Homologs in group_2238

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17140 FBDBKF_17140 81.9 Morganella morganii S1 baeS Signal transduction histidine kinase
EHELCC_01750 EHELCC_01750 81.9 Morganella morganii S2 baeS Signal transduction histidine kinase
NLDBIP_01710 NLDBIP_01710 81.9 Morganella morganii S4 baeS Signal transduction histidine kinase
LHKJJB_00325 LHKJJB_00325 81.9 Morganella morganii S3 baeS Signal transduction histidine kinase
HKOGLL_00365 HKOGLL_00365 81.9 Morganella morganii S5 baeS Signal transduction histidine kinase
PMI_RS08305 PMI_RS08305 48.5 Proteus mirabilis HI4320 - ATP-binding protein

Distribution of the homologs in the orthogroup group_2238

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2238

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8GP19 3.85e-143 421 48 4 434 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P40719 5.24e-37 144 30 15 439 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q8X524 6.53e-37 144 30 15 439 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q8ZLZ9 3.16e-33 133 29 12 420 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z3P2 7.71e-33 132 28 12 420 3 qseC Sensor protein QseC Salmonella typhi
P45336 2.49e-32 131 27 13 422 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8XBY4 1.27e-21 100 29 6 248 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q9HV31 4.03e-21 99 28 3 242 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q869S5 1.1e-20 99 29 8 254 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
P77485 2.01e-20 97 28 6 246 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q47457 2.24e-20 97 27 12 355 3 pcoS Probable sensor protein PcoS Escherichia coli
P30855 4.69e-20 97 28 6 248 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q8FK37 9.14e-20 95 28 6 246 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DMC5 1.5e-19 95 27 5 241 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
P0DMC6 1.52e-19 95 27 5 241 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMK6 6.31e-19 92 28 8 263 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
I1WSZ3 9.53e-19 92 28 8 263 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
P51392 1.03e-18 92 27 6 241 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
T2KMF4 1.07e-18 93 29 5 212 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
A0QR01 1.09e-18 90 30 4 204 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q56128 1.32e-18 92 27 5 241 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 2.08e-18 92 27 5 241 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P58402 2.13e-18 92 28 6 248 3 evgS Sensor protein EvgS Escherichia coli O157:H7
P23545 3.44e-18 90 31 7 222 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
P42245 4.52e-18 88 28 5 209 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q54SP4 4.92e-18 90 25 15 377 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 4.72e-06 53 22 8 268 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q8ZPP5 6.03e-18 90 29 4 220 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGK5 1.04e-17 88 30 3 205 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.04e-17 88 30 3 205 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.04e-17 88 30 3 205 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4L6C5 1.17e-17 88 24 5 274 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q70FG9 1.72e-17 87 29 8 278 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q742C0 1.92e-17 88 26 9 310 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P36557 2.27e-17 86 27 7 304 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P54883 2.35e-17 87 31 3 205 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q7A0W5 3.49e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 3.49e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 3.49e-17 87 24 13 306 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 3.49e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 3.49e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 3.49e-17 87 24 13 306 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 3.49e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 3.59e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GGZ4 4e-17 87 24 13 306 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
O69729 4.94e-17 86 33 7 207 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q02541 5.32e-17 86 26 6 263 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
A0R3I7 6.26e-17 86 29 7 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P30847 7.17e-17 86 29 8 251 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q1B3X9 7.46e-17 86 27 8 287 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 7.46e-17 86 27 8 287 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
P35164 7.48e-17 86 28 11 263 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
A3Q5L8 8.69e-17 86 27 8 287 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
A0QBR0 1.29e-16 85 26 9 310 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
A1TEL6 1.37e-16 85 28 9 290 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
P40330 1.64e-16 86 29 6 231 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P26762 2.06e-16 85 29 6 231 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P49333 2.07e-16 85 29 5 225 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
