15 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia multivorans (strain ATCC 17616 / 249)
A3QFM9 6.82e-85 284 33 15 583 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q2T2K1 1.54e-84 282 33 19 684 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1TZU2 1.71e-83 278 31 14 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B2HYP8 3.33e-82 275 31 21 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ACICU)
A8FTT1 3.37e-82 277 30 17 691 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sediminis (strain HAW-EB3)
Q3SID4 2.47e-81 272 35 20 657 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Thiobacillus denitrificans (strain ATCC 25259)
A3M8T4 1.36e-80 271 31 20 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q12P60 8.27e-80 272 37 7 422 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1V8X2 5.84e-79 267 32 17 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain SAVP1)
Q4FR09 8.28e-79 268 30 19 697 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7ZEX8 1.1e-78 266 30 20 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter concisus (strain 13826)
A3N3Y7 1.73e-78 266 32 18 688 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 668)
Q63Z34 2.58e-78 266 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain K96243)
A3NPL7 5.01e-78 265 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1106a)
Q62FV6 5.01e-78 265 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain ATCC 23344)
A2S6N9 5.01e-78 265 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10229)
A3MQF7 5.01e-78 265 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10247)
Q3JXS0 5.73e-78 265 32 17 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1710b)
Q1Q999 9.09e-77 262 30 18 691 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A0LA84 1.23e-76 261 32 16 681 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q6F7Y9 1.09e-75 258 31 22 655 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B0V636 5.94e-75 256 31 21 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain AYE)
A5WGY8 1.31e-71 249 29 25 764 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter sp. (strain PRwf-1)
A8FMX4 6.31e-69 239 27 19 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A5EWE5 8.39e-68 236 30 21 656 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dichelobacter nodosus (strain VCS1703A)
A1W0Q3 1.15e-67 236 27 19 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PN30 1.96e-67 235 27 22 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H2B2 3e-66 232 26 19 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q5HTJ5 4.33e-66 231 27 20 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni (strain RM1221)
Q0BX22 7.13e-62 220 30 15 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hyphomonas neptunium (strain ATCC 15444)
A2SH83 1.62e-61 220 30 17 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q39L16 4.12e-61 219 29 18 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0RQ83 1.95e-59 213 26 14 654 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter fetus subsp. fetus (strain 82-40)
B1YQ54 6.71e-59 213 29 19 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain MC40-6)
A7I2T7 5.9e-57 207 25 18 708 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A0K2U3 1.03e-56 206 29 19 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia cenocepacia (strain HI2424)
Q0BJQ6 1.15e-56 206 29 20 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BZN5 2.27e-56 206 29 19 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain AU 1054)
B1K1H7 3.77e-56 205 29 20 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain MC0-3)
Q2KVJ9 3.84e-56 204 31 21 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella avium (strain 197N)
A1TRM7 4.85e-55 202 29 21 661 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paracidovorax citrulli (strain AAC00-1)
Q0ALP0 4.45e-54 198 29 23 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Maricaulis maris (strain MCS10)
B1Y222 2.53e-52 194 29 20 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B0SVF8 2.97e-51 191 33 20 663 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter sp. (strain K31)
A1VQ03 2.06e-50 189 29 19 589 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas naphthalenivorans (strain CJ2)
Q9AA58 3.74e-50 187 29 18 660 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A9C3G2 1.18e-46 178 29 18 659 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Delftia acidovorans (strain DSM 14801 / SPH-1)
Q12B26 1.26e-46 178 29 16 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas sp. (strain JS666 / ATCC BAA-500)
A9I518 2.7e-45 174 28 20 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A1W6V9 1.76e-44 172 28 20 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acidovorax sp. (strain JS42)
Q7WFU7 2.74e-39 157 40 6 234 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W4D9 2.46e-38 154 39 6 234 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P44247 1.15e-24 102 46 0 112 4 HI_1536 Uncharacterized protein HI_1536 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A1WH84 3.97e-22 104 26 25 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Verminephrobacter eiseniae (strain EF01-2)
Q21WM8 4.03e-20 98 26 23 623 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02600
Feature type CDS
Gene mnmC
Product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
Location 547143 - 549155 (strand: -1)
Length 2013 (nucleotides) / 670 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1961
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01266 FAD dependent oxidoreductase
PF05430 S-adenosyl-L-methionine-dependent methyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4121 Translation, ribosomal structure and biogenesis (J) J tRNA U34 5-methylaminomethyl-2-thiouridine-forming methyltransferase MnmC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15461 tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein [EC:2.1.1.61 1.5.-.-] - -

Protein Sequence

MKKNVIETAHLTLNEQGTPVSQHFDDVYFSNEGEQAETRYVFLSGNDFPARFSRITTQTCTVAETGFGTGLNFLTLCRSFRNFRNTHPDSPLQRLHFISFEKYPLTPDDLQTAHDRWPEFADFSLQLYAQWPHAAPGCHRIFLDNGEITLDLWLGDISTLLPSLTHALDNKIDAWFLDGFAPSKNPDMWQQTLFELIARFTRQGGTFATFTAAGFVRRGLQQAGFDVERRTGFAHKRECLAGINTRAPATSLTPWHDRHPAAARRRIAVIGGGIAGVLSALALLQRGAEVSLYCADDSLATNASGNRQGALYPLLTGLDDPLERFFTVAFTFARRAYDSLSAQGVKYSHDWCGVIQLMYNEKNRKKINAIAAVPRPETLFKTLSRQQLSELAGQDVNSGGLYYPAGGWLCPQELVRGAAALAQKKGLHLYLNHNAERLEPTAQGWQIRFADNTTAQSDVVVLANGHHITQYPQTAALPVTPVRGQVSHVPTTPEITKLKAVLCYEGYLTPVNPADGQHSLGASHQRNDITTAYSEEEQIANKERLRTSLPDVNWSDEVDVSGKEAHTGIRCTVRDHLPVVGNVPDFAQLTVQYAKLERMKHRPDSVSSAADVPQLFIIGALGSRGLCTAPLAAELLAAQIFDEALPLDDETLAELHPNRFHIRKLLKGAL

