Homologs in group_1910

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14235 FBDBKF_14235 88.3 Morganella morganii S1 purF amidophosphoribosyltransferase
EHELCC_08045 EHELCC_08045 88.3 Morganella morganii S2 purF amidophosphoribosyltransferase
NLDBIP_08370 NLDBIP_08370 88.3 Morganella morganii S4 purF amidophosphoribosyltransferase
LHKJJB_05895 LHKJJB_05895 88.3 Morganella morganii S3 purF amidophosphoribosyltransferase
HKOGLL_05020 HKOGLL_05020 88.3 Morganella morganii S5 purF amidophosphoribosyltransferase
F4V73_RS02675 F4V73_RS02675 88.1 Morganella psychrotolerans purF amidophosphoribosyltransferase

Distribution of the homologs in the orthogroup group_1910

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1910

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AG17 0.0 879 82 0 505 3 purF Amidophosphoribosyltransferase Shigella flexneri
P0AG16 0.0 879 82 0 505 1 purF Amidophosphoribosyltransferase Escherichia coli (strain K12)
Q9L6B8 0.0 744 69 3 505 3 purF Amidophosphoribosyltransferase Pasteurella multocida (strain Pm70)
P43854 0.0 724 68 3 506 3 purF Amidophosphoribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q51342 0.0 644 61 3 504 3 purF Amidophosphoribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P04046 6.58e-171 494 50 4 509 1 ADE4 Amidophosphoribosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12698 1.09e-170 494 49 5 514 3 ADE4 Amidophosphoribosyltransferase Lachancea kluyveri
P41390 2.71e-168 489 49 7 521 1 ade4 Amidophosphoribosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q57657 2.78e-104 323 42 13 470 3 purF Amidophosphoribosyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O29388 7.89e-103 318 42 12 453 3 purF Amidophosphoribosyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O26742 2.23e-102 318 40 11 472 3 purF Amidophosphoribosyltransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P00497 1.24e-97 306 40 12 471 1 purF Amidophosphoribosyltransferase Bacillus subtilis (strain 168)
Q55038 1.25e-95 301 39 14 471 3 purF Amidophosphoribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55621 2.48e-94 298 39 12 469 3 purF Amidophosphoribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9STG9 6.3e-92 294 38 9 470 1 ASE2 Amidophosphoribosyltransferase 2, chloroplastic Arabidopsis thaliana
P52418 6.08e-91 291 39 8 443 2 PUR1 Amidophosphoribosyltransferase, chloroplastic Glycine max
Q9SI61 2.34e-90 290 37 11 496 2 ASE1 Amidophosphoribosyltransferase 1, chloroplastic Arabidopsis thaliana
Q9V253 1.47e-89 284 41 15 451 3 purF Amidophosphoribosyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
P28173 1.92e-89 286 38 14 476 1 PPAT Amidophosphoribosyltransferase Gallus gallus
O57979 1.37e-87 279 39 15 447 3 purF Amidophosphoribosyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P9WHQ7 8.85e-87 279 38 13 477 1 purF Amidophosphoribosyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHQ6 8.85e-87 279 38 13 477 3 purF Amidophosphoribosyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65830 8.85e-87 279 38 13 477 3 purF Amidophosphoribosyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P52419 3.45e-86 276 38 12 467 2 PUR1 Amidophosphoribosyltransferase, chloroplastic (Fragment) Vigna aconitifolia
P77935 1.11e-85 275 39 16 482 3 purF Amidophosphoribosyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8CIH9 3.8e-84 272 36 13 475 1 Ppat Amidophosphoribosyltransferase Mus musculus
P35433 7.52e-84 271 36 14 478 1 Ppat Amidophosphoribosyltransferase Rattus norvegicus
Q86A85 9.69e-84 271 37 11 461 3 purF Amidophosphoribosyltransferase Dictyostelium discoideum
Q06203 1.14e-83 271 36 14 477 1 PPAT Amidophosphoribosyltransferase Homo sapiens
Q50028 2.38e-82 268 37 14 477 3 purF Amidophosphoribosyltransferase Mycobacterium leprae (strain TN)
Q8NX91 1.15e-81 265 37 11 448 3 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain MW2)
Q6GAE3 1.15e-81 265 37 11 448 3 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain MSSA476)
Q5HH14 1.15e-81 265 37 11 448 3 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain COL)
P99164 1.66e-81 265 37 11 448 1 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain N315)
P65831 1.66e-81 265 37 11 448 3 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GI14 1.22e-80 262 36 11 448 3 purF Amidophosphoribosyltransferase Staphylococcus aureus (strain MRSA252)
Q9T0J5 2.38e-80 263 37 8 443 1 ASE3 Amidophosphoribosyltransferase 3, chloroplastic Arabidopsis thaliana
