Homologs in group_1961

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14305 FBDBKF_14305 100.0 Morganella morganii S1 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
EHELCC_07975 EHELCC_07975 100.0 Morganella morganii S2 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
LHKJJB_05965 LHKJJB_05965 100.0 Morganella morganii S3 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
HKOGLL_04950 HKOGLL_04950 100.0 Morganella morganii S5 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
F4V73_RS02600 F4V73_RS02600 75.4 Morganella psychrotolerans mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
PMI_RS08805 PMI_RS08805 54.5 Proteus mirabilis HI4320 mnmC bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC

Distribution of the homologs in the orthogroup group_1961

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1961

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JGH2 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TM73 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis (strain Pestoides F)
Q1CHL1 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7V8 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD36 0.0 801 56 4 682 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis
Q1C669 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGL1 0.0 801 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JKL6 0.0 801 57 1 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q668W0 0.0 800 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K8I4 0.0 800 56 4 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A8GH77 0.0 800 59 2 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Serratia proteamaculans (strain 568)
Q7N2A3 0.0 782 57 2 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D2N1 0.0 778 56 2 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8XCQ7 0.0 756 55 4 672 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O157:H7
B1LLT0 0.0 751 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain SMS-3-5 / SECEC)
Q3YZN7 0.0 751 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella sonnei (strain Ss046)
A7ZPE0 0.0 749 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FFH0 0.0 749 56 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B2TWA6 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1IXC1 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2J3 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O9:H4 (strain HS)
Q83QQ8 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri
Q1R988 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain UTI89 / UPEC)
P77182 0.0 748 55 4 672 1 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12)
A1ADH3 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O1:K1 / APEC
B1X935 0.0 748 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli (strain K12 / DH10B)
Q0TFC2 0.0 746 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0T2G1 0.0 746 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella flexneri serotype 5b (strain 8401)
Q31YD4 0.0 745 55 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella boydii serotype 4 (strain Sb227)
Q32DL2 0.0 744 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shigella dysenteriae serotype 1 (strain Sd197)
A9N465 0.0 743 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8ZNB2 0.0 740 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCW7 0.0 738 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LX5 0.0 738 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella choleraesuis (strain SC-B67)
A7MH59 0.0 737 57 2 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cronobacter sakazakii (strain ATCC BAA-894)
Q8Z4Z3 0.0 736 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella typhi
A9MJ47 0.0 733 54 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8ADQ4 0.0 728 55 4 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TC10 0.0 720 55 5 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WCV7 0.0 701 52 4 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Enterobacter sp. (strain 638)
Q5E450 0.0 651 47 3 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7MS81 0.0 647 48 6 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio campbellii (strain ATCC BAA-1116)
Q87MN6 0.0 636 47 6 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A5F6E9 0.0 632 47 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C3LP59 0.0 631 47 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain M66-2)
Q9KQ91 0.0 631 47 5 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DB38 0.0 624 47 6 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain CMCP6)
Q7MIT5 0.0 622 47 6 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Vibrio vulnificus (strain YJ016)
A4SNE3 0.0 622 48 8 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas salmonicida (strain A449)
A0KJJ9 0.0 622 48 9 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q65S61 0.0 614 45 5 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VMR0 0.0 603 45 7 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4QKP6 0.0 602 46 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain 86-028NP)
P44246 0.0 601 46 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UCC9 0.0 601 46 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittEE)
A5UEH1 0.0 600 46 4 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus influenzae (strain PittGG)
Q0I2W9 0.0 596 45 4 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 129Pt)
B0UT85 0.0 595 44 5 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Histophilus somni (strain 2336)
Q9CNT7 0.0 590 46 4 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pasteurella multocida (strain Pm70)
A1SW96 2.98e-179 530 41 10 695 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7VM59 1.2e-176 522 40 5 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B0BPE2 3.27e-176 521 42 6 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q6LNT9 1.48e-175 521 41 9 693 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Photobacterium profundum (strain SS9)
