Homologs in group_2238

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17140 FBDBKF_17140 50.0 Morganella morganii S1 baeS Signal transduction histidine kinase
EHELCC_01750 EHELCC_01750 50.0 Morganella morganii S2 baeS Signal transduction histidine kinase
NLDBIP_01710 NLDBIP_01710 50.0 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_00325 LHKJJB_00325 50.0 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_00365 HKOGLL_00365 50.0 Morganella morganii S5 baeS Signal transduction histidine kinase
F4V73_RS05900 F4V73_RS05900 48.5 Morganella psychrotolerans - ATP-binding protein

Distribution of the homologs in the orthogroup group_2238

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2238

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8GP19 3.22e-166 479 52 3 463 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P40719 1.08e-44 165 27 7 429 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q8X524 2.14e-44 164 27 9 436 2 qseC Sensor protein QseC Escherichia coli O157:H7
P45336 2.49e-44 164 28 13 471 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZLZ9 4.43e-37 144 33 3 300 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 4.9e-37 144 33 3 300 3 qseC Sensor protein QseC Salmonella typhi
Q9HV31 4.2e-31 128 33 3 247 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P77485 1.44e-25 112 26 7 318 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q8XBY4 1.14e-24 109 26 7 318 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q8FK37 1.93e-24 108 26 7 318 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ZHD4 3.87e-23 105 26 12 337 3 silS Probable sensor kinase SilS Salmonella typhimurium
P30855 5.63e-21 100 27 6 254 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
A0R3I7 9.57e-21 98 28 8 266 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P30847 1.14e-20 97 26 8 259 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
P58402 1.16e-20 99 27 6 254 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P08400 1.61e-20 97 28 10 269 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P23545 1.03e-19 95 30 5 225 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P35164 1.31e-19 95 30 9 238 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P45609 2.96e-19 93 27 8 249 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q47457 4.76e-19 92 27 8 272 3 pcoS Probable sensor protein PcoS Escherichia coli
Q742C0 6.9e-19 92 26 8 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q70FG9 8.28e-19 91 26 6 290 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
P21865 1.51e-18 92 30 9 229 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
A0QBR0 1.75e-18 91 26 8 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q7V6P7 1.78e-18 90 28 11 283 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
Q9Z5G7 1.88e-18 91 26 10 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q2YY04 2.56e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 2.58e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 2.73e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.73e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.73e-18 90 27 9 301 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.73e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.73e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.73e-18 90 27 9 301 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.73e-18 90 27 9 301 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
P45608 2.93e-18 90 29 6 226 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
A0PWB3 3.74e-18 90 25 9 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
A0QR01 4.08e-18 89 27 6 237 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7A5H7 5.6e-18 90 29 7 227 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 5.6e-18 90 29 7 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P9WGK5 7.36e-18 89 29 5 232 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 7.36e-18 89 29 5 232 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 7.36e-18 89 29 5 232 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9L523 7.4e-18 89 29 7 227 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 7.47e-18 89 29 7 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 7.47e-18 89 29 7 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 7.47e-18 89 29 7 227 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 7.47e-18 89 29 7 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9SSY6 8.84e-18 89 28 8 262 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q6GGK7 9.1e-18 89 29 7 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q55932 9.17e-18 89 30 7 230 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2C884 1.28e-17 87 28 11 283 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q1B3X9 1.36e-17 89 25 9 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 1.36e-17 89 25 9 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
Q87GU5 1.68e-17 89 24 7 284 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A3Q5L8 1.7e-17 88 25 9 289 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
T2KMF4 2.41e-17 89 27 6 236 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P76339 2.94e-17 87 29 9 290 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P49333 3.28e-17 88 26 6 258 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P54302 5.06e-17 87 25 8 291 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