Q9F8D7 2.56e-16 85 29 5 212 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P9WGK7 3.78e-16 84 26 6 280 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 3.78e-16 84 26 6 280 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 3.78e-16 84 26 6 280 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P16575 3.87e-16 85 29 6 231 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q55932 3.93e-16 84 31 5 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DPL8 4.48e-16 83 29 7 208 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 4.48e-16 83 29 7 208 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P76339 8.24e-16 82 25 9 305 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q6GGK7 8.49e-16 83 27 8 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
P48027 1.1e-15 83 28 4 216 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
Q44007 1.29e-15 82 29 7 246 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9L523 1.49e-15 82 27 8 227 1 srrB Sensor protein SrrB Staphylococcus aureus
Q8NWF3 1.53e-15 82 27 8 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 1.53e-15 82 27 8 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 1.53e-15 82 27 8 227 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 1.53e-15 82 27 8 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9Z5G7 1.6e-15 82 25 15 396 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q8KIY1 1.67e-15 82 25 6 303 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
A1KHB8 1.88e-15 82 26 7 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 1.88e-15 82 26 7 271 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O49230 2.21e-15 82 28 5 231 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9ZHD4 2.24e-15 81 27 6 255 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q7A5H7 2.27e-15 82 27 8 227 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 2.27e-15 82 27 8 227 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0AEC5 2.35e-15 82 30 7 229 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 2.35e-15 82 30 7 229 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 2.35e-15 82 30 7 229 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P30844 2.72e-15 80 28 9 291 1 basS Sensor protein BasS Escherichia coli (strain K12)
P59342 2.84e-15 82 30 7 229 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
Q4L8M0 3.68e-15 80 25 8 280 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q45614 5.01e-15 80 26 6 206 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
Q9SSY6 5.12e-15 81 25 8 288 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q1XD95 5.49e-15 80 25 8 244 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
A0PWB3 6.31e-15 80 27 7 269 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P9WGL1 6.71e-15 80 26 7 271 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 6.71e-15 80 26 7 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 6.71e-15 80 26 7 271 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
O82436 7.76e-15 80 26 8 296 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q6GIT7 1.73e-14 78 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.76e-14 78 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.76e-14 78 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.76e-14 78 27 9 250 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.76e-14 78 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.76e-14 78 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q840P7 2.84e-14 77 27 9 250 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q5HHW5 2.84e-14 77 27 9 250 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 2.84e-14 77 27 9 250 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 2.84e-14 77 27 9 250 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
O34206 3.61e-14 78 28 6 206 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q9SXL4 3.97e-14 78 26 8 273 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9KLK7 7.35e-14 77 29 5 217 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9XH58 1.18e-13 77 25 6 242 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q5AHA0 1.2e-13 77 27 7 229 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P20169 1.45e-13 76 25 7 231 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P08400 1.47e-13 75 28 8 226 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P0AEC4 1.93e-13 76 26 5 223 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 1.93e-13 76 26 5 223 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 1.96e-13 76 26 5 223 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P45609 2.01e-13 75 27 10 255 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
Q8CTI3 2.31e-13 74 28 10 260 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.31e-13 74 28 10 260 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O81122 2.84e-13 75 27 6 229 2 ETR1 Ethylene receptor Malus domestica
O48929 2.91e-13 75 24 6 275 2 ETR1 Ethylene receptor Nicotiana tabacum
