Homologs in group_572

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_00905 FBDBKF_00905 61.3 Morganella morganii S1 ttrR tetrathionate respiration response regulator TtrR
EHELCC_00640 EHELCC_00640 61.3 Morganella morganii S2 ttrR tetrathionate respiration response regulator TtrR
NLDBIP_02820 NLDBIP_02820 61.3 Morganella morganii S4 ttrR tetrathionate respiration response regulator TtrR
LHKJJB_04335 LHKJJB_04335 61.3 Morganella morganii S3 ttrR tetrathionate respiration response regulator TtrR
HKOGLL_02710 HKOGLL_02710 61.3 Morganella morganii S5 ttrR tetrathionate respiration response regulator TtrR
F4V73_RS06900 F4V73_RS06900 60.3 Morganella psychrotolerans ttrR tetrathionate respiration response regulator TtrR

Distribution of the homologs in the orthogroup group_572

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_572

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7CQM8 7.01e-71 217 55 0 187 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23221 3.17e-43 146 39 1 188 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26487 8.44e-40 138 38 1 188 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8KR08 1.07e-38 135 37 2 190 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q3LWR6 5.01e-38 134 35 1 188 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 5.01e-38 134 35 1 188 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 5.01e-38 134 35 1 188 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P10958 9.19e-38 132 38 2 195 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P37740 1.59e-36 129 37 2 190 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
O87940 1.8e-29 112 32 1 189 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P15940 2.3e-26 103 29 1 198 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P13632 4.42e-16 79 34 0 115 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q9HU19 5.08e-16 79 37 2 116 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10046 1.07e-15 77 37 1 116 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
Q1XDE4 1.18e-14 72 29 3 195 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
P72781 6.21e-14 70 28 8 228 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P06184 1.11e-12 68 38 1 92 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGA9 4.94e-12 65 31 7 195 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 4.94e-12 65 31 7 195 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 4.94e-12 65 31 7 195 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 4.94e-12 65 31 7 195 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
P0AEL8 1.08e-11 64 27 3 150 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.08e-11 64 27 3 150 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P51343 3.29e-11 63 30 5 195 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
P27667 4.53e-11 62 30 7 195 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04849 6.76e-11 63 30 1 109 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P0AFU5 7.15e-11 63 33 1 132 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 7.15e-11 63 33 1 132 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q1M7A0 9.87e-11 62 24 4 193 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P48359 1.42e-10 61 25 7 207 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P28787 1.54e-10 62 30 0 116 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P0AED6 1.81e-10 61 26 2 153 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 1.81e-10 61 26 2 153 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 1.92e-10 61 26 2 153 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 1.92e-10 61 26 2 153 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P26319 2.12e-10 60 26 4 168 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P13800 3.01e-10 60 26 2 173 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P54662 5.38e-10 60 25 2 177 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
O34903 9.08e-10 59 28 6 176 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
P50350 1.22e-09 59 32 1 115 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
P50351 1.55e-09 58 32 1 115 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8X613 1.66e-09 59 30 0 117 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P14375 1.93e-09 59 30 0 117 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q9APD9 2.05e-09 59 30 0 117 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q55890 2.62e-09 58 31 1 122 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q07783 3.25e-09 58 29 1 123 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
P26275 3.56e-09 58 37 1 95 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P42508 5.16e-09 56 28 0 111 3 regA Photosynthetic apparatus regulatory protein RegA Rhodobacter capsulatus
P03029 5.98e-09 58 31 0 100 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