A1TEL6 5.19e-17 86 26 12 332 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O34989 7.69e-17 86 25 13 322 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
A1KHB8 9.4e-17 86 25 10 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 9.4e-17 86 25 10 290 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O82436 1.05e-16 86 28 10 263 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
P9WGL1 1.25e-16 85 25 9 290 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.25e-16 85 25 9 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.25e-16 85 25 9 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q8CTI3 1.38e-16 84 29 9 251 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.38e-16 84 29 9 251 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q03228 1.48e-16 85 29 9 246 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P30844 1.76e-16 84 25 6 283 1 basS Sensor protein BasS Escherichia coli (strain K12)
P23621 2.67e-16 84 27 4 219 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q49XM6 7.71e-16 83 26 11 322 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8KIY1 8.07e-16 84 26 8 320 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q2T0V9 8.52e-16 83 26 8 228 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9M7M1 9.13e-16 83 26 7 263 2 ETR1 Ethylene receptor Prunus persica
P36557 1.05e-15 81 26 6 279 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9I0I2 1.4e-15 82 24 8 277 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5A2P0 1.54e-15 82 27 10 235 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P54883 1.59e-15 82 28 5 231 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
P42245 1.99e-15 80 25 6 246 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q9RDT3 2.32e-15 81 25 5 226 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q4L6C5 2.7e-15 81 26 10 288 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
E0X9C7 2.74e-15 82 25 5 243 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q45614 2.92e-15 81 25 7 234 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q41342 3.23e-15 82 27 6 248 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9F8D7 3.32e-15 82 25 5 234 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
I1WSZ3 3.47e-15 81 25 8 282 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P58363 3.57e-15 81 24 4 230 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q8CU87 3.65e-15 81 25 5 226 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 3.65e-15 81 25 5 226 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q54SP4 3.89e-15 82 28 10 291 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 6.85e-10 65 22 6 291 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P0AEC4 3.9e-15 81 24 4 230 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 3.9e-15 81 24 4 230 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
Q6GKS6 3.97e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P0DMK6 3.97e-15 80 26 10 286 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
A6QD58 4.3e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 4.62e-15 81 25 5 226 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 4.62e-15 81 25 5 226 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 4.62e-15 81 25 5 226 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
O49230 4.69e-15 81 27 8 254 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q8Z7H3 4.79e-15 80 24 6 280 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
P0DM80 5.15e-15 80 24 6 280 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 5.15e-15 80 24 6 280 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 5.15e-15 80 24 6 280 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 5.15e-15 80 24 6 280 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 5.15e-15 80 24 6 280 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 5.15e-15 80 24 6 280 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
P0DMC5 6.91e-15 80 25 5 240 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P58662 8.24e-15 80 25 6 242 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0DMC6 8.54e-15 80 25 5 240 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P20169 9.59e-15 80 28 7 221 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8ZPP5 1.18e-14 80 24 5 240 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GIT7 1.41e-14 78 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.43e-14 78 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.43e-14 78 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.43e-14 78 26 9 267 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.43e-14 78 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.43e-14 78 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9XH58 1.64e-14 79 26 6 263 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q4LAJ8 1.67e-14 79 24 5 226 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q869S5 1.72e-14 80 25 4 241 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q7MD16 1.74e-14 79 25 7 274 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 1.77e-14 79 26 6 227 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
O81122 1.94e-14 79 26 8 258 2 ETR1 Ethylene receptor Malus domestica
Q56128 1.97e-14 79 24 6 242 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q0DKM0 2.21e-14 79 23 10 309 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
P94414 2.22e-14 78 25 13 338 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
