Homologs in group_2179

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16405 FBDBKF_16405 56.3 Morganella morganii S1 yidA sugar-phosphatase
EHELCC_08270 EHELCC_08270 56.3 Morganella morganii S2 yidA sugar-phosphatase
NLDBIP_08595 NLDBIP_08595 56.3 Morganella morganii S4 yidA sugar-phosphatase
LHKJJB_05670 LHKJJB_05670 56.3 Morganella morganii S3 yidA sugar-phosphatase
HKOGLL_05245 HKOGLL_05245 56.3 Morganella morganii S5 yidA sugar-phosphatase
F4V73_RS02925 F4V73_RS02925 56.7 Morganella psychrotolerans yidA sugar-phosphatase

Distribution of the homologs in the orthogroup group_2179

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2179

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A8Y7 1.85e-89 269 45 0 268 3 yidA Sugar phosphatase YidA Shigella flexneri
P0A8Y5 1.85e-89 269 45 0 268 1 yidA Sugar phosphatase YidA Escherichia coli (strain K12)
P0A8Y6 1.85e-89 269 45 0 268 3 yidA Sugar phosphatase YidA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P54947 1.3e-74 231 41 0 265 3 yxeH Putative phosphatase YxeH Bacillus subtilis (strain 168)
Q5XD45 1.03e-72 226 41 1 268 1 M6_Spy0533 Putative phosphatase M6_Spy0533 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P42962 2.1e-34 127 31 7 269 1 ycsE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YcsE Bacillus subtilis (strain 168)
P94592 1.93e-27 110 28 6 284 1 ywpJ Phosphatase YwpJ Bacillus subtilis (strain 168)
P44447 5.51e-23 97 29 7 272 1 HI_0003 Putative phosphatase HI_0003 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P70947 2.47e-22 96 28 10 273 1 yitU 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU Bacillus subtilis (strain 168)
P96741 1.27e-21 94 29 9 299 1 ywtE 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YwtE Bacillus subtilis (strain 168)
Q8L5Z4 2.63e-21 96 28 8 279 1 YBEY Endoribonuclease YBEY, chloroplastic Arabidopsis thaliana
P53661 4.51e-21 93 28 8 280 3 MCAP_0732 Putative phosphatase MCAP_0732 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A7MFJ6 5.77e-19 87 28 7 254 3 cof HMP-PP phosphatase Cronobacter sakazakii (strain ATCC BAA-894)
A8GAR8 6.69e-17 81 25 5 249 3 cof HMP-PP phosphatase Serratia proteamaculans (strain 568)
P75792 8.76e-17 81 25 9 269 1 ybiV Sugar phosphatase YbiV Escherichia coli (strain K12)
O07539 1.11e-16 81 24 5 274 1 yhaX Stress response protein YhaX Bacillus subtilis (strain 168)
P75360 5.12e-16 79 25 6 256 3 MPN_427 Putative phosphatase MPN_427 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8KA73 6.24e-16 79 26 7 272 3 BUsg_029 Putative phosphatase BUsg_029 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P21829 2.55e-15 77 24 8 273 1 ybhA Pyridoxal phosphate phosphatase YbhA Escherichia coli (strain K12)
P47507 2.83e-15 77 27 9 286 3 MG265 Putative phosphatase MG265 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8TK72 4.55e-15 75 27 9 265 3 MA_3544 Phosphoglycolate phosphatase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O27143 9.57e-15 74 24 10 270 3 MTH_1071 Phosphoglycolate phosphatase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B1JHR2 1.62e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLB5 1.62e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPD3 1.82e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pestis (strain Pestoides F)
Q1CL56 1.82e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZP3 1.82e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Angola)
Q7CK25 1.82e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pestis
Q1C4L7 1.82e-14 74 27 7 249 3 cof HMP-PP phosphatase Yersinia pestis bv. Antiqua (strain Antiqua)
Q66DS5 3.36e-14 73 28 9 253 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype I (strain IP32953)
A1RSN2 5.9e-14 72 26 9 272 3 Pisl_0788 Phosphoglycolate phosphatase Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q89B25 6.07e-14 73 26 7 273 3 bbp_030 Putative phosphatase bbp_030 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A4W7B7 7.61e-14 72 26 7 250 3 cof HMP-PP phosphatase Enterobacter sp. (strain 638)
A6T5I9 9.18e-14 72 25 7 249 3 cof HMP-PP phosphatase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2K6W6 1.47e-13 72 26 7 249 3 cof HMP-PP phosphatase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A8AK07 1.86e-13 72 24 8 271 3 cof HMP-PP phosphatase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LMD3 2.08e-13 71 26 9 247 3 cof HMP-PP phosphatase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5Y0T3 2.84e-13 71 26 7 249 3 cof HMP-PP phosphatase Klebsiella pneumoniae (strain 342)