Q8CT30 7.42e-79 258 35 12 451 3 purF Amidophosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA0 7.42e-79 258 35 12 451 3 purF Amidophosphoribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q27601 4.61e-74 246 34 13 479 1 Prat Amidophosphoribosyltransferase Drosophila melanogaster
P35853 9.94e-25 104 38 8 196 3 purF Amidophosphoribosyltransferase (Fragment) Lacticaseibacillus casei
P25195 2.61e-20 97 32 6 215 2 nodM Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Rhizobium meliloti
Q8UEH1 2.65e-19 94 32 10 243 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5FUY5 6.71e-19 93 32 10 230 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Gluconobacter oxydans (strain 621H)
P59362 1.02e-18 92 33 8 223 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92PS4 1.43e-18 92 33 10 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Rhizobium meliloti (strain 1021)
Q6G322 1.76e-18 92 32 7 214 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
P08633 3.96e-18 91 31 7 220 3 nodM Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Rhizobium leguminosarum bv. viciae
Q92ZK3 4.56e-18 90 33 10 224 3 nodM Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Rhizobium meliloti (strain 1021)
Q4J6D9 1.29e-17 89 29 10 253 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q6LWM9 1.86e-17 89 31 7 197 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q98LX5 2.1e-17 89 33 8 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6FZH6 9.11e-17 87 31 7 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bartonella quintana (strain Toulouse)
F9VPA4 1e-16 86 30 8 199 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q5NRH4 1.55e-16 86 30 8 237 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q5QZH5 3.28e-16 85 30 7 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P94323 4.5e-16 84 32 8 219 3 nodM Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q890U2 9.72e-16 83 29 10 255 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Clostridium tetani (strain Massachusetts / E88)
Q8CX33 9.82e-16 83 31 8 232 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
O57981 1.03e-15 83 32 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q83IA1 1.22e-15 83 29 6 176 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Tropheryma whipplei (strain TW08/27)
Q9YCQ6 1.25e-15 83 31 4 178 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q83FU2 1.28e-15 83 29 6 176 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Tropheryma whipplei (strain Twist)
Q8R841 1.38e-15 83 30 7 220 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8AAB1 1.79e-15 82 29 8 219 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5WSX8 2.28e-15 82 27 9 242 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Legionella pneumophila (strain Lens)
Q5ZRP4 2.42e-15 82 27 9 242 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X153 2.42e-15 82 27 9 242 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Legionella pneumophila (strain Paris)
Q8TLL3 2.61e-15 82 31 10 225 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O83833 2.78e-15 82 30 6 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Treponema pallidum (strain Nichols)
Q8Q038 3.37e-15 82 30 9 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8CY30 3.89e-15 81 31 8 223 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Brucella suis biovar 1 (strain 1330)
Q8YC47 3.96e-15 81 32 8 223 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q577Y1 3.96e-15 81 32 8 223 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Brucella abortus biovar 1 (strain 9-941)
Q5NHQ9 4.59e-15 81 32 12 218 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q8TZ14 6.92e-15 80 31 6 199 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q87SR3 1.01e-14 80 29 8 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8XHZ7 1.08e-14 80 29 9 215 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Clostridium perfringens (strain 13 / Type A)
P44708 1.29e-14 80 29 6 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8D3J0 1.32e-14 80 27 8 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Wigglesworthia glossinidia brevipalpis
O68956 1.52e-14 80 29 10 259 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q56213 1.67e-14 79 31 10 244 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q7NA97 2.42e-14 79 30 8 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q5E279 2.56e-14 79 31 11 233 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q74GH6 3.51e-14 78 33 10 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6CYJ9 3.9e-14 78 30 11 260 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8DJI6 4.6e-14 78 30 11 245 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5L3P0 4.92e-14 78 28 11 238 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Geobacillus kaustophilus (strain HTA426)