Q7CQM5 6.1e-09 57 22 2 165 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AFB8 6.64e-09 58 27 0 115 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 6.64e-09 58 27 0 115 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P0ACZ7 6.85e-09 56 25 3 154 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 6.85e-09 56 25 3 154 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 6.85e-09 56 25 3 154 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 6.85e-09 56 25 3 154 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
P41789 7.43e-09 58 27 0 115 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7WZY4 8.11e-09 56 25 3 162 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
A1KHB7 8.37e-09 57 28 0 134 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 8.37e-09 57 28 0 134 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P45337 1.16e-08 56 30 2 131 3 qseB Transcriptional regulatory protein QseB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P48259 1.24e-08 56 31 1 117 3 ycf27 Probable transcriptional regulator ycf27 Cyanophora paradoxa
A0R3I8 1.27e-08 56 27 0 134 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P9WGM9 1.38e-08 56 28 0 134 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 1.38e-08 56 28 0 134 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 1.38e-08 56 28 0 134 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A8R3S7 1.48e-08 55 26 5 199 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
P32967 1.63e-08 55 23 5 202 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P0C5S3 1.85e-08 55 27 0 111 3 actR Acid tolerance regulatory protein ActR Rhizobium meliloti (strain 1021)
A6UEL7 2.29e-08 55 27 0 111 3 actR Acid tolerance regulatory protein ActR Sinorhizobium medicae (strain WSM419)
Q9CD68 2.84e-08 55 27 1 143 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
A1TEL7 4.49e-08 54 30 2 138 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
O07528 4.62e-08 54 26 2 188 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q742C1 7.96e-08 53 27 0 134 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 7.96e-08 53 27 0 134 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
O82868 8.7e-08 53 27 1 133 3 regA Photosynthetic apparatus regulatory protein RegA Rhodovulum sulfidophilum
Q9KT84 9.38e-08 54 32 0 84 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1B3X8 1e-07 53 30 1 122 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 1e-07 53 30 1 122 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 1e-07 53 30 1 122 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q87MX7 1.3e-07 54 27 1 124 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZCY9 1.31e-07 54 27 1 129 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
P0C5S5 1.35e-07 54 27 1 124 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 1.35e-07 54 27 1 124 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
P96686 1.48e-07 53 24 4 206 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P0A4H5 1.83e-07 51 32 1 91 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.83e-07 51 32 1 91 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q6GE42 1.91e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 1.91e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
O78428 1.97e-07 53 30 1 115 3 ycf27 Probable transcriptional regulator ycf27 Guillardia theta
Q7A029 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 2.3e-07 52 24 3 162 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q00934 2.32e-07 53 34 0 70 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q68WH4 2.53e-07 53 27 1 129 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9I4N3 2.55e-07 53 31 0 105 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1RJS1 3.56e-07 53 26 1 129 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q7MM78 3.6e-07 53 33 0 74 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 3.6e-07 53 33 0 74 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
A0PWB4 3.62e-07 52 29 0 117 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
Q4UL27 3.66e-07 53 26 1 129 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P94439 3.7e-07 52 24 4 205 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P42421 4.06e-07 52 30 8 166 3 yxdJ Transcriptional regulatory protein YxdJ Bacillus subtilis (strain 168)
Q53228 4.08e-07 51 25 3 173 1 regA Photosynthetic apparatus regulatory protein RegA Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P25852 6.44e-07 52 29 0 117 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z333 6.62e-07 52 29 0 117 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q9KL96 7.02e-07 51 33 2 110 3 VC_A0850 Uncharacterized response regulatory protein VC_A0850 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P31079 7.25e-07 51 24 3 177 3 petR Protein PetR Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q06065 7.96e-07 52 29 0 106 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P0A4H2 1.05e-06 50 22 4 198 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 1.05e-06 50 22 4 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 1.05e-06 50 22 4 198 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9TLQ4 1.19e-06 50 31 3 123 3 ycf27 Probable transcriptional regulator ycf27 Cyanidium caldarium