P75809 3.23e-13 71 25 8 277 1 ybjI 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YbjI Escherichia coli (strain K12)
A3CWU5 3.38e-13 70 21 5 274 3 Memar_1919 Phosphoglycolate phosphatase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
P44771 3.74e-13 70 26 7 268 3 HI_0597 Putative phosphatase HI_0597 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B7L683 4.46e-13 70 26 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain 55989 / EAEC)
B1YDE0 5.46e-13 69 24 9 248 3 Tneu_0866 Phosphoglycolate phosphatase Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
A9MM14 8.35e-13 70 24 7 284 3 cof HMP-PP phosphatase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8FKA2 2.77e-12 68 25 7 246 3 cof HMP-PP phosphatase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q325F5 2.8e-12 68 25 8 246 3 cof HMP-PP phosphatase Shigella boydii serotype 4 (strain Sb227)
P57140 3e-12 68 25 8 276 3 BU028/BU029 Putative phosphatase BU028/BU029 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5JDB7 3.77e-12 67 24 5 266 3 TK2301 Phosphoglycolate phosphatase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5XAQ1 5.18e-12 68 22 8 271 1 M6_Spy1377 Putative bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B7N900 5.48e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M3T9 5.48e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O8 (strain IAI1)
Q3Z4V2 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Shigella sonnei (strain Ss046)
B2U4Q1 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RF89 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain UTI89 / UPEC)
B1LJK3 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZQ3 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain SE11)
Q0TKJ5 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8B5 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O1:K1 / APEC
A7ZXA4 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O9:H4 (strain HS)
B7NJ48 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MDA5 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJR9 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIK4 5.58e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8PZN6 6.76e-12 66 25 10 274 3 MM_0456 Phosphoglycolate phosphatase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P46891 8.56e-12 67 25 8 246 1 cof HMP-PP phosphatase Escherichia coli (strain K12)
B1XFN4 8.56e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain K12 / DH10B)
C4ZTK3 8.56e-12 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli (strain K12 / MC4100 / BW2952)
B5Z3V4 1.01e-11 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE50 1.01e-11 67 25 8 246 3 cof HMP-PP phosphatase Escherichia coli O157:H7
P27848 1.08e-11 66 23 8 267 1 yigL Pyridoxal phosphate phosphatase YigL Escherichia coli (strain K12)
B7MQG2 1.08e-11 67 24 7 246 3 cof HMP-PP phosphatase Escherichia coli O81 (strain ED1a)
C6A1L0 1.36e-11 66 24 7 265 3 TSIB_0439 Phosphoglycolate phosphatase Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q83M49 1.38e-11 66 24 6 246 3 cof HMP-PP phosphatase Shigella flexneri
Q0T7D7 1.38e-11 66 24 6 246 3 cof HMP-PP phosphatase Shigella flexneri serotype 5b (strain 8401)
Q8X8L6 1.59e-11 66 23 8 267 3 yigL Pyridoxal phosphate phosphatase YigL Escherichia coli O157:H7
O29805 3.11e-11 64 24 8 264 3 AF_0444 Phosphoglycolate phosphatase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B5EXJ7 6.97e-11 64 23 7 284 3 cof HMP-PP phosphatase Salmonella agona (strain SL483)
B4SWV0 7.98e-11 64 23 7 284 3 cof HMP-PP phosphatase Salmonella newport (strain SL254)
Q8Z8U7 1.09e-10 63 24 6 273 3 cof HMP-PP phosphatase Salmonella typhi
Q8TYT9 1.23e-10 63 24 9 268 3 MK0203 Phosphoglycolate phosphatase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8ZRB6 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BD74 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella paratyphi A (strain AKU_12601)
A9MWC0 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PFM4 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T9F2 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella heidelberg (strain SL476)
B5R6V8 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QU47 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella enteritidis PT4 (strain P125109)
B5FKW1 1.34e-10 63 23 7 284 3 cof HMP-PP phosphatase Salmonella dublin (strain CT_02021853)