Q72HF4 6.45e-14 77 31 10 244 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q9KUM8 6.86e-14 77 30 6 175 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q663R1 7.82e-14 77 28 12 262 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8Z9S8 7.82e-14 77 28 12 262 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Yersinia pestis
Q8Z2Q2 9.08e-14 77 32 9 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Salmonella typhi
Q83IY4 9.83e-14 77 31 11 252 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Shigella flexneri
P57138 1e-13 77 27 8 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P9WN49 1.51e-13 76 31 4 173 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WN48 1.51e-13 76 31 4 173 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A589 1.51e-13 76 31 4 173 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8ZKX1 1.65e-13 76 31 8 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PKV9 1.71e-13 76 31 8 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9ABV2 1.98e-13 76 31 7 214 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8FBT4 2.31e-13 76 31 11 252 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P17169 2.61e-13 75 31 11 252 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Escherichia coli (strain K12)
P57963 2.64e-13 75 28 7 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pasteurella multocida (strain Pm70)
Q7MP62 2.66e-13 75 28 8 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Vibrio vulnificus (strain YJ016)
Q8XEG2 2.68e-13 75 31 11 252 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Escherichia coli O157:H7
Q8DEF3 2.8e-13 75 28 8 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Vibrio vulnificus (strain CMCP6)
Q97MN6 3.19e-13 75 27 10 248 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6LLH3 3.2e-13 75 30 9 230 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Photobacterium profundum (strain SS9)
O26273 3.33e-13 75 29 10 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9KG45 4.4e-13 75 29 11 241 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6F6U8 5.53e-13 75 28 8 219 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8EZQ1 5.66e-13 75 32 4 137 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72V57 5.66e-13 75 32 4 137 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8U4D1 7.77e-13 74 29 6 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9HT00 8.3e-13 74 28 10 238 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q87TT8 9.19e-13 74 27 6 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7VKK4 1.65e-12 73 29 10 255 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O68280 2.38e-12 73 28 11 243 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Nostoc sp. (strain PCC 9229)
Q88BX8 3.81e-12 72 29 8 225 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8KG38 1.01e-11 70 29 15 262 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8ETM5 1.47e-11 70 28 9 213 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8RG65 1.47e-11 70 26 6 171 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5JH71 1.6e-11 70 30 6 173 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9V249 1.63e-11 70 28 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pyrococcus abyssi (strain GE5 / Orsay)
Q56275 1.73e-11 70 28 3 176 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Acidithiobacillus ferridurans
Q8ZTZ0 2.1e-11 70 27 7 199 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q9PH05 2.73e-11 69 26 4 173 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Xylella fastidiosa (strain 9a5c)
Q9WXZ5 3.93e-11 68 29 7 176 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P72720 4.3e-11 68 30 11 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9Z6U0 4.49e-11 68 28 10 247 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlamydia pneumoniae
Q7NIG8 5.59e-11 68 32 6 170 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9PLA4 5.62e-11 68 27 7 194 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlamydia muridarum (strain MoPn / Nigg)
Q73S23 6.54e-11 68 28 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0CI73 7.71e-11 68 30 7 170 2 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus subtilis (strain 168)
P59499 7.8e-11 68 24 8 226 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q5L589 9.53e-11 67 26 7 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlamydia abortus (strain DSM 27085 / S26/3)
Q722H1 1.08e-10 67 27 11 260 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Listeria monocytogenes serotype 4b (strain F2365)