Q4L8Q6 1.23e-06 50 24 4 162 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
P31802 2.37e-06 49 26 5 197 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P37478 2.42e-06 50 26 1 125 1 walR Transcriptional regulatory protein WalR Bacillus subtilis (strain 168)
Q92HC2 2.75e-06 50 25 1 129 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
L7N689 2.95e-06 49 24 1 131 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q51373 3.33e-06 49 22 2 153 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P95582 3.43e-06 49 23 5 202 3 gacA Response regulator GacA Pseudomonas viridiflava
Q9F8D7 4.8e-06 50 32 4 116 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q47456 5.11e-06 48 29 1 133 3 pcoR Transcriptional regulatory protein PcoR Escherichia coli
P9WGL9 5.2e-06 48 27 1 117 1 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL8 5.2e-06 48 27 1 117 2 regX3 Sensory transduction protein RegX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O07130 5.2e-06 48 27 1 117 1 regX3 Sensory transduction protein RegX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q52376 5.36e-06 48 23 5 202 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
Q9ZEP4 5.98e-06 48 28 1 112 1 cseB Transcriptional regulatory protein CseB Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0DMK7 7.23e-06 48 28 5 149 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain K96243)
I1WSZ4 7.23e-06 48 28 5 149 3 irlR Transcriptional activator protein IrlR Burkholderia pseudomallei (strain 1026b)
Q8CN75 8.29e-06 48 24 3 159 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q82EB1 9.63e-06 48 28 1 112 3 cseB Transcriptional regulatory protein CseB Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P28835 1.05e-05 48 28 1 114 3 ycf27 Probable transcriptional regulator ycf27 Porphyridium aerugineum
Q5HLK6 1.07e-05 47 24 3 159 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9F868 1.08e-05 48 26 1 117 1 regX3 Sensory transduction protein RegX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0AF31 1.17e-05 47 30 2 129 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 1.17e-05 47 30 2 129 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 1.17e-05 47 30 2 129 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 1.17e-05 47 30 2 129 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P0A4I0 1.22e-05 47 29 0 109 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 1.22e-05 47 29 0 109 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)
O34723 1.41e-05 47 26 4 184 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q8CQ37 1.5e-05 47 27 4 119 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR81 1.5e-05 47 27 4 119 3 graR Response regulator protein GraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q46791 1.65e-05 46 32 3 103 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P55184 2.11e-05 47 24 2 145 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
P58664 2.26e-05 47 32 3 103 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
P0A4I2 2.4e-05 47 27 0 118 3 cutR Transcriptional regulatory protein CutR Streptomyces lividans
P0A4I1 2.4e-05 47 27 0 118 3 cutR Transcriptional regulatory protein CutR Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0A4H8 2.61e-05 47 24 7 223 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4H7 2.61e-05 47 24 7 223 3 ciaR Transcriptional regulatory protein CiaR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P9WGM5 2.62e-05 46 24 2 167 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 2.62e-05 46 24 2 167 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P24908 2.65e-05 46 26 4 199 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1XDC9 2.66e-05 47 28 1 114 3 ycf27 Probable transcriptional regulator ycf27 Neopyropia yezoensis
P08368 3.04e-05 46 23 0 113 1 creB Transcriptional regulatory protein CreB Escherichia coli (strain K12)
P45607 3.1e-05 46 23 1 137 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P51358 3.13e-05 46 28 1 114 3 ycf27 Probable transcriptional regulator ycf27 Porphyra purpurea
Q49VK3 4.01e-05 46 26 4 128 3 graR Response regulator protein GraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P66795 4.2e-05 46 26 2 137 3 qseB Transcriptional regulatory protein QseB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66796 4.2e-05 46 26 2 137 3 qseB Transcriptional regulatory protein QseB Salmonella typhi
Q31S42 4.31e-05 46 29 3 124 1 rpaA DNA-binding dual master transcriptional regulator RpaA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P28257 4.64e-05 46 28 1 114 3 ycf27 Probable transcriptional regulator ycf27 Galdieria sulphuraria