A3N0L8 3.77e-175 519 42 6 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q3IF34 3.97e-162 485 39 11 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas translucida (strain TAC 125)
Q15QE8 7.87e-149 452 39 14 708 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5QUE0 2.22e-141 430 40 16 659 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A4XXB7 1.25e-140 429 40 14 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas mendocina (strain ymp)
Q1H1H9 1.58e-139 426 39 10 657 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4VMX4 4.71e-137 420 41 14 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Stutzerimonas stutzeri (strain A1501)
Q7NWN9 2.34e-135 416 41 18 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q47XJ9 1e-134 415 35 14 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q4K8K9 3.7e-133 410 39 17 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9HYF0 8.64e-133 409 40 12 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QU5 1.12e-132 409 40 12 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V1X0 2.81e-130 402 40 13 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas aeruginosa (strain PA7)
Q3K8R9 3.73e-130 402 39 14 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas fluorescens (strain Pf0-1)
Q886E0 4.97e-130 402 38 16 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48LF6 1.16e-128 399 38 16 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZPZ9 6.26e-127 394 37 15 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas syringae pv. syringae (strain B728a)
B0KTW1 1.33e-125 390 36 12 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain GB-1)
Q1QZP3 2.4e-125 391 38 17 683 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q88M24 4.44e-125 389 37 12 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W7H7 4.21e-123 384 36 12 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q1IDB9 1.12e-117 370 37 14 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas entomophila (strain L48)
A6W0S5 8.38e-116 365 34 13 697 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinomonas sp. (strain MWYL1)
B1J5F1 2.52e-115 364 36 17 683 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Pseudomonas putida (strain W619)
Q5ZVA8 9.54e-111 352 34 18 688 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IC27 1.13e-110 352 34 17 687 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Corby)
Q5X531 1.39e-108 347 33 19 687 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Paris)
A1K5J4 1.42e-108 345 37 14 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Azoarcus sp. (strain BH72)
Q31JE7 8.17e-108 345 36 20 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5WWF9 2.39e-107 343 33 18 687 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Legionella pneumophila (strain Lens)
Q2Y7P9 9.6e-107 340 35 15 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2SD50 7.68e-106 338 34 19 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hahella chejuensis (strain KCTC 2396)
Q47C51 1.58e-104 335 35 18 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dechloromonas aromatica (strain RCB)
A4Y884 1.82e-104 336 33 12 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A1RIA5 1.01e-103 334 33 12 645 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain W3-18-1)
Q5NY30 1.07e-102 330 35 15 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1S7K4 2.02e-101 328 39 5 443 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8XYP9 5.59e-101 326 34 14 664 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A6WQ09 6.12e-100 324 32 12 650 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS185)
A9KTV2 3.38e-99 323 32 13 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS195)
Q1LM60 3.72e-99 322 34 15 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A3D671 8.48e-99 322 32 16 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q472D5 9.15e-99 321 34 19 685 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q21KP6 4.75e-97 317 34 15 708 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A8H2Z3 5.36e-97 315 35 11 565 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0HWM0 1.36e-96 316 33 19 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-7)
Q0HKB8 1.74e-96 316 33 17 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain MR-4)
B2T7N8 2.86e-96 314 33 16 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B2HYP8 6.67e-96 312 33 17 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ACICU)
Q084S3 1.76e-95 313 33 20 692 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella frigidimarina (strain NCIMB 400)
Q8ECR0 2.23e-95 313 32 13 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1TZU2 2.48e-95 311 33 14 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0KV89 3.99e-95 312 32 15 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sp. (strain ANA-3)
A3M8T4 7.77e-95 309 33 17 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q0KBK6 9.92e-95 310 34 17 682 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q72UK9 2.36e-94 308 30 17 689 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F0E4 3e-94 308 30 17 689 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q04XS7 6.59e-94 308 31 17 683 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04VP5 6.59e-94 308 31 17 683 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q6F7Y9 6.19e-93 304 32 20 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B2JJN6 1.18e-92 304 34 19 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q13SL2 4.15e-91 300 32 14 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paraburkholderia xenovorans (strain LB400)
A4J9Z5 3.83e-90 298 34 19 675 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia vietnamiensis (strain G4 / LMG 22486)
