Homologs in group_437

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00410 FBDBKF_00410 58.0 Morganella morganii S1 yfaE class I ribonucleotide reductase maintenance protein YfaE
EHELCC_01135 EHELCC_01135 58.0 Morganella morganii S2 yfaE class I ribonucleotide reductase maintenance protein YfaE
NLDBIP_02325 NLDBIP_02325 58.0 Morganella morganii S4 yfaE class I ribonucleotide reductase maintenance protein YfaE
LHKJJB_03840 LHKJJB_03840 58.0 Morganella morganii S3 yfaE class I ribonucleotide reductase maintenance protein YfaE
HKOGLL_03205 HKOGLL_03205 58.0 Morganella morganii S5 yfaE class I ribonucleotide reductase maintenance protein YfaE
F4V73_RS06390 F4V73_RS06390 58.0 Morganella psychrotolerans yfaE class I ribonucleotide reductase maintenance protein YfaE

Distribution of the homologs in the orthogroup group_437

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_437

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P45154 1.23e-26 96 61 1 76 4 HI_1309 Uncharacterized ferredoxin-like protein HI_1309 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0ABW3 4.52e-25 92 55 1 85 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli (strain K12)
P0ABW4 4.52e-25 92 55 1 85 4 yfaE Uncharacterized ferredoxin-like protein YfaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P57274 9.87e-15 66 47 2 70 4 BU177 Uncharacterized ferredoxin-like protein BU177 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AS6 1.46e-12 60 44 1 65 4 bbp_166 Uncharacterized ferredoxin-like protein bbp_166 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0A3D3 2.56e-11 57 33 4 95 1 petF1 Ferredoxin-1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P0A3D2 2.56e-11 57 33 4 95 3 petF Ferredoxin-1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P00244 1.15e-09 53 30 4 94 1 None Ferredoxin-1 Aphanizomenon flos-aquae
P00248 1.7e-08 50 32 4 95 1 petF Ferredoxin Mastigocladus laminosus
P00247 2.2e-08 50 31 4 95 1 None Ferredoxin Chlorogloeopsis fritschii
P75863 3.74e-08 52 40 2 72 1 ycbX Uncharacterized protein YcbX Escherichia coli (strain K12)
P00221 6.59e-08 50 33 3 93 1 PETF Ferredoxin-1, chloroplastic Spinacia oleracea
Q51577 1.78e-07 48 32 3 92 1 petF1 Ferredoxin-1 Leptolyngbya boryana
P00252 1.82e-07 48 31 5 95 1 None Ferredoxin-1 Desmonostoc muscorum
P75824 2.77e-07 49 34 1 76 1 hcr NADH oxidoreductase HCR Escherichia coli (strain K12)
P04669 3e-07 48 32 3 93 2 PETF Ferredoxin, chloroplastic Silene latifolia subsp. alba
Q66DP5 3.7e-07 49 32 3 92 1 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
P68641 3.7e-07 49 32 3 92 3 ascD CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase Yersinia pestis
Q03304 3.88e-07 49 29 3 79 1 tmoF Toluene-4-monooxygenase system, ferredoxin--NAD(+) reductase component Pseudomonas mendocina
P00231 4.95e-07 47 30 3 92 1 None Ferredoxin-2 Phytolacca americana
P15788 5.16e-07 47 30 4 91 1 PCC7418_2938 Ferredoxin Halothece sp. (strain PCC 7418)
P00254 6.39e-07 46 29 2 93 1 petF1 Ferredoxin-1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P00253 7.76e-07 46 30 2 93 1 None Ferredoxin Desmonostoc muscorum
P0A3C8 7.84e-07 46 30 2 93 1 petF Ferredoxin-1 Nostoc sp. (strain ATCC 29151 / PCC 7119)
P0A3C7 7.84e-07 46 30 2 93 1 petF Ferredoxin-1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P00245 8.27e-07 46 27 4 95 1 None Ferredoxin Limnospira maxima