Q8CRL1 1.09e-10 67 28 8 220 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM69 1.09e-10 67 28 8 220 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8Y915 1.4e-10 67 27 11 260 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q81J01 1.64e-10 67 26 10 242 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8NVE6 1.65e-10 67 27 8 227 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain MW2)
Q6G7F8 1.65e-10 67 27 8 227 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain MSSA476)
Q6GES3 1.65e-10 67 27 8 227 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain MRSA252)
P64228 1.65e-10 67 27 8 227 1 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain N315)
P64227 1.65e-10 67 27 8 227 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HE49 1.65e-10 67 27 8 227 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Staphylococcus aureus (strain COL)
E0U070 1.68e-10 67 27 10 236 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
O84823 1.91e-10 67 28 7 194 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O86781 1.97e-10 67 29 10 223 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9HT25 2.15e-10 66 26 6 224 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8DZZ7 2.5e-10 66 28 11 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q73F49 2.72e-10 66 26 10 242 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPL2 2.86e-10 66 26 9 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VN5 3.1e-10 66 26 9 229 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus anthracis
Q8E5P8 3.77e-10 65 28 11 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus agalactiae serotype III (strain NEM316)
P40831 4.59e-10 65 30 4 143 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Mycobacterium leprae (strain TN)
Q5WLG7 5e-10 65 27 8 231 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Shouchella clausii (strain KSM-K16)
Q8DTY0 5.16e-10 65 29 3 136 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8Y303 5.16e-10 65 29 4 171 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q88YE7 6.83e-10 65 27 12 261 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O26060 9.6e-10 64 26 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Helicobacter pylori (strain ATCC 700392 / 26695)
Q92DS8 9.64e-10 64 26 10 257 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q65P46 9.8e-10 64 26 10 250 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q87F28 1.28e-09 64 26 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q821Z7 1.69e-09 63 25 5 170 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q67T12 2.52e-09 63 27 11 264 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q7VRZ3 3.3e-09 63 27 8 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W334 3.3e-09 63 27 8 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WE36 3.3e-09 63 27 8 221 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9CGT6 3.62e-09 62 29 3 137 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Lactococcus lactis subsp. lactis (strain IL1403)
Q7T6X6 4.2e-09 62 25 12 263 3 MIMI_L619 Probable glutamine--fructose-6-phosphate aminotransferase [isomerizing] Acanthamoeba polyphaga mimivirus
O19908 4.23e-09 62 26 9 222 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Cyanidium caldarium
Q9ZJ94 4.66e-09 62 26 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Helicobacter pylori (strain J99 / ATCC 700824)
Q9PMT4 5.27e-09 62 27 7 202 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O66648 5.32e-09 62 26 4 175 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Aquifex aeolicus (strain VF5)
Q97SQ9 6.52e-09 62 26 8 220 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8PGH9 1.13e-08 61 28 5 169 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Xanthomonas axonopodis pv. citri (strain 306)
Q8DRA8 1.32e-08 61 28 10 217 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q52846 1.76e-08 55 37 4 107 3 nodM Glutamine--fructose-6-phosphate aminotransferase [isomerizing] (Fragment) Rhizobium leguminosarum bv. trifolii
Q6NG33 2.11e-08 60 28 8 184 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5XBV6 2.7e-08 60 27 4 136 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8KA75 3.31e-08 59 24 7 244 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q99ZD3 4.52e-08 59 26 10 226 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pyogenes serotype M1
