Homologs in group_2094

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15760 FBDBKF_15760 39.3 Morganella morganii S1 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
EHELCC_17675 EHELCC_17675 39.3 Morganella morganii S2 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
NLDBIP_19345 NLDBIP_19345 39.3 Morganella morganii S4 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
LHKJJB_18115 LHKJJB_18115 39.3 Morganella morganii S3 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
HKOGLL_18965 HKOGLL_18965 39.3 Morganella morganii S5 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
F4V73_RS07930 F4V73_RS07930 40.1 Morganella psychrotolerans - response regulator

Distribution of the homologs in the orthogroup group_2094

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2094

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AED6 2.17e-46 154 41 2 177 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 2.17e-46 154 41 2 177 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 2.17e-46 154 41 2 177 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 2.17e-46 154 41 2 177 3 uvrY Response regulator UvrY Escherichia coli O157:H7
P95582 1.43e-35 126 38 2 174 3 gacA Response regulator GacA Pseudomonas viridiflava
Q52376 1.47e-35 126 38 2 174 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
Q51373 3.08e-34 123 36 2 177 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P32967 6.6e-32 117 40 1 154 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
A8R3S7 8.82e-20 85 30 3 178 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
Q7CQM5 1.16e-19 85 29 1 172 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P13800 4.93e-14 70 23 3 193 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P29904 1.81e-13 69 29 1 171 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
P27667 1.82e-13 68 28 3 145 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26319 5.37e-13 67 25 1 175 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEL8 1.6e-12 66 27 1 167 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.6e-12 66 27 1 167 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q7WZY4 1.98e-12 66 27 5 185 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
P0AGA9 1.99e-11 63 30 4 145 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 1.99e-11 63 30 4 145 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 1.99e-11 63 30 4 145 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 1.99e-11 63 30 4 145 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
P0A4H2 2.84e-11 63 23 2 171 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 2.84e-11 63 23 2 171 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 2.84e-11 63 23 2 171 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q46791 3.87e-11 61 31 3 149 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P58664 1.15e-10 61 28 4 179 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
Q8CN75 1.77e-10 61 25 3 185 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLK6 2.52e-10 60 25 3 185 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A029 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 2.54e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
O34723 2.62e-10 60 30 2 104 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
Q6GE42 2.7e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 2.7e-10 60 27 5 185 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
O32197 4.5e-10 59 28 2 162 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P0ACZ7 6.11e-10 59 28 3 156 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 6.11e-10 59 28 3 156 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 6.11e-10 59 28 3 156 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 6.11e-10 59 28 3 156 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q4L8Q6 1.21e-09 58 25 3 184 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
P94439 1.4e-09 58 23 3 181 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
Q4L7J5 1.43e-09 58 26 2 148 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
O07528 1.69e-09 58 27 4 174 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P9WGM5 2.64e-09 57 23 2 160 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 2.64e-09 57 23 2 160 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8CNP9 3.13e-09 57 26 2 148 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 3.13e-09 57 26 2 148 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q1M7A0 4.95e-09 57 27 4 155 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q5HEP0 5.66e-09 56 25 2 148 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 5.66e-09 56 25 2 148 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q7A0I0 6.98e-09 56 25 2 148 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 6.98e-09 56 25 2 148 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 6.98e-09 56 25 2 148 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 6.98e-09 56 25 2 148 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 6.98e-09 56 25 2 148 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 6.98e-09 56 25 2 148 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P23221 1.68e-08 55 28 3 156 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P54662 1.69e-08 55 20 3 194 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
Q3LWR6 5.8e-08 54 27 3 157 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 5.8e-08 54 27 3 157 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 5.8e-08 54 27 3 157 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P44845 5.91e-08 53 27 5 165 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q49YS9 6.46e-08 53 25 2 148 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P24908 8.53e-08 53 26 1 175 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96686 1.16e-07 53 24 5 179 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P58663 1.43e-07 53 27 2 136 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56127 1.47e-07 52 27 2 136 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
P31802 1.56e-07 52 23 2 167 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P69410 1.6e-07 52 27 2 136 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 1.6e-07 52 27 2 136 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 1.6e-07 52 27 2 136 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 1.6e-07 52 27 2 136 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 1.6e-07 52 27 2 136 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
Q8KR08 4.07e-07 51 26 3 157 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P56644 6.53e-07 51 25 2 146 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
O07019 8.56e-07 50 24 2 157 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
A8R3T0 4.85e-06 48 23 3 160 3 agmR Glycerol metabolism activator Pseudomonas putida
P29369 8.94e-06 47 22 3 167 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P26487 1.09e-05 47 24 3 158 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
O87940 1.58e-05 47 37 0 66 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P10958 2.17e-05 46 25 4 176 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07405
Feature type CDS
Gene -
Product LuxR C-terminal-related transcriptional regulator
Location 1616486 - 1617049 (strand: -1)
Length 564 (nucleotides) / 187 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2094
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Protein Sequence

MNDESEAFRYCRQYSVNLIIFYSLPTVSLIDVIKRIKRFSPIIKIVVISPKIDSILSVTLLQLGIEGFIVIDSSAANVLQAIRQVCIGQRYISPEIAMDIALTKVQADLNPLHHLSERELQIMSMIIRGKKIAQIAQELNISTKTVNSYRYRMFSKLKISGDVELTHIAVRYGLIEIESYLQSGKHI

Flanking regions ( +/- flanking 50bp)

GTATAGAAAAATTACTTTGCCAGATTAAAAAAATTAACATTCGTAAGATTATGAATGATGAAAGTGAAGCTTTTCGTTATTGCAGACAATATTCTGTCAATCTTATTATTTTTTATTCTTTACCTACTGTCTCTTTAATAGATGTAATAAAAAGAATTAAACGTTTTTCTCCCATTATAAAAATAGTGGTTATTTCGCCTAAAATAGACTCAATACTTTCCGTCACATTGCTACAGTTAGGTATTGAAGGGTTTATCGTTATAGATTCCTCTGCTGCGAATGTGCTTCAGGCCATTCGACAAGTCTGTATTGGTCAACGTTATATTAGTCCAGAAATTGCTATGGATATTGCACTAACTAAAGTACAAGCAGACTTAAATCCGCTACATCATCTTTCTGAAAGAGAGTTACAGATAATGTCGATGATTATAAGAGGGAAAAAAATAGCACAAATTGCACAAGAGCTGAATATCAGCACTAAAACAGTAAATAGCTATCGTTATCGAATGTTTAGTAAACTTAAAATCTCAGGTGATGTAGAATTAACTCATATAGCAGTTCGTTATGGGTTAATCGAGATAGAGAGTTACTTACAAAGTGGAAAACATATTTGATGCTAAAGCATTTCTAAGTCGAGTAACGAGTCAACCGGGTGTGTATCGAA