P17007 8.27e-07 46 32 3 89 1 petF Ferredoxin-1 Cyanophora paradoxa
P00250 9.54e-07 46 32 3 93 1 None Ferredoxin-1 Aphanothece sacrum
P27320 1.05e-06 45 30 3 93 1 petF Ferredoxin-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O04683 1.11e-06 47 31 3 93 2 None Ferredoxin-1, chloroplastic Mesembryanthemum crystallinum
P00243 1.47e-06 45 30 3 93 1 None Ferredoxin Synechocystis sp. (strain PCC 6714)
P26395 1.66e-06 47 33 1 71 4 rfbI Protein RfbI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P00232 1.76e-06 45 29 3 92 1 None Ferredoxin-2 Phytolacca acinosa
P00227 2.07e-06 45 35 2 67 1 None Ferredoxin Brassica napus
P14938 2.21e-06 45 34 2 67 1 None Ferredoxin, leaf L-A Raphanus sativus
P00230 2.51e-06 45 29 3 92 1 None Ferredoxin-1 Phytolacca acinosa
P83522 2.79e-06 44 30 3 92 1 None Ferredoxin Hordeum vulgare
A7IPX7 3.37e-06 46 32 1 83 1 xamoF Alkene monooxygenase system, ferredoxin--NAD(+) reductase component Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
P00251 3.51e-06 44 27 4 94 1 None Ferredoxin-2 Aphanothece sacrum
P00246 3.52e-06 44 27 4 95 1 None Ferredoxin Arthrospira platensis
P09911 4.45e-06 45 32 2 91 1 PETF Ferredoxin-1, chloroplastic Pisum sativum
P00229 6.66e-06 43 29 3 92 1 None Ferredoxin-1 Phytolacca americana
P16972 8.75e-06 44 30 4 94 1 FD2 Ferredoxin-2, chloroplastic Arabidopsis thaliana
Q3C1D2 9.74e-06 45 28 3 91 1 tphA1II Terephthalate 1,2-dioxygenase, reductase component 2 Comamonas sp.
P00228 1.02e-05 44 31 3 92 1 PETF Ferredoxin, chloroplastic Triticum aestivum
Q9C7Y4 1.03e-05 44 30 2 94 2 FDC2 Ferredoxin C 2, chloroplastic Arabidopsis thaliana
P00255 1.12e-05 43 28 3 92 1 None Ferredoxin Thermostichus lividus
Q8IED5 1.18e-05 44 34 2 67 1 FD Ferredoxin, apicoplast Plasmodium falciparum (isolate 3D7)
P09735 1.28e-05 43 26 3 91 1 None Ferredoxin Marchantia polymorpha
P0A3D1 1.7e-05 42 29 4 93 3 petF1 Ferredoxin-1 Thermostichus vulcanus
P0A3C9 1.7e-05 42 29 4 93 1 petF1 Ferredoxin-1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P0A3D0 1.7e-05 42 29 4 93 3 petF1 Ferredoxin-1 Synechococcus elongatus
O78510 1.8e-05 42 26 2 90 3 petF Ferredoxin Guillardia theta
P0DPQ8 2.37e-05 44 29 1 71 1 gcoB Aromatic O-demethylase, reductase subunit Amycolatopsis sp. (strain ATCC 39116 / 75iv2)
Q9AHG2 2.74e-05 43 34 1 55 5 tsaB2 Putative toluene-4-sulfonate monooxygenase system reductase subunit TsaB2 Comamonas testosteroni
O52378 3.59e-05 43 31 1 76 1 nagAa Naphthalene 1,2-dioxygenase/salicylate 5-hydroxylase systems, ferredoxin--NAD(P)(+), reductase component Ralstonia sp.
P94680 4.06e-05 43 34 1 55 1 tsaB1 Toluene-4-sulfonate monooxygenase system reductase subunit TsaB1 Comamonas testosteroni
P00226 4.15e-05 42 33 3 92 1 None Ferredoxin Sambucus nigra
O04166 4.38e-05 42 32 4 89 2 PETF Ferredoxin, chloroplastic Physcomitrium patens
Q05182 4.86e-05 43 33 2 81 2 pht2 Phthalate 4,5-dioxygenase oxygenase reductase subunit Pseudomonas putida
Q3C1E0 5.6e-05 43 25 2 89 1 tphA1I Terephthalate 1,2-dioxygenase, reductase component 1 Comamonas sp.
P00224 5.83e-05 41 26 2 90 1 None Ferredoxin-2 Spinacia oleracea
Q9TLW0 6.59e-05 41 27 2 92 3 petF Ferredoxin Cyanidium caldarium
P81373 7.12e-05 41 31 3 92 1 None Ferredoxin-B Alocasia macrorrhizos
P85121 7.56e-05 41 32 2 76 1 None Ferredoxin Panax ginseng