Q95PI2 3.12e-13 75 28 4 211 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q8DMC5 3.96e-13 74 26 12 304 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P18392 4.19e-13 74 29 7 222 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P0C0F7 4.21e-13 75 25 5 234 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P0C0F6 4.43e-13 75 25 5 234 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O34638 6.53e-13 73 26 10 277 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9HUI3 7.21e-13 74 28 11 237 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q53RH0 8.59e-13 73 28 10 271 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 8.59e-13 73 28 10 271 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
Q41342 9.42e-13 73 26 8 276 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P96368 1.02e-12 73 29 12 285 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O33071 1.02e-12 73 25 7 286 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
E0X9C7 1.03e-12 74 26 5 226 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
O34989 1.07e-12 73 26 16 325 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
Q8CSL7 1.44e-12 72 22 6 282 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9XH57 1.45e-12 73 28 5 224 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q54YH4 1.56e-12 73 23 6 240 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q5HPC4 1.71e-12 72 22 6 281 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q38846 2.27e-12 72 25 6 260 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
O14002 2.41e-12 73 26 8 242 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9C5U1 2.45e-12 73 24 8 270 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
P45608 2.52e-12 72 27 6 213 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
Q7V6P7 2.58e-12 71 30 9 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
A5W4E3 2.72e-12 72 27 5 209 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q551X9 3.02e-12 72 31 8 211 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q9M7M1 3.08e-12 72 26 5 224 2 ETR1 Ethylene receptor Prunus persica
A2C884 3.58e-12 71 30 9 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
O49187 4.04e-12 72 26 6 234 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q49XM6 4.18e-12 71 22 9 307 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P71380 4.57e-12 71 27 8 229 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P74111 4.78e-12 72 27 10 243 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P39664 4.85e-12 71 28 6 188 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B8AY75 5.47e-12 71 25 6 232 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q9RQQ9 6.88e-12 71 26 6 206 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q0DKM0 7e-12 71 25 6 232 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q7U871 7.85e-12 70 28 8 228 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q54YZ9 1.17e-11 71 24 6 274 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P37894 1.21e-11 70 25 5 211 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q0IBF4 1.5e-11 69 29 9 227 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q49ZT9 1.5e-11 69 24 11 281 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P54302 1.71e-11 70 26 8 223 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q8D5Z6 2.04e-11 70 27 6 224 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q7MD16 2.09e-11 70 27 6 224 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q9I0I2 2.11e-11 69 24 7 261 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KHI5 2.31e-11 69 27 7 230 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q87GU5 2.43e-11 69 27 9 228 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZWL6 4.77e-11 68 25 7 262 2 ETR1 Ethylene receptor Passiflora edulis
P0DM80 6.53e-11 67 23 10 286 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 6.53e-11 67 23 10 286 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 6.53e-11 67 23 10 286 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 6.53e-11 67 23 10 286 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 6.53e-11 67 23 10 286 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 6.53e-11 67 23 10 286 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q8Z7H3 6.71e-11 67 23 10 286 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
Q06240 7.02e-11 67 27 8 234 1 vanS Sensor protein VanS Enterococcus faecium
O22267 8.25e-11 68 22 7 288 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
A8Z553 9.64e-11 67 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 9.64e-11 67 23 6 260 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 9.64e-11 67 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 9.64e-11 67 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 9.64e-11 67 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q3AYV8 1.29e-10 66 27 8 229 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
P73276 1.3e-10 66 27 8 240 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7A3X0 1.37e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 1.37e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 1.37e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 1.37e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 1.37e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GE72 1.5e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