B8AY75 2.29e-14 79 23 10 309 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
A5W4E3 3.19e-14 79 25 5 243 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P0A4I6 3.35e-14 77 28 7 234 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 3.35e-14 77 28 7 234 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5HPC4 3.54e-14 77 24 13 391 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4A159 3.57e-14 78 24 5 226 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q02541 3.82e-14 78 26 7 261 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q54YH4 4.06e-14 79 25 7 252 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q8CSL7 4.43e-14 77 25 13 381 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CRA8 4.55e-14 77 25 4 235 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q840P7 5.21e-14 76 26 9 267 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P48027 5.33e-14 78 24 5 242 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q5HHW5 5.6e-14 76 26 9 267 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 5.6e-14 76 26 9 267 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 5.6e-14 76 26 9 267 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
P44578 5.91e-14 76 25 3 214 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9P896 7.05e-14 77 24 7 240 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O34638 7.87e-14 77 24 12 305 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9KLK7 9.62e-14 77 28 12 314 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P40330 9.96e-14 77 27 8 252 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P26762 1.02e-13 77 27 8 252 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7U871 1.02e-13 76 25 10 278 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q2JWK9 1.13e-13 75 24 6 239 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q8FIB8 1.14e-13 76 23 7 280 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83RR1 1.16e-13 76 23 7 280 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8DPL8 1.25e-13 76 29 9 227 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 1.25e-13 76 29 9 227 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P23837 1.3e-13 76 23 7 280 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
P51392 1.32e-13 76 26 6 232 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
Q9SXL4 1.63e-13 77 25 11 290 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
P72292 2.07e-13 75 25 7 238 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q9XH57 2.14e-13 76 26 6 263 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q0IBF4 3.09e-13 74 25 11 277 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q49ZT9 3.45e-13 75 22 7 272 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8X739 3.6e-13 75 23 7 280 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q04943 4.04e-13 75 29 7 240 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5HLN1 4.46e-13 74 24 4 235 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P16575 5.14e-13 75 26 8 252 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q95PI2 9.46e-13 74 27 5 229 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
O48929 1.13e-12 73 26 7 252 2 ETR1 Ethylene receptor Nicotiana tabacum
Q3AYV8 1.15e-12 72 24 9 276 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q7V113 1.16e-12 72 28 10 237 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B7KFU0 1.17e-12 72 25 8 232 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
O69729 1.21e-12 73 25 16 370 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q52969 1.25e-12 73 26 6 231 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q2JKD9 1.33e-12 72 24 6 239 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
O14002 1.58e-12 73 26 8 245 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q53RH0 2.26e-12 72 25 8 262 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 2.26e-12 72 25 8 262 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P71380 2.93e-12 72 27 10 276 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P08982 2.95e-12 72 24 14 299 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 2.95e-12 72 24 14 299 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
A8G5E7 3.1e-12 71 26 9 266 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
P41406 3.11e-12 72 24 14 299 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
E5KK10 3.2e-12 72 26 7 238 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P08401 3.28e-12 72 24 6 255 1 creC Sensor protein CreC Escherichia coli (strain K12)
P37461 3.5e-12 71 24 6 239 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B7K3M6 3.7e-12 71 26 7 263 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q8Z332 3.75e-12 71 24 6 239 3 zraS Sensor histidine kinase ZraS Salmonella typhi
P0AEC5 4.22e-12 72 23 6 268 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 4.22e-12 72 23 6 268 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 4.22e-12 72 23 6 268 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
A3PDI2 4.62e-12 70 26 8 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P59342 4.86e-12 72 23 6 268 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P18392 9.04e-12 70 23 10 296 1 rstB Sensor protein RstB Escherichia coli (strain K12)
O49187 1.3e-11 70 25 9 264 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q04804 1.32e-11 70 25 8 248 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL2 1.42e-11 70 27 14 281 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WGL3 1.47e-11 70 27 14 281 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A2BRQ6 1.58e-11 69 26 8 241 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