Q56127 5.13e-05 45 23 7 215 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
P58663 5.23e-05 45 23 6 185 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O32197 5.46e-05 45 25 3 150 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P69410 5.7e-05 45 23 6 185 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 5.7e-05 45 23 6 185 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 5.7e-05 45 23 6 185 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 5.7e-05 45 23 6 185 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 5.7e-05 45 23 6 185 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
O31432 6.02e-05 45 26 4 126 3 ybdJ Uncharacterized transcriptional regulatory protein YbdJ Bacillus subtilis (strain 168)
Q8DPL7 6.4e-05 45 25 1 115 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2UQ68 6.4e-05 45 25 1 115 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A0A0H2ZN37 6.4e-05 45 25 1 115 1 walR Transcriptional regulatory protein WalR Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8XBS3 6.84e-05 45 28 1 113 2 qseB Transcriptional regulatory protein QseB Escherichia coli O157:H7
P52076 7.17e-05 45 28 1 113 2 qseB Transcriptional regulatory protein QseB Escherichia coli (strain K12)
Q04942 7.23e-05 45 25 1 117 1 afsQ1 Transcriptional regulatory protein AfsQ1 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q2NB98 7.3e-05 45 39 0 53 1 ELI_04755 Light-activated DNA-binding protein EL222 Erythrobacter litoralis (strain HTCC2594)
P59969 7.73e-05 46 40 0 57 4 BQ2027_MB0914C Putative HTH-type transcriptional regulator Mb0914c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMG1 7.73e-05 46 40 0 57 1 Rv0890c Putative HTH-type transcriptional regulator Rv0890c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMG0 7.73e-05 46 40 0 57 4 MT0914 Putative HTH-type transcriptional regulator MT0914 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A9Q4 8.12e-05 45 23 1 134 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 8.12e-05 45 23 1 134 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 8.12e-05 45 23 1 134 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 8.12e-05 45 23 1 134 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
A8Z181 8.61e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW8 8.61e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain Newman)
Q5HI09 8.61e-05 45 28 4 128 1 graR Response regulator protein GraR Staphylococcus aureus (strain COL)
Q2G0E0 8.61e-05 45 28 4 128 1 graR Response regulator protein GraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIY0 8.61e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain USA300)
Q6GJ11 8.7e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain MRSA252)
Q2YSS2 9.21e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1L2 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain MW2)
Q6GBH1 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain MSSA476)
Q99VW2 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain N315)
A5IQL2 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH9)
A6TZD6 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain JH1)
A7WZC3 9.57e-05 45 28 4 128 3 graR Response regulator protein GraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P45606 9.65e-05 45 21 2 181 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
Q4UU85 9.74e-05 45 26 3 141 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
Q932F1 9.94e-05 45 28 4 128 1 graR Response regulator protein GraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P13792 0.000104 45 25 0 112 1 phoP Alkaline phosphatase synthesis transcriptional regulatory protein PhoP Bacillus subtilis (strain 168)
P0AFJ5 0.000109 45 23 1 137 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 0.000109 45 23 1 137 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
Q44006 0.000112 45 25 1 120 2 czcR Transcriptional activator protein CzcR Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
P14204 0.000127 44 23 6 208 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
B8GZM2 0.000147 45 34 4 93 1 pleD Response regulator PleD Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A5I5 0.000147 45 34 4 93 1 pleD Response regulator PleD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0CL17 0.000174 44 26 7 178 2 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WA34 0.000174 44 26 7 178 3 tctD Transcriptional regulatory protein TctD Salmonella typhimurium (strain SL1344)
P44895 0.000195 44 31 2 122 3 cpxR Transcriptional regulatory protein CpxR homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88RJ6 0.000197 45 28 0 106 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P42244 0.000232 44 28 4 126 3 ycbL Uncharacterized transcriptional regulatory protein YcbL Bacillus subtilis (strain 168)