A2WYI4 1.63e-10 67 22 6 283 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 1.68e-10 67 22 6 283 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q47745 2.03e-10 66 22 11 395 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q8NV46 2.07e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 2.07e-10 66 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q54RP6 3.37e-10 66 25 5 203 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
P21865 4.78e-10 65 25 10 272 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
A2BRQ6 5.37e-10 64 26 9 243 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A3PDI2 5.82e-10 64 26 9 243 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
P08401 6.16e-10 64 22 6 244 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q9HZ47 6.48e-10 64 28 8 227 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04804 6.64e-10 64 25 8 260 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I6 7.42e-10 64 24 8 226 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 7.42e-10 64 24 8 226 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2T0V9 8.26e-10 64 24 12 283 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P9WGK8 8.65e-10 64 28 6 209 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 8.65e-10 64 28 6 209 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P44578 8.98e-10 63 24 6 220 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WGK9 9.45e-10 64 28 6 209 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZEP3 1.07e-09 64 30 12 254 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P08982 1.15e-09 63 28 9 285 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.15e-09 63 28 9 285 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P41406 1.25e-09 63 28 9 285 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
A0QTK3 1.32e-09 63 27 7 210 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2YZ23 1.47e-09 63 23 6 260 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9APE0 1.49e-09 63 23 6 219 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
P52101 1.53e-09 63 27 9 243 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
A8G5E7 1.55e-09 63 26 9 243 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q9RDT3 2e-09 63 26 6 200 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q93CB7 2.13e-09 63 28 7 212 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q4LAJ8 2.14e-09 63 25 6 200 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
A6QD58 2.18e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q7A215 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 2.2e-09 63 26 6 200 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 2.2e-09 63 26 6 200 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 2.2e-09 63 26 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GJ10 2.22e-09 62 27 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q7BWI3 2.32e-09 62 26 7 216 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q03228 2.46e-09 63 26 7 219 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q31AE8 2.53e-09 62 26 12 266 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q9CCJ1 2.84e-09 62 28 6 209 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
B0CI82 3.99e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8CU87 4.25e-09 62 26 6 200 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 4.25e-09 62 26 6 200 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8FZ86 4.31e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
A6X5X4 4.38e-09 62 23 10 296 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P0A4I8 4.55e-09 62 25 12 299 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 4.55e-09 62 25 12 299 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P39453 4.65e-09 62 26 8 209 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8YIM6 4.66e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BR6 4.79e-09 62 23 10 295 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 4.79e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 4.79e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
Q8X739 4.93e-09 62 24 13 284 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q7A6Z3 5.02e-09 61 26 5 209 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 5.02e-09 61 26 5 209 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 5.02e-09 61 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 5.02e-09 61 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 5.02e-09 61 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8XA47 5.14e-09 62 26 9 243 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
A5A2P0 5.42e-09 61 25 9 233 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
A5VRX4 5.5e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q2JWK9 6.43e-09 61 23 6 238 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q8FIB8 6.71e-09 61 24 13 284 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 6.89e-09 61 24 13 285 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
A1A699 7.07e-09 62 25 2 164 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q83RR1 7.08e-09 61 24 13 285 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
A9M715 7.2e-09 62 23 10 295 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q6GKS6 7.56e-09 61 25 6 200 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