P9WGK8 1.67e-11 70 27 6 243 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.67e-11 70 27 6 243 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q3S4A7 2.12e-11 70 24 9 275 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P74111 2.62e-11 69 27 9 251 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WGK9 2.86e-11 69 26 6 243 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9CCJ1 3.1e-11 68 28 7 227 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
Q31AE8 3.1e-11 68 25 10 268 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A0A4P7TSF2 3.47e-11 68 25 13 283 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 3.47e-11 68 25 13 283 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 3.47e-11 68 25 13 283 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
A0QTK3 3.52e-11 68 27 7 227 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4L8M0 3.59e-11 68 23 8 307 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q8FZ86 3.69e-11 69 23 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 3.89e-11 69 23 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q55630 4.22e-11 68 23 5 226 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q93CB7 4.51e-11 68 25 9 313 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q07737 5.18e-11 68 25 13 308 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
O34206 5.35e-11 68 24 8 224 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
A9M715 5.61e-11 68 23 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q7BWI3 6.15e-11 67 24 5 222 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q2FWH7 6.21e-11 68 24 5 207 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P39453 6.23e-11 68 22 7 257 1 torS Sensor protein TorS Escherichia coli (strain K12)
P37894 7.5e-11 68 26 6 247 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P58356 7.75e-11 68 23 8 256 3 torS Sensor protein TorS Escherichia coli O157:H7
A7HD43 8.85e-11 67 26 9 220 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q54U87 9.71e-11 68 23 6 252 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q44007 1.21e-10 67 24 9 326 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8X614 1.55e-10 66 22 8 296 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q8DMC5 1.56e-10 66 26 11 241 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B2J946 1.57e-10 66 26 7 223 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P39664 1.78e-10 66 27 6 183 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55168 2.14e-10 66 26 9 245 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q38846 2.41e-10 66 29 10 248 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
P73276 2.65e-10 65 25 8 239 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q57BR6 3.02e-10 66 22 5 251 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 3.02e-10 66 22 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 3.02e-10 66 22 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8YIM6 3.15e-10 66 22 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A6X5X4 3.37e-10 66 24 4 241 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5VRX4 3.53e-10 66 22 5 251 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q1XD95 3.93e-10 65 26 7 233 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q5AHA0 4.28e-10 66 26 10 247 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0C0F7 4.79e-10 65 24 7 242 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 5e-10 65 24 7 242 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9ZEP3 5.97e-10 65 28 9 220 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9ZWL6 6.11e-10 65 27 8 263 2 ETR1 Ethylene receptor Passiflora edulis
Q8E3C7 6.34e-10 64 26 8 226 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q8DKG0 6.51e-10 65 26 6 245 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P96368 7.15e-10 64 24 11 321 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q551X9 7.55e-10 65 24 6 227 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q54YZ9 8.83e-10 65 25 6 241 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P14377 9.48e-10 64 21 8 297 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
P0A4I8 9.6e-10 63 26 11 249 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 9.6e-10 63 26 11 249 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q82EB2 1.21e-09 63 27 10 216 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A1A697 1.28e-09 64 21 5 281 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
P0AE82 1.34e-09 63 23 9 277 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.34e-09 63 23 9 277 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.34e-09 63 23 9 277 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q8DXQ8 1.42e-09 63 27 8 220 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
B0JK50 1.5e-09 63 22 4 226 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q5A599 1.68e-09 63 24 6 210 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P16497 1.69e-09 63 25 7 237 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
A8Z553 1.82e-09 63 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 1.82e-09 63 26 7 253 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 1.82e-09 63 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 1.82e-09 63 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 1.82e-09 63 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