Q9K621 0.000252 43 25 1 115 3 bceR Sensory transduction protein BceR Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O31517 0.000253 44 27 3 123 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
P40138 0.00032 44 30 4 123 1 cyaB Adenylate cyclase 2 Stigmatella aurantiaca
Q4L481 0.000326 43 28 8 127 3 graR Response regulator protein GraR Staphylococcus haemolyticus (strain JCSC1435)
Q8D4U6 0.00034 43 31 1 79 3 VV2_1193 Uncharacterized response regulatory protein VV2_1193 Vibrio vulnificus (strain CMCP6)
Q88AQ2 0.000344 44 29 2 109 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P45605 0.000347 43 23 1 137 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae
P45671 0.000355 44 23 0 116 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P10577 0.000376 43 23 0 121 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P45365 0.000394 44 23 2 114 3 None Uncharacterized 76.5 kDa protein in phbC 3'region Thiocystis violacea
P10576 0.000415 43 23 2 132 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P23747 0.000438 43 28 6 138 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FZ93 0.000463 43 24 0 106 1 ctrA Cell cycle response regulator CtrA Brucella suis biovar 1 (strain 1330)
B0CI76 0.000463 43 24 0 106 3 ctrA Cell cycle response regulator CtrA Brucella suis (strain ATCC 23445 / NCTC 10510)
A5VRW9 0.000463 43 24 0 106 1 ctrA Cell cycle response regulator CtrA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q7CNV1 0.000463 43 24 0 106 1 ctrA Cell cycle response regulator CtrA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9M708 0.000463 43 24 0 106 3 ctrA Cell cycle response regulator CtrA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9ZHS1 0.000463 43 24 0 106 1 ctrA Cell cycle response regulator CtrA Brucella abortus biovar 1 (strain 9-941)
Q2YQA4 0.000463 43 24 0 106 1 ctrA Cell cycle response regulator CtrA Brucella abortus (strain 2308)
B2S753 0.000463 43 24 0 106 3 ctrA Cell cycle response regulator CtrA Brucella abortus (strain S19)
P52106 0.000465 43 26 7 203 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
A6WZ81 0.000481 43 24 0 106 3 ctrA Cell cycle response regulator CtrA Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9AE24 0.000509 43 29 2 110 3 rprY Transcriptional regulatory protein RprY Bacteroides fragilis (strain YCH46)
Q9HUI2 0.000516 43 30 3 120 3 aruR Transcriptional regulatory protein AruR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87S86 0.00066 42 23 7 219 3 VP0538 Uncharacterized response regulatory protein VP0538 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P35163 0.000699 42 25 9 211 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
G3XCY6 0.000718 42 27 2 116 1 gltR Transcriptional regulatory protein GltR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P56644 0.000747 42 24 3 186 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
O25918 0.0008 42 24 2 121 3 crdR Transcriptional regulatory protein CrdR Helicobacter pylori (strain ATCC 700392 / 26695)
B8H358 0.000805 42 23 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAW8 0.000805 42 23 0 106 3 ctrA Cell cycle transcriptional regulator CtrA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P38889 0.001 43 26 1 134 1 SKN7 Transcription factor SKN7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P94413 0.001 42 22 7 217 3 yclJ Uncharacterized transcriptional regulatory protein YclJ Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS08245
Feature type CDS
Gene ttrR
Product tetrathionate respiration response regulator TtrR
Location 1802039 - 1802641 (strand: 1)
Length 603 (nucleotides) / 200 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_572
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4566 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, FixJ family, consists of REC and HTH domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K13041 two-component system, LuxR family, response regulator TtrR Two-component system -

Protein Sequence

MPTIHLVDDDLAVTDACQFLLESLGYAAQVWNDSEYFLHNIDLYQQGVVLLDMRMPKADGRQVHQYLIEKHSTLAVIFLTGHGDIPMAVEEIKKGAIDFLQKPIDSNALLSALKSAFTETATRFTADDIRRRYASLTPREKDIAYYVIQGLMNREIAETACVSIRTVEVHRAKVMDKMAVKNIAELVTALQGIDIVAPNL

Flanking regions ( +/- flanking 50bp)

ATTAAAAATCACCCTTATTTTCCCCAATAACAATAATTAGAGGAAGAAAAATGCCAACAATTCATCTGGTTGATGACGATCTCGCCGTCACCGATGCTTGCCAATTTCTATTAGAAAGCTTAGGTTATGCGGCGCAGGTTTGGAATGACAGCGAATATTTTCTCCATAATATTGACCTTTATCAGCAAGGGGTTGTGCTGTTAGACATGAGAATGCCTAAAGCAGATGGTAGACAAGTACATCAATATTTAATTGAAAAACACAGTACGCTAGCAGTGATTTTCTTAACGGGTCATGGTGATATTCCGATGGCGGTTGAAGAAATAAAAAAAGGTGCCATTGATTTTTTACAAAAACCCATTGATAGCAATGCATTACTCTCTGCACTGAAATCCGCCTTTACCGAAACTGCAACACGCTTTACGGCTGATGATATCCGTCGCCGTTATGCCTCACTGACACCAAGAGAAAAAGATATTGCATATTATGTTATTCAAGGCCTAATGAATCGAGAAATTGCTGAAACTGCCTGTGTTTCTATCAGAACAGTTGAGGTACATCGAGCAAAAGTGATGGATAAAATGGCCGTTAAAAATATCGCAGAATTAGTTACCGCATTACAAGGAATTGATATTGTAGCGCCAAATTTATGACAAAATTTCTGATCTGCGGTAAAAAGTGTCACAATATAGAATATTCATTG