A0LA84 1.6e-89 296 34 15 678 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B0V636 3.9e-88 291 32 17 666 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acinetobacter baumannii (strain AYE)
Q2T2K1 3.9e-87 290 34 17 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B0TL07 3.06e-86 287 34 10 555 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella halifaxensis (strain HAW-EB4)
A3QFM9 4.05e-86 288 33 17 585 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1V8X2 1.94e-85 285 33 16 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain SAVP1)
Q63Z34 4.27e-85 285 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain K96243)
Q3SID4 6.33e-85 283 36 18 654 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Thiobacillus denitrificans (strain ATCC 25259)
A3NPL7 6.62e-85 284 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1106a)
Q62FV6 6.62e-85 284 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain ATCC 23344)
A2S6N9 6.62e-85 284 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10229)
A3MQF7 6.62e-85 284 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia mallei (strain NCTC 10247)
Q3JXS0 9.53e-85 283 33 16 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 1710b)
A3N3Y7 1.47e-84 283 33 16 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia pseudomallei (strain 668)
Q12P60 3.53e-83 281 38 6 424 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9AJC5 3.69e-83 279 32 19 679 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia multivorans (strain ATCC 17616 / 249)
B1KKR3 4.89e-83 280 31 12 623 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella woodyi (strain ATCC 51908 / MS32)
Q1Q999 1.63e-80 273 30 19 712 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FR09 1.19e-78 268 30 22 710 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A5WGY8 1.65e-78 269 30 27 769 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Psychrobacter sp. (strain PRwf-1)
A8FTT1 1.87e-78 268 30 16 676 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Shewanella sediminis (strain HAW-EB3)
A7ZEX8 3.76e-75 257 29 22 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter concisus (strain 13826)
Q0BX22 4.65e-71 245 32 17 668 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Hyphomonas neptunium (strain ATCC 15444)
A7H2B2 5.33e-70 243 29 22 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FMX4 9.97e-70 242 29 21 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W0Q3 7.74e-68 237 29 21 673 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PN30 1.52e-67 236 28 22 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HTJ5 1.16e-66 234 28 22 677 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter jejuni (strain RM1221)
Q0ALP0 4.04e-66 231 31 23 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Maricaulis maris (strain MCS10)
A5EWE5 1.04e-65 231 30 21 670 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Dichelobacter nodosus (strain VCS1703A)
A2SH83 2.54e-63 226 32 18 671 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q7WFU7 1.35e-60 218 31 20 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A0RQ83 8.25e-60 215 26 15 661 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter fetus subsp. fetus (strain 82-40)
Q2KVJ9 1.28e-59 214 31 22 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella avium (strain 197N)
Q7W4D9 1.81e-59 214 31 20 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9AA58 1.62e-58 211 32 20 653 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q39L16 1.42e-57 209 29 19 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A1TRM7 2.3e-57 209 30 23 680 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Paracidovorax citrulli (strain AAC00-1)
B1YQ54 3.93e-56 206 29 21 647 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain MC40-6)
Q0BJQ6 4.85e-56 205 30 21 647 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1VQ03 2.54e-55 203 29 22 687 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas naphthalenivorans (strain CJ2)
A7I2T7 4.09e-55 203 24 19 713 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B1Y222 1.02e-54 202 30 23 688 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B1K1H7 2.18e-52 195 28 20 674 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain MC0-3)
Q1BZN5 3.64e-52 194 29 19 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia orbicola (strain AU 1054)
A0K2U3 5.5e-52 194 29 19 672 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Burkholderia cenocepacia (strain HI2424)
A9I518 1.57e-49 187 30 23 662 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q12B26 2.19e-49 186 29 14 667 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Polaromonas sp. (strain JS666 / ATCC BAA-500)
A1W6V9 2.41e-49 186 28 17 691 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Acidovorax sp. (strain JS42)
A9C3G2 1.63e-45 176 29 19 665 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Delftia acidovorans (strain DSM 14801 / SPH-1)
B0SVF8 1.77e-40 160 41 2 239 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter sp. (strain K31)
B0SVF8 5.03e-11 69 33 8 234 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Caulobacter sp. (strain K31)
A1WH84 6.75e-24 110 27 23 669 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Verminephrobacter eiseniae (strain EF01-2)
P44247 8.61e-21 91 42 0 111 4 HI_1536 Uncharacterized protein HI_1536 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q21WM8 3.17e-18 92 25 22 652 3 mnmC tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8Y0W7 0.000114 48 23 10 374 3 dadA1 D-amino acid dehydrogenase 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08300
Feature type CDS
Gene mnmC
Product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC
Location 53697 - 55802 (strand: -1)
Length 2106 (nucleotides) / 701 (amino acids)
In genomic island -