P00233 8.99e-05 40 31 2 67 1 None Ferredoxin Gleichenia japonica
P07839 0.000102 41 26 2 89 1 PETF Ferredoxin, chloroplastic Chlamydomonas reinhardtii
Q9ZTS2 0.000107 41 30 3 93 1 AP1 Ferredoxin, chloroplastic Capsicum annuum
Q1XDG7 0.000114 40 26 4 94 3 petF Ferredoxin Neopyropia yezoensis
P51320 0.000153 40 26 4 94 3 petF Ferredoxin Porphyra purpurea
P00238 0.000172 40 26 2 89 1 None Ferredoxin Scenedesmus quadricauda
P08451 0.000177 40 27 3 94 3 petF2 Ferredoxin-2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q0J8M2 0.000183 40 31 2 67 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. japonica
A2YQD9 0.000183 40 31 2 67 1 ADI1 Ferredoxin-1, chloroplastic Oryza sativa subsp. indica
O98450 0.000185 40 26 4 94 3 petF Ferredoxin Thalassiosira weissflogii
B6V6V6 0.000211 41 31 3 82 1 kshB 3-ketosteroid-9-alpha-monooxygenase, ferredoxin reductase component Rhodococcus rhodochrous
P00225 0.000266 39 31 2 76 1 None Ferredoxin Leucaena leucocephala
P83584 0.000274 39 30 3 92 1 None Ferredoxin Solanum lasiocarpum
P00241 0.000288 39 26 4 93 1 PETF Ferredoxin Cyanidium caldarium
P56408 0.000298 39 27 2 87 1 None Ferredoxin Scenedesmus fuscus
Q45692 0.000314 41 31 1 76 1 dntAa 2,4-dinitrotoluene dioxygenase system ferredoxin--NAD(+), reductase component Burkholderia sp. (strain RASC)
P27787 0.000342 40 32 1 65 1 FDX1 Ferredoxin-1, chloroplastic Zea mays
P49522 0.000355 39 26 2 89 3 petF Ferredoxin Trieres chinensis
O04090 0.000368 40 28 2 67 1 FD1 Ferredoxin-1, chloroplastic Arabidopsis thaliana
P15789 0.000456 39 26 2 90 1 PETF Ferredoxin Cyanidium caldarium
P14937 0.000484 38 29 2 72 1 None Ferredoxin, root R-B2 Raphanus sativus
P10770 0.000493 38 26 3 89 1 None Ferredoxin Peridinium bipes
O80429 0.000501 39 29 2 67 1 FDX2 Ferredoxin-2, chloroplastic Zea mays
P76081 0.000503 40 27 4 95 1 paaE 1,2-phenylacetyl-CoA epoxidase, subunit E Escherichia coli (strain K12)
P07838 0.00068 38 29 3 91 1 None Ferredoxin Bryopsis maxima
Q7WTJ2 0.000687 40 30 5 91 1 mphP Phenol hydroxylase P5 protein Acinetobacter pittii (strain PHEA-2)
P07771 0.000706 40 28 4 97 1 benC Benzoate 1,2-dioxygenase electron transfer component Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P83526 0.001 38 30 3 92 1 None Ferredoxin Nicotiana tabacum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08520
Feature type CDS
Gene yfaE
Product class I ribonucleotide reductase maintenance protein YfaE
Location 1859023 - 1859301 (strand: 1)
Length 279 (nucleotides) / 92 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_437
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00111 2Fe-2S iron-sulfur cluster binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0633 Energy production and conversion (C) C Ferredoxin

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11107 ferredoxin - -

Protein Sequence

MASHKVTLHQQGLSTALEFSSETHPSLLETLERSKIQIEYQCREGYCGSCRLRLVKGKVCYRNEPLAFIQADEILPCSCHPVSDIEIEICTK

Flanking regions ( +/- flanking 50bp)

ATGATTTAAGTAACTTCGAACTGTAAAACAGAGAACTAGCGCTATACATTATGGCATCTCATAAAGTGACCCTGCACCAGCAGGGTCTATCAACCGCATTAGAATTTAGCTCTGAAACGCATCCTTCCTTGTTGGAGACGTTAGAGCGCAGCAAAATTCAAATCGAATATCAATGCCGAGAAGGTTATTGTGGCTCTTGCCGATTACGCTTAGTAAAAGGCAAAGTATGTTATCGCAATGAGCCATTGGCATTTATTCAAGCTGATGAAATTTTACCTTGTAGCTGTCACCCTGTGAGTGATATCGAAATCGAGATCTGCACAAAGTAAAACTATTGACTATAATGATCACTGTTTTCTTATATTGTTCTTTTTCTAAC