P75399 1.81e-10 63 21 5 266 3 MPN_383 Putative phosphatase MPN_383 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q57SA6 2.57e-10 62 23 7 284 3 cof HMP-PP phosphatase Salmonella choleraesuis (strain SC-B67)
B4TMD5 2.97e-10 62 23 7 284 3 cof HMP-PP phosphatase Salmonella schwarzengrund (strain CVM19633)
P21878 5.72e-10 58 34 0 84 3 None Uncharacterized protein in pdhA 5'region (Fragment) Geobacillus stearothermophilus
Q2FU45 5.79e-10 61 21 8 260 3 Mhun_2939 Phosphoglycolate phosphatase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q45494 8.09e-10 61 32 0 93 3 ykrA Putative phosphatase YkrA Bacillus subtilis (strain 168)
Q8ZT04 8.9e-10 60 25 10 243 3 PAE3495 Phosphoglycolate phosphatase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
P95967 1.84e-09 60 26 11 269 3 SSO0094 Phosphoglycolate phosphatase 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9UTA6 2.62e-09 60 22 8 288 1 SPAC25B8.12c Uncharacterized hydrolase C25B8.12c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12UG6 3.28e-09 59 24 7 264 3 Mbur_2034 Phosphoglycolate phosphatase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
A1JNL2 3.47e-09 59 23 6 271 3 cof HMP-PP phosphatase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A5ULS3 3.75e-09 58 34 0 88 3 Msm_0946 Phosphoglycolate phosphatase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q8U111 2.25e-08 57 23 7 268 3 PF1419 Phosphoglycolate phosphatase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q6KZ42 6.5e-08 55 26 8 250 3 PTO1425 Phosphoglycolate phosphatase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
B1IZE7 6.79e-08 55 24 8 230 3 cof HMP-PP phosphatase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
O50129 7.95e-08 55 22 7 267 1 PH1421 Phosphoglycolate phosphatase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O94314 1.9e-07 54 24 11 288 3 SPBC215.10 Uncharacterized hydrolase C215.10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q97C22 2.49e-07 53 22 6 251 3 TV0283 Phosphoglycolate phosphatase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A0B7J8 3.93e-07 53 32 0 67 3 Mthe_0884 Phosphoglycolate phosphatase Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
P75401 4.68e-07 53 23 10 290 3 MPN_381 Putative phosphatase MPN_381 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9V0Q4 6.91e-07 52 21 7 270 3 PYRAB07350 Phosphoglycolate phosphatase Pyrococcus abyssi (strain GE5 / Orsay)
A4YIL7 2.77e-06 50 24 9 222 3 Msed_2130 Phosphoglycolate phosphatase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
P75511 4.19e-06 50 20 9 248 3 MPN_264 Putative phosphatase MPN_264 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9HLQ2 5.05e-06 49 22 7 250 1 Ta0175 Phosphoglycolate phosphatase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q4J8P4 1.01e-05 48 22 11 269 3 Saci_1518 Phosphoglycolate phosphatase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P47371 1.03e-05 49 31 1 87 3 MG125 Putative phosphatase MG125 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q3ISC7 2.22e-05 48 28 0 81 3 NP_1738A Phosphoglycolate phosphatase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A9A492 2.85e-05 47 20 8 270 3 Nmar_0685 Phosphoglycolate phosphatase Nitrosopumilus maritimus (strain SCM1)
B9LMX5 0.000107 45 27 0 76 3 Hlac_1119 Phosphoglycolate phosphatase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q32JB1 0.000148 44 36 0 63 5 cof Putative HMP-PP phosphatase Shigella dysenteriae serotype 1 (strain Sd197)
Q9HRF9 0.000159 45 21 10 270 3 VNG_0718C Phosphoglycolate phosphatase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R403 0.000159 45 21 10 270 3 OE_2060R Phosphoglycolate phosphatase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O28142 0.000258 45 43 1 53 3 AF_2138 Phosphoserine phosphatase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A3DNN7 0.000666 43 28 0 83 3 Smar_1152 Phosphoglycolate phosphatase Staphylothermus marinus (strain ATCC 43588 / DSM 3639 / JCM 9404 / F1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07800
Feature type CDS
Gene yidA
Product sugar-phosphatase
Location 1707504 - 1708310 (strand: 1)
Length 807 (nucleotides) / 268 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2179
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF08282 haloacid dehalogenase-like hydrolase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0561 Coenzyme transport and metabolism (H)
General function prediction only (R)		 HR Hydroxymethylpyrimidine pyrophosphatase and other HAD family phosphatases