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1961
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01266 FAD dependent oxidoreductase
PF05430 S-adenosyl-L-methionine-dependent methyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4121 Translation, ribosomal structure and biogenesis (J) J tRNA U34 5-methylaminomethyl-2-thiouridine-forming methyltransferase MnmC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15461 tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein [EC:2.1.1.61 1.5.-.-] - -

Protein Sequence

MSHPAWQYSAKQSKIRENRTESSGRNVKKTAIETAHLTWNEQGTPVSQHFDDVYFSNDDGLAETRYVFLNGNGFPDRFSQMTTPVCTVAETGFGTGLNFLTLWQSFLAFRNANPVHPLKRLHFISFEKFPLTVADLQAAHRHWPEFADFSLQLCAQWPQPLPGCHRIQLSGGEITLDLWLGDVNELLPSLTHALDNKIDAWFLDGFAPSKNPDMWQQSLFDLMIRFSKPGGTFATFTAAGFVRRGLQQAGFDVERRKGFAHKRECLSGVNPRDAAPSVTPWFDRHPAAARQKIAVIGGGIAGVFSALALLRRGADVSLYCADAALALNASGNRQGALYPLLTGRDDPLERFFTAAFPFARRTYDALSAQGVKYDHDWCGVIQLMYHEKSSKKINNISSVPWPDEMVQRLSREQLSELAGTDVNFDGLHYPQGGWLCPQELVRNTAALAQKEGLHLRLNCEVKALIPAEQGWQLRFADNSTAEADVVVLANGHCITQFPQTAPLPVTPVRGQVSHVPSVPAIAGLKKVLCYEGYLTPVNPADGLHCIGASHQRNDLGTEYREEEQTANKQRLLASLPDVNWPEMVDISAGESRQGIRCTLRDHLPLAGNVPDFAELTERYAHLDEQKSSPETVCSVPHLPQLFLLAALGSRGLCTAPLAAEVLAAQIFGEALPLDDETLAAIHPARFYVRKLLKGRPLPKKS

Flanking regions ( +/- flanking 50bp)