Flanking regions ( +/- flanking 50bp)

GTAAAGCAGAGTAAAATCAGGGAAAGTGAACAAAAAACACAGGCTGGAATGTGAAAAAAAACGTAATTGAAACGGCTCATTTAACCCTGAACGAACAGGGTACACCTGTTTCGCAACATTTTGATGACGTCTATTTTTCAAACGAGGGTGAACAGGCGGAAACCCGTTATGTGTTCCTCAGCGGCAACGATTTTCCTGCACGGTTCAGCCGGATTACCACACAAACCTGTACCGTGGCAGAAACCGGGTTCGGTACCGGACTGAATTTTCTGACCCTCTGCCGGAGCTTTCGTAATTTCCGTAACACACACCCGGACAGCCCGCTGCAACGGTTGCATTTTATCAGTTTTGAAAAATACCCGCTGACGCCTGACGATTTACAGACCGCACATGACCGCTGGCCGGAATTCGCAGATTTCTCCTTACAACTGTACGCTCAATGGCCGCACGCGGCTCCCGGTTGTCACCGGATTTTTTTAGATAACGGTGAAATTACGCTTGATTTATGGCTGGGTGATATCAGCACACTGCTGCCGTCTCTCACCCATGCGCTGGATAACAAAATCGATGCCTGGTTTCTGGATGGCTTTGCACCATCAAAAAATCCGGATATGTGGCAGCAGACACTGTTTGAGCTGATCGCCCGGTTTACCCGTCAGGGCGGTACATTTGCCACCTTTACCGCCGCAGGCTTTGTCCGCCGTGGTTTACAACAGGCGGGGTTTGATGTTGAGCGCAGGACAGGCTTCGCACACAAACGCGAATGTCTTGCCGGTATCAATACCCGCGCACCCGCCACCTCTCTCACTCCCTGGCACGATCGCCACCCCGCTGCTGCCCGCAGGCGCATTGCGGTTATCGGCGGCGGAATAGCCGGTGTACTCAGCGCCCTCGCGCTGCTGCAAAGAGGTGCAGAGGTTTCGTTATATTGCGCTGATGACTCATTAGCCACCAATGCATCCGGCAACCGGCAGGGCGCGCTTTATCCTCTGCTGACCGGTCTGGACGATCCTCTTGAACGTTTCTTCACCGTCGCCTTTACGTTTGCACGGCGCGCCTATGATTCACTGTCTGCTCAGGGCGTAAAATACAGCCATGACTGGTGCGGTGTTATCCAACTGATGTATAACGAAAAAAACAGAAAAAAAATTAATGCCATTGCGGCTGTTCCCCGCCCTGAAACGCTGTTTAAGACACTGTCACGCCAACAACTCAGTGAACTGGCAGGTCAGGATGTGAATTCCGGTGGCCTATATTATCCTGCCGGCGGCTGGCTCTGCCCGCAGGAATTAGTCCGTGGTGCCGCCGCACTTGCACAAAAAAAAGGTCTGCATCTGTATCTGAACCATAATGCAGAGCGTCTGGAGCCGACCGCACAGGGCTGGCAGATCCGTTTTGCAGATAACACCACCGCACAGTCAGATGTGGTTGTGCTGGCAAATGGTCACCACATCACACAATATCCGCAGACCGCCGCACTGCCGGTAACCCCGGTACGTGGTCAGGTGAGCCATGTGCCGACTACTCCGGAAATTACCAAACTGAAAGCCGTGCTGTGTTATGAAGGTTATCTGACCCCGGTGAACCCGGCAGACGGGCAACACAGTCTCGGTGCCAGTCACCAGCGCAATGACATAACAACCGCATACAGTGAAGAAGAACAGATTGCCAATAAAGAGCGTCTGCGCACTTCCCTGCCGGATGTGAACTGGTCTGATGAAGTGGATGTCAGCGGAAAAGAAGCACATACAGGCATCCGCTGCACAGTGCGCGATCATCTTCCTGTTGTCGGTAACGTGCCGGACTTTGCACAACTCACGGTGCAATATGCAAAACTCGAAAGAATGAAGCACAGGCCGGACTCCGTCAGCAGCGCTGCGGATGTCCCGCAATTGTTTATCATCGGGGCGCTGGGGTCGCGGGGATTATGTACCGCACCCCTGGCAGCTGAATTGCTCGCGGCACAGATTTTTGATGAAGCCCTGCCGCTGGATGATGAAACACTGGCAGAATTGCACCCGAACCGCTTTCATATCCGTAAATTGCTCAAAGGTGCACTGTAACAGAAAAACAGATTCTGAGTTGATAACCGAGAAGGCAATGTAAATATCTG