P9WGL3 8.89e-09 61 25 9 258 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P23621 8.97e-09 61 26 6 224 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9P896 9.26e-09 61 24 6 239 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2YSS1 9.26e-09 60 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P9WGL2 9.28e-09 61 25 9 258 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q07737 9.46e-09 61 24 12 308 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
A8Z182 9.51e-09 60 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 9.51e-09 60 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 9.51e-09 60 26 5 209 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 9.51e-09 60 26 5 209 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 9.51e-09 60 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q8NXR5 9.95e-09 60 26 5 209 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 9.95e-09 60 26 5 209 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
A1A698 1e-08 61 23 1 162 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q04943 1.03e-08 61 29 9 217 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A4P7TSF2 1.07e-08 60 27 9 284 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.07e-08 60 27 9 284 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.07e-08 60 27 9 284 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q52969 1.07e-08 60 23 7 267 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
P94608 1.6e-08 60 25 6 204 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q08430 1.88e-08 60 25 4 207 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q82EB2 1.93e-08 60 28 10 221 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q06067 2.2e-08 60 23 7 204 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q3S4A7 2.35e-08 60 24 7 237 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
Q8DXQ8 2.43e-08 59 25 8 222 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9K620 2.59e-08 58 25 13 287 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O31661 2.76e-08 60 27 7 221 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
A7MRY4 2.89e-08 60 29 8 201 1 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio campbellii (strain ATCC BAA-1116)
B1WYT4 2.98e-08 59 24 7 214 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
P0C5S6 3.02e-08 60 29 8 201 3 luxN Autoinducer 1 sensor kinase/phosphatase LuxN Vibrio harveyi
B7K3M6 3.02e-08 59 31 3 122 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q4A159 3.1e-08 59 24 6 200 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5A599 3.22e-08 60 21 6 278 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P0AE82 3.45e-08 59 25 8 227 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 3.45e-08 59 25 8 227 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 3.45e-08 59 25 8 227 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q8E3C7 3.82e-08 58 25 8 222 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P58356 4.15e-08 59 26 8 209 3 torS Sensor protein TorS Escherichia coli O157:H7
P23222 4.43e-08 58 30 11 212 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8DKG0 4.67e-08 59 24 7 245 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q08408 4.8e-08 58 25 4 192 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
B2J946 5.35e-08 58 25 9 236 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
E5KK10 5.72e-08 58 23 6 229 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q54U87 5.74e-08 59 23 8 241 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
B7KFU0 6.18e-08 58 24 7 240 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q03069 6.49e-08 58 23 4 199 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q7V113 7.13e-08 57 26 9 236 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q55E44 8.95e-08 58 25 2 151 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum
Q4L482 9.28e-08 57 25 5 217 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
P37461 1.04e-07 57 23 7 230 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A1A697 1.12e-07 58 26 4 154 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q8CRA8 1.12e-07 57 22 7 262 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8Z332 1.16e-07 57 23 7 238 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q44930 1.62e-07 57 23 8 240 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q49VK4 2.13e-07 56 26 6 196 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P10955 2.94e-07 56 24 7 207 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P10578 3.01e-07 55 24 8 211 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q04850 3.91e-07 56 25 7 236 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q9C5U2 4.04e-07 56 26 3 162 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
P18540 6.04e-07 55 26 10 231 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P72292 6.89e-07 55 26 9 217 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q2JKD9 7.57e-07 54 22 6 238 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
Q5HLN1 8.31e-07 55 21 7 262 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9HU20 9.07e-07 55 27 9 236 3 dctB C4-dicarboxylate transport sensor protein DctB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P16497 9.51e-07 55 26 7 215 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
O31671 1.05e-06 54 25 5 204 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