ACAAGTCCGATCAGACGTTTTTTCGCATCTTTACATACCGATGTTGTGCTATGTCACATCCGGCATGGCAGTACAGCGCAAAGCAGAGTAAAATCAGGGAAAACCGAACAGAATCCTCAGGCCGTAACGTGAAAAAAACCGCAATTGAAACTGCACATTTAACCTGGAATGAACAGGGTACACCTGTTTCGCAACATTTTGATGACGTCTATTTTTCGAACGATGACGGACTGGCGGAAACCCGCTATGTGTTTCTTAACGGAAACGGTTTTCCGGACAGATTTTCACAAATGACCACTCCGGTCTGTACTGTCGCAGAAACCGGGTTTGGTACCGGACTGAATTTTCTCACGTTGTGGCAGAGCTTCCTGGCGTTCCGGAATGCCAATCCTGTGCATCCTCTGAAGCGCCTGCACTTTATCAGTTTTGAAAAATTTCCGCTGACCGTGGCTGATTTACAGGCCGCCCACCGCCACTGGCCGGAGTTCGCGGATTTCTCCTTACAGCTGTGCGCTCAGTGGCCGCAGCCATTACCCGGTTGTCACCGTATTCAGTTGTCCGGCGGTGAAATTACCCTCGATTTATGGCTGGGAGATGTTAATGAGCTGCTCCCTTCCCTCACTCACGCGCTGGACAACAAAATCGACGCCTGGTTTCTCGACGGGTTTGCGCCGTCCAAAAACCCGGATATGTGGCAGCAGTCGCTGTTTGATTTGATGATTCGTTTTTCAAAACCGGGCGGCACCTTTGCCACCTTTACTGCCGCCGGGTTTGTCCGCCGGGGTTTACAGCAGGCCGGGTTTGACGTTGAGCGCCGCAAAGGCTTTGCGCACAAGCGGGAATGCCTGTCCGGGGTGAATCCCCGTGACGCGGCACCGTCCGTGACACCCTGGTTTGATCGCCATCCGGCTGCTGCCCGGCAGAAGATAGCAGTCATTGGCGGCGGGATAGCCGGAGTTTTCTCTGCCCTCGCCCTGCTGCGCCGTGGTGCGGATGTGTCCTTATATTGCGCGGATGCGGCTCTGGCACTCAATGCTTCCGGCAACCGCCAGGGTGCGCTTTATCCGCTGCTGACCGGACGGGATGATCCGCTTGAGCGCTTTTTTACCGCCGCATTTCCGTTTGCCCGGCGTACATATGATGCACTGTCAGCTCAGGGTGTGAAATACGACCATGACTGGTGCGGCGTGATCCAACTGATGTATCACGAAAAAAGCAGTAAAAAAATCAATAACATTTCATCTGTCCCATGGCCGGATGAAATGGTGCAGCGCCTGTCACGGGAACAGCTTTCTGAGCTTGCCGGAACCGATGTCAATTTTGACGGCCTGCACTATCCGCAGGGCGGCTGGCTCTGCCCGCAGGAACTGGTACGCAATACCGCAGCGCTGGCACAGAAAGAAGGGCTTCATCTGCGTTTAAACTGTGAGGTGAAAGCGCTGATCCCGGCAGAACAGGGCTGGCAGCTCCGCTTTGCAGATAACAGCACAGCAGAGGCGGATGTGGTGGTGCTGGCCAACGGTCACTGTATCACGCAGTTCCCGCAGACCGCCCCGCTGCCGGTCACGCCGGTGCGCGGCCAGGTCAGCCATGTGCCATCGGTACCGGCGATTGCCGGGCTGAAAAAAGTGCTGTGTTATGAAGGTTATCTGACCCCGGTGAATCCGGCTGACGGTCTGCACTGTATTGGTGCCAGCCACCAGCGCAACGACTTGGGCACGGAATACCGCGAAGAGGAACAAACTGCCAACAAACAGCGGCTGCTCGCCTCGCTGCCGGATGTCAACTGGCCGGAGATGGTGGATATCAGCGCCGGGGAGTCCCGTCAGGGGATCCGCTGCACATTACGCGATCACCTGCCGCTGGCCGGAAATGTTCCCGATTTTGCAGAATTAACAGAACGTTATGCACATCTGGATGAACAAAAATCGTCCCCGGAAACCGTATGCAGTGTTCCGCATCTGCCTCAGCTGTTTTTGCTGGCCGCTCTCGGCTCGCGGGGGTTATGCACCGCCCCGCTGGCGGCTGAAGTGCTGGCAGCACAGATTTTCGGTGAGGCCCTTCCGCTGGATGATGAAACACTCGCTGCTATTCATCCCGCCCGTTTCTATGTCCGTAAATTGCTGAAAGGCCGTCCGCTGCCGAAAAAATCCTGACCCGCTTCTGACCGGCCACCGGGCTGGTCTTCATCACATTATTGATATTT