Kegg Ortholog Annotation(s)

Protein Sequence

MSIKLIVIDLDGTLLNEQHEITPEVHQAIQHAKNSGVHIVLASGRSFNGISPYLKALNLDTSDNFCISNNGSQIHQAENGEIITEDLLNFEDYLYFEDLSREIGVHFHVLSDNKIYTTNRHISHFTCREAFLTWTPLYYRPLSEMQRDMRFSKFMIVGTPTVLDNAMQYLPANIYQQYSILRSAPYFIEILNTDVNKGNAVQKIAEHLKITPEKIMCIGDQDNDLAMLQYAGLGVAMGNAPEEIKKVAKFITLSNKEHGVAVAINKFI

Flanking regions ( +/- flanking 50bp)

ACCTCGCCCTTACCAACCATTAACTGCTTTACTTTAATATGGGGATGATAATGAGTATTAAGCTTATCGTTATTGATTTAGATGGAACGTTACTAAACGAACAACATGAGATCACACCTGAAGTACATCAAGCGATCCAACATGCTAAAAATTCTGGAGTGCATATTGTTCTTGCATCTGGGCGATCTTTTAACGGCATCTCTCCCTATTTAAAAGCACTGAATCTTGATACATCTGATAACTTTTGCATTAGCAATAATGGTAGCCAAATTCACCAAGCAGAAAATGGTGAAATTATCACCGAAGACTTGCTCAATTTTGAAGATTACCTCTATTTTGAAGATCTCTCCCGTGAGATAGGTGTTCACTTTCATGTTTTAAGTGATAATAAAATTTATACCACCAATCGCCATATTAGCCATTTTACTTGTCGTGAAGCATTCTTAACGTGGACACCTCTCTATTATCGCCCCTTAAGCGAAATGCAAAGAGATATGCGCTTTAGTAAATTTATGATCGTTGGTACACCTACGGTATTAGATAACGCAATGCAATATTTACCTGCTAATATCTATCAACAATACAGCATATTACGTAGCGCTCCTTATTTTATTGAGATATTAAATACCGATGTCAATAAAGGAAACGCGGTACAAAAAATAGCAGAACATTTAAAAATCACTCCAGAGAAAATAATGTGTATTGGCGATCAAGATAATGATTTAGCGATGTTACAGTATGCGGGATTGGGTGTTGCGATGGGAAACGCCCCTGAAGAGATCAAAAAAGTGGCGAAATTTATTACATTATCTAATAAAGAACACGGTGTTGCTGTCGCTATCAATAAATTTATTTAAACACGATATTTTTTGTGTTTTATCACTAATGTCTACAAAATTATATAGCA