Q9P7Q7 1.11e-06 55 21 8 251 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8X614 1.49e-06 53 24 10 243 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
O06979 1.53e-06 53 22 12 319 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
Q55630 1.57e-06 53 23 11 251 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P14377 2.03e-06 53 24 10 240 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q9C5U0 2.12e-06 54 23 4 182 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
P94414 2.36e-06 53 20 10 349 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
Q54Q69 2.56e-06 53 27 5 154 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
O34971 2.75e-06 53 26 7 213 3 kdpD Sensor protein KdpD Rathayibacter rathayi
Q06904 3.83e-06 52 25 8 248 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P33113 1.03e-05 51 25 8 229 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P0A2D9 1.36e-05 50 27 9 208 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 1.36e-05 50 27 9 208 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q8CTL4 1.56e-05 50 25 7 215 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 1.56e-05 50 25 7 215 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9R6X3 1.89e-05 50 23 9 239 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A0A0H3GPN8 2.14e-05 50 22 7 224 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P45670 2.49e-05 50 23 8 209 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
Q9KM24 8.64e-05 48 26 8 200 1 vxrA Sensor histidine kinase VxrA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10799 0.000156 48 27 7 214 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
P07168 0.00017 47 27 7 214 3 virA Wide host range VirA protein Rhizobium radiobacter
P06218 0.000172 47 26 9 208 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q2FWH7 0.00024 47 19 6 240 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8THF6 0.000243 47 26 3 111 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O32193 0.00027 47 21 12 275 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q8YR50 0.000285 46 28 2 94 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 0.000374 46 28 2 94 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P0DOA0 0.000376 47 27 7 188 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
P10047 0.0004 46 29 4 118 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
P45675 0.000422 46 27 8 223 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P42422 0.000587 45 21 12 283 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
B0JK50 0.000625 45 22 7 233 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P19906 0.000756 45 28 10 207 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q5SML4 0.000758 45 19 2 151 2 HK2 Probable histidine kinase 2 Oryza sativa subsp. japonica
A2YA15 0.000758 45 19 2 151 3 HK2 Probable histidine kinase 2 Oryza sativa subsp. indica
A2YFR6 0.001 45 27 4 140 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05900
Feature type CDS
Gene -
Product ATP-binding protein
Location 1257433 - 1258818 (strand: 1)
Length 1386 (nucleotides) / 461 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2238
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0642 Signal transduction mechanisms (T) T Signal transduction histidine kinase

Protein Sequence

MLLLWGVWIAWLKYAYLPDVSEDFNTQQLVIARGISDTLKDTPTDAANFRQIASALESMYTNAMRSGLEDESYDPLIAILGSNGDILYSNKPDINIPLKPNGIVRFSEEGETWYLAYDTDTATTRTAVVGESATDRHMLIGDPASGTAIPLLFILGTMLASTIITTYLSMRPLRETTQSLAARNPGNLTPISMKHQYNELRPVLRAINQLMQRVDAGNLREKQFMADAAHELRTPIAAVLAQIHLLKQIDDPVERNEITADMEISLDRAVSLSRQLIDLARLETEDYPLKMEEIDLSRELSHTIAMMVPYALRKNIELAFDGPQVCLVITDKQALFSIINNILNNAVKYCPPGSLVETTLETGHADDIRIIIRDNGDGISEQYRPRLFSRFFRVPGSCETGSGLGLAIAQNLAGKIGGYLSVTDGLQQRGIGFVIHISAHGLSALAESNSTSAVHHDNSDT

Flanking regions ( +/- flanking 50bp)

TGAAAGTCCGCTCAATCTTTGTTTATACTGTTTTTCTCCAGACAGTTTGCATGCTTTTACTGTGGGGCGTCTGGATTGCCTGGCTGAAATACGCTTATCTGCCTGACGTTAGTGAAGATTTTAATACCCAGCAGTTAGTTATTGCCCGCGGTATTTCTGATACGCTCAAAGATACCCCTACAGATGCTGCCAATTTCCGGCAAATTGCCTCCGCCCTTGAAAGCATGTACACCAACGCGATGCGCAGTGGTCTGGAAGACGAAAGCTATGATCCGCTGATTGCCATACTCGGCAGTAACGGCGACATTCTTTACAGCAATAAACCTGATATTAATATTCCGTTGAAACCAAACGGAATAGTTCGTTTTAGTGAAGAAGGTGAAACCTGGTATCTGGCTTATGATACCGATACTGCCACAACCCGGACAGCCGTTGTGGGAGAATCTGCAACAGACCGCCACATGCTGATTGGCGATCCGGCTTCCGGCACCGCGATCCCTTTACTGTTTATCCTCGGTACCATGCTGGCATCGACTATTATTACCACCTATCTCAGTATGCGTCCGTTGCGGGAAACCACACAAAGCCTTGCCGCCCGCAATCCCGGTAATCTGACGCCTATCAGCATGAAGCATCAGTATAATGAGCTGCGTCCGGTTCTCCGGGCAATTAACCAGTTAATGCAGCGGGTTGATGCCGGTAATTTACGGGAAAAACAATTTATGGCAGATGCCGCTCATGAATTACGCACCCCGATTGCGGCCGTTCTGGCGCAAATTCACCTGTTAAAACAGATTGATGACCCGGTCGAGCGCAATGAAATCACCGCTGATATGGAAATCAGCCTTGATCGTGCGGTTTCCCTTTCCCGCCAGTTGATTGATCTGGCACGGCTGGAAACAGAAGATTACCCGCTGAAAATGGAAGAGATTGACCTGAGCCGGGAACTGAGCCACACCATCGCCATGATGGTGCCTTATGCGCTGCGCAAAAATATTGAACTGGCCTTTGATGGTCCGCAGGTTTGCCTAGTCATAACCGATAAACAGGCGCTTTTCTCGATAATTAACAATATCCTGAATAATGCGGTTAAATATTGTCCGCCTGGCAGTCTGGTTGAAACCACACTGGAAACCGGTCACGCAGATGATATCCGGATAATCATCCGTGATAACGGCGACGGTATAAGTGAACAGTATCGTCCCCGCCTGTTTTCACGTTTTTTCCGTGTTCCGGGCAGTTGTGAAACCGGCAGCGGACTCGGGCTGGCAATTGCGCAAAATCTGGCCGGAAAAATTGGCGGGTATTTGTCTGTCACTGATGGTTTACAACAGCGCGGGATCGGTTTTGTTATCCATATTTCTGCACACGGACTCTCTGCGCTTGCAGAGAGCAACAGTACGTCTGCGGTACATCATGACAATTCAGACACGTAATATATGTACAGTGGCGCGTTCCCTGTTACCGGCCGGTAACAGGGGAAAAT