A2WYI4 1.85e-09 63 21 4 281 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 1.9e-09 63 21 4 281 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q7A3X0 2.4e-09 62 25 10 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 2.4e-09 62 25 10 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 2.4e-09 62 25 10 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 2.4e-09 62 25 10 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 2.4e-09 62 25 10 292 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YZ23 2.42e-09 62 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KHI5 2.97e-09 63 24 5 225 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P9WGK7 3.3e-09 62 25 9 295 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 3.3e-09 62 25 9 295 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 3.3e-09 62 25 9 295 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KM66 3.59e-09 62 25 10 235 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O32193 3.64e-09 62 23 15 306 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q8DMT2 3.94e-09 62 26 8 226 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q6GE72 4.11e-09 62 26 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
Q9HUI3 4.91e-09 62 24 10 250 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9C5U2 6.01e-09 62 25 1 162 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q9APE0 6.45e-09 61 21 6 253 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q47745 6.7e-09 61 24 13 329 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q9RQQ9 1.01e-08 61 22 6 248 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8NV46 1.08e-08 60 25 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 1.08e-08 60 25 7 253 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
O31661 1.13e-08 61 27 8 248 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q08408 1.26e-08 60 24 6 229 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
Q9C5U0 1.27e-08 61 23 1 148 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
B1WYT4 1.29e-08 60 23 9 239 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q54RP6 1.46e-08 61 24 6 224 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
A1A698 1.59e-08 60 24 1 156 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
P94608 2.01e-08 60 25 9 240 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9HZ47 2.04e-08 60 25 11 244 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YR50 2.08e-08 59 30 2 113 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q86CZ2 2.32e-08 60 25 8 252 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
O33071 2.36e-08 59 24 7 268 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
Q3M8A7 2.38e-08 59 30 2 113 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q08430 2.9e-08 59 25 5 220 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q06904 3.39e-08 58 23 6 249 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A0A0H3GPN8 3.41e-08 59 21 9 275 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
Q06240 3.54e-08 58 25 7 196 1 vanS Sensor protein VanS Enterococcus faecium
Q9C5U1 3.72e-08 59 21 7 271 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q44930 5.8e-08 58 26 7 193 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
P33113 1.61e-07 57 25 4 194 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
Q9LCC2 2.14e-07 57 25 8 241 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8DN03 2.32e-07 56 22 14 319 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 2.32e-07 56 22 14 319 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4L482 3.32e-07 55 21 6 223 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P52101 3.37e-07 56 22 9 252 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
Q8THF6 4.31e-07 56 32 5 124 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6GJ10 5.27e-07 55 23 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
A1A699 6.1e-07 55 21 1 156 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q8XA47 9.83e-07 54 22 9 252 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q03069 1.34e-06 53 20 6 219 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
P19906 1.37e-06 53 26 8 234 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
P39764 1.38e-06 54 25 8 250 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q06067 1.72e-06 54 23 7 232 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q7A6Z3 1.99e-06 53 21 8 232 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 1.99e-06 53 21 8 232 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 1.99e-06 53 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 1.99e-06 53 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 1.99e-06 53 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9R6X3 2.21e-06 53 24 7 243 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9P7Q7 2.49e-06 53 23 9 248 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A3BE68 3.41e-06 53 24 2 138 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
P42707 3.47e-06 52 23 13 383 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
O22267 3.53e-06 53 22 10 286 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
A2YFR6 3.62e-06 53 24 2 138 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