Q8P0S7 5.52e-08 59 26 10 226 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DB33 5.81e-08 58 26 10 226 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB32 5.81e-08 58 26 10 226 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8PCY1 6.05e-08 58 27 5 173 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q08DQ2 7.06e-08 58 26 9 231 2 GFPT2 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2 Bos taurus
O94808 1.13e-07 58 26 9 233 1 GFPT2 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2 Homo sapiens
Q9Z2Z9 3.28e-07 56 27 10 231 1 Gfpt2 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2 Mus musculus
Q58815 3.34e-07 57 36 1 76 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6AD32 4.3e-07 56 30 4 141 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Leifsonia xyli subsp. xyli (strain CTCB07)
Q4KMC4 8e-07 55 26 10 231 1 Gfpt2 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 2 Rattus norvegicus
Q8FNH2 1.16e-06 55 28 7 185 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
O26293 1.9e-06 53 25 7 201 3 MTH_191 Putative glutamine amidotransferase MTH_191 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8NND3 3.21e-06 53 29 9 204 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q06210 4.75e-05 49 22 6 250 1 GFPT1 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1 Homo sapiens
Q5F584 4.75e-05 49 29 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
O87390 5.68e-05 48 26 5 158 3 glxB Glutamine amidotransferase-like protein GlxB Rhizobium meliloti (strain 1021)
Q9JWN9 9.17e-05 48 29 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P82808 0.000101 48 23 5 192 1 Gfpt1 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1 Rattus norvegicus
Q9K1P9 0.00011 48 29 5 174 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P47856 0.000309 47 22 5 192 1 Gfpt1 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1 Mus musculus
Q9LIP9 0.000584 46 25 9 230 2 GFAT1 Glutamine--fructose-6-phosphate aminotransferase [isomerizing] 1 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08745
Feature type CDS
Gene purF
Product amidophosphoribosyltransferase
Location 1912830 - 1914347 (strand: -1)
Length 1518 (nucleotides) / 505 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1910
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00156 Phosphoribosyl transferase domain
PF13522 Glutamine amidotransferase domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0034 Nucleotide transport and metabolism (F) F Glutamine phosphoribosylpyrophosphate amidotransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MCGIVGIAGVNPVNQSIYDALTVLQHRGQDAAGIATIDENNGFRLRKANGLVKDVFETRHMLRLKGTIGIGHVRYPTAGSSSASEAQPFYVNSPFGITLAHNGNLTNAHLLRRQLFETARRHINTTSDSEILLNVLAYELDRFDHFPLEPDNIFTAVAAMHKKLRGAYACVALIIGHGLLAFRDPYGIRPLVLGKRTLEDGRSEYMVASESVALDTLGFEFLRDVAPGEAVYITEQGQLFTRQCAENPQLVPCLFEYVYFARPDSFIDKISVYNARLRMGQKLGAKIAKEWEDLQIDVVIPIPETSCDIALEIAHILNKPYRQGFVKNRYVGRTFIMPGQQERRKSVRRKLNANRAEFRDKNVLLIDDSIVRGTTSEQIVELAREAGAKKVYFASAAPEVRFPNVYGIDMPNANELIAHGREVDEIRKLIGADGLIFQDLSDLIAAVQEENPDINQFECSVFDGVYITKDIDQGYLDYLENLRRDDEHKIRDQHEAENLEIYNEG

Flanking regions ( +/- flanking 50bp)

TCGTGTCGGAGAAAATGTAACCTCTCCGTCTGGCTGATGAGGATCTTTTCATGTGCGGTATTGTCGGTATCGCTGGAGTTAATCCAGTAAACCAATCGATTTATGATGCGTTAACGGTGTTACAACACCGAGGTCAAGATGCAGCAGGCATTGCAACAATTGATGAGAATAACGGTTTTCGTCTACGCAAAGCAAATGGGCTGGTGAAAGATGTCTTTGAAACGCGTCATATGTTGCGTTTAAAAGGAACTATCGGAATAGGACATGTACGTTATCCAACCGCGGGCAGTTCGAGTGCATCAGAAGCGCAACCTTTTTATGTTAACTCACCTTTTGGGATCACACTTGCACATAATGGTAATTTAACCAATGCGCATTTGTTGCGTCGTCAATTATTTGAAACTGCTCGTCGACATATCAATACCACCTCAGACTCCGAAATTTTACTCAATGTGCTAGCGTATGAATTAGATCGCTTCGATCATTTTCCGCTAGAGCCAGATAATATTTTTACCGCTGTTGCGGCTATGCATAAAAAATTACGTGGCGCTTATGCTTGCGTTGCTTTGATCATCGGCCACGGCTTATTAGCTTTTCGTGATCCTTATGGCATTCGTCCTTTAGTGTTAGGCAAACGTACTTTAGAAGATGGACGCAGTGAGTATATGGTTGCGTCTGAAAGTGTCGCTCTAGATACACTAGGATTTGAATTCTTGCGTGATGTAGCACCCGGTGAGGCTGTTTATATCACAGAGCAAGGACAACTGTTTACTCGTCAATGTGCTGAAAATCCGCAATTAGTGCCTTGTCTATTTGAGTATGTTTATTTTGCGCGTCCAGACTCTTTTATTGATAAAATTTCCGTATATAACGCCCGTCTACGTATGGGGCAAAAACTCGGCGCTAAAATTGCTAAAGAGTGGGAAGATTTACAAATAGATGTGGTGATCCCTATTCCTGAAACTTCTTGTGATATTGCATTAGAAATTGCCCACATCTTAAATAAACCTTATCGACAAGGTTTTGTGAAGAATCGTTATGTTGGACGTACTTTTATTATGCCCGGCCAGCAAGAGCGTCGCAAATCAGTACGTCGTAAACTAAATGCCAACCGTGCAGAATTTCGCGATAAAAACGTGTTACTTATCGATGACTCTATCGTACGTGGCACAACATCAGAGCAAATTGTTGAGTTAGCGAGAGAAGCGGGGGCTAAAAAAGTTTATTTTGCCTCAGCCGCTCCAGAAGTGCGTTTCCCTAATGTTTATGGTATTGATATGCCTAATGCCAATGAATTAATTGCTCATGGGCGTGAAGTGGATGAAATACGTAAACTGATTGGTGCTGATGGACTTATTTTTCAAGATCTCTCTGATTTAATTGCCGCTGTTCAAGAAGAAAATCCAGATATCAACCAATTCGAATGCTCTGTATTTGATGGTGTCTATATCACAAAAGATATTGATCAAGGCTATTTAGATTACCTTGAAAATTTACGTCGTGATGATGAACATAAAATTCGTGATCAACATGAAGCTGAGAACTTAGAAATCTATAACGAAGGCTAATTTTCCGTTAAAATAGCCACCTTTATCAAGCGTCGATGCTAGCGTAACAC