A8Z182 3.85e-06 52 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 3.85e-06 52 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 3.85e-06 52 21 8 232 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 3.85e-06 52 21 8 232 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 3.85e-06 52 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q2YSS1 3.92e-06 52 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXR5 4.2e-06 52 21 8 232 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 4.2e-06 52 21 8 232 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
A7N6S2 4.66e-06 52 25 6 199 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
P42422 4.85e-06 52 21 7 234 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
O07777 7.45e-06 49 36 3 93 1 Rv0601c Sensor histidine kinase component HK2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q52977 1e-05 51 25 8 200 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
O25917 1.7e-05 50 24 11 236 3 crdS Sensor histidine kinase CrdS Helicobacter pylori (strain ATCC 700392 / 26695)
Q86AT9 2.31e-05 50 28 5 141 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
A7MRY4 2.34e-05 50 29 9 205 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
P0C5S6 2.55e-05 50 29 9 205 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
Q9HU20 3.17e-05 50 24 7 222 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10047 3.51e-05 50 25 10 224 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P41503 6.4e-05 48 22 7 198 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
P96601 6.51e-05 48 28 4 114 3 dctS Probable C4-dicarboxylate sensor kinase Bacillus subtilis (strain 168)
P30663 6.58e-05 48 21 9 242 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
Q9K997 6.84e-05 48 32 4 110 3 dctS Probable C4-dicarboxylate sensor kinase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q49VK4 7.91e-05 48 22 8 218 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O06979 8.09e-05 48 22 8 249 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
O35044 9.98e-05 48 22 7 243 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
Q54Q69 0.000105 48 24 6 175 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
P33529 0.000168 48 23 6 206 2 PHY Phytochrome Mougeotia scalaris
P0DOA0 0.000181 47 22 9 233 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O34427 0.000222 47 32 3 105 1 citS Sensor protein CitS Bacillus subtilis (strain 168)
O74539 0.000472 46 21 8 258 1 mak3 Peroxide stress-activated histidine kinase mak3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0A2D9 0.000508 45 24 9 219 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 0.000508 45 24 9 219 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
O31671 0.000568 46 22 5 216 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q9RC53 0.000732 45 27 4 113 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8PUB8 0.000768 45 28 4 113 1 top6B Type 2 DNA topoisomerase 6 subunit B Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P0AFB7 0.001 45 25 11 220 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 0.001 45 25 11 220 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 0.001 45 25 11 220 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08305
Feature type CDS
Gene -
Product ATP-binding protein
Location 1814082 - 1815485 (strand: 1)
Length 1404 (nucleotides) / 467 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2238
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Protein Sequence

MKIRSFFIYTIFLQTISIVMLWGVWLAWIEFDYLADFETIYNKQQEIIAEGFANTLETVSSQPETVKQIAHHLQNMYIDTMLNGEDDDLHYLPWFIVLNKDNDLIYTNRPELSLPKRVLSLASEKISVAGEKWYLSYSWGKQHKIKVFIGESVEDRGHVIGNPISGTFVPFLFILATVILAILITAYFSLRPLRQAAELISNRKPRNLTPINVGQQFKEIRPIFKELNQLMARIDAANIREKQFMADAAHELRTPIAAVIAQLHILSLVDEKQEREEIIEDMKQSLDRAAALSHQLIDLARLECDDFPIKIEPFDVYNIIGNAIAQRVPYALTKNIELSLNEGMSLKIETDKQALLSIFNNLLDNAIKYCPNNSQVEVTIEHKDTHHLNIILRDNGPGIAPEYISSLFSRFYRVPGSQGTGSGLGLSIAQNLAEKIQATISITEGLHNKGIGFIITLPLKIKPLDNE

Flanking regions ( +/- flanking 50bp)

TTATTACGGTTCGCGGTATCGGTTATCTCTTAAAAAAAGAAGTGAACTAAATGAAGATCCGCTCTTTCTTTATTTATACTATCTTTCTACAAACGATATCTATCGTGATGCTATGGGGCGTTTGGTTAGCTTGGATAGAATTTGATTATCTTGCTGACTTTGAAACTATCTACAATAAGCAACAAGAAATTATTGCTGAAGGATTTGCCAATACACTCGAAACGGTTTCCTCTCAACCCGAGACAGTAAAACAGATAGCTCACCATTTACAAAACATGTATATCGATACCATGCTTAATGGTGAAGATGATGATTTACACTATTTACCTTGGTTTATTGTCTTAAATAAAGATAATGATCTGATTTATACCAATAGACCGGAACTTTCTCTGCCTAAACGGGTACTATCGCTTGCCTCTGAAAAAATCTCTGTGGCTGGGGAGAAATGGTATTTATCTTATAGTTGGGGAAAACAACATAAAATTAAAGTTTTTATTGGTGAATCCGTCGAAGATAGAGGACATGTCATTGGTAACCCTATTTCCGGTACTTTTGTGCCCTTCCTATTTATTTTAGCGACAGTGATCTTGGCTATCTTAATTACTGCTTATTTTAGTTTGCGCCCTTTAAGACAAGCCGCAGAGCTGATTTCTAATCGAAAACCTCGTAATTTAACGCCAATTAATGTCGGACAACAATTTAAAGAGATCCGCCCTATCTTTAAAGAGCTTAACCAATTAATGGCAAGAATAGATGCGGCTAATATTAGAGAAAAACAATTTATGGCTGATGCGGCTCATGAGCTAAGAACCCCGATTGCCGCAGTGATTGCCCAATTACACATTCTCTCTTTAGTCGATGAAAAGCAGGAGCGAGAAGAAATTATTGAAGATATGAAACAATCTCTGGATAGAGCCGCCGCACTTTCCCACCAGCTTATTGATTTAGCAAGATTAGAGTGTGACGATTTCCCTATAAAAATAGAACCCTTTGATGTTTATAATATTATTGGTAATGCTATTGCTCAGCGCGTGCCTTATGCCTTAACAAAAAATATTGAGCTATCTTTAAATGAAGGTATGTCACTTAAAATAGAAACAGATAAACAAGCACTGCTGTCTATTTTTAATAACTTATTGGATAATGCAATCAAATATTGCCCCAATAATAGTCAAGTCGAAGTGACTATTGAACATAAAGATACCCATCATCTCAATATTATTCTGCGTGATAATGGACCAGGAATTGCACCTGAGTATATTAGCTCACTATTTTCCCGTTTTTATCGTGTTCCGGGATCACAAGGGACGGGCAGTGGTTTAGGCTTATCTATTGCACAAAATCTCGCTGAAAAAATTCAAGCAACCATTTCCATTACTGAAGGGCTACACAATAAAGGTATTGGTTTTATTATTACCTTACCGTTAAAAATTAAACCACTAGATAACGAGTAAATATATTGTAGGAGGCCTTTGCCTCCTATAATTTTAGTTAAAACTATTAG