Homologs in group_2094

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15760 FBDBKF_15760 100.0 Morganella morganii S1 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
EHELCC_17675 EHELCC_17675 100.0 Morganella morganii S2 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
NLDBIP_19345 NLDBIP_19345 100.0 Morganella morganii S4 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
LHKJJB_18115 LHKJJB_18115 100.0 Morganella morganii S3 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
F4V73_RS07930 F4V73_RS07930 89.0 Morganella psychrotolerans - response regulator
PMI_RS07405 PMI_RS07405 39.3 Proteus mirabilis HI4320 - LuxR C-terminal-related transcriptional regulator

Distribution of the homologs in the orthogroup group_2094

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2094

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AED6 4.73e-64 201 46 0 215 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 4.73e-64 201 46 0 215 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 6.01e-64 200 46 0 215 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 6.01e-64 200 46 0 215 3 uvrY Response regulator UvrY Escherichia coli O157:H7
Q51373 1.11e-51 169 40 2 211 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q52376 8.79e-49 161 37 0 210 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P95582 1.08e-48 161 37 0 210 3 gacA Response regulator GacA Pseudomonas viridiflava
P32967 4.53e-48 160 38 1 210 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
O32197 1.23e-26 104 29 0 195 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
P13800 5.67e-25 100 25 4 227 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P55184 7.54e-24 97 28 1 213 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
Q7WZY4 1.66e-23 96 28 5 218 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q8CN75 1.68e-23 96 30 5 223 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLK6 2.54e-23 96 30 5 223 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4L8Q6 3.3e-23 95 28 4 218 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q6GE42 8.72e-23 94 30 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 8.72e-23 94 30 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
P27667 1.32e-22 94 29 4 202 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A029 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 2.09e-22 94 29 5 222 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
P96686 2.89e-22 93 31 5 219 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P54662 7.73e-22 92 22 3 228 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P0A4H2 9.19e-22 92 27 2 193 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 9.19e-22 92 27 2 193 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 9.19e-22 92 27 2 193 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P9WGM5 1.03e-21 92 27 3 211 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 1.03e-21 92 27 3 211 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O34723 1.04e-20 89 28 6 202 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
P31802 1.05e-20 89 27 1 205 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P0AGA9 4.66e-20 87 27 4 201 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 4.66e-20 87 27 4 201 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 4.66e-20 87 27 4 201 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 4.66e-20 87 27 4 201 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
P9WMF9 2.38e-19 85 26 0 195 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 2.38e-19 85 26 0 195 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P44845 1.17e-18 83 26 2 202 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A8R3S7 1.26e-18 84 25 1 177 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
P0AEL8 4.36e-18 82 23 1 208 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 4.36e-18 82 23 1 208 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
Q7CQM5 9.01e-18 81 25 2 208 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26319 8.69e-17 79 24 3 210 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O07019 1.44e-16 78 26 2 210 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
P94439 6.28e-16 76 22 3 219 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
Q7A0I0 1.82e-15 75 23 2 210 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 1.82e-15 75 23 2 210 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 1.82e-15 75 23 2 210 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 1.82e-15 75 23 2 210 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 1.82e-15 75 23 2 210 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 1.82e-15 75 23 2 210 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P24908 3.33e-15 74 29 2 185 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P58664 2.25e-13 69 25 2 212 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
O07528 4.93e-13 68 22 4 212 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
Q1M7A0 1.22e-11 65 24 4 211 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P29904 1.48e-11 64 24 3 208 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
Q5HEP0 9.4e-11 62 23 2 210 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 9.4e-11 62 23 2 210 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
P56644 3.47e-10 60 23 3 194 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
Q8CNP9 1.2e-09 59 22 2 210 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 1.2e-09 59 22 2 210 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q46791 2.04e-09 57 27 1 151 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P0AF31 3.13e-09 58 23 2 185 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 3.13e-09 58 23 2 185 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 3.13e-09 58 23 2 185 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 3.13e-09 58 23 2 185 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
P0ACZ7 3.72e-09 57 23 1 180 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 3.72e-09 57 23 1 180 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 3.72e-09 57 23 1 180 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 3.72e-09 57 23 1 180 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
Q8KR08 5.69e-09 57 27 3 147 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
Q4L7J5 5.76e-09 57 22 2 210 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
P69410 2.38e-08 55 23 3 204 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 2.38e-08 55 23 3 204 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 2.38e-08 55 23 3 204 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 2.38e-08 55 23 3 204 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 2.38e-08 55 23 3 204 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
P58663 2.58e-08 55 23 3 204 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q56127 4e-08 55 23 3 204 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q49YS9 6.96e-08 54 21 2 210 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P26487 9.63e-08 53 26 3 164 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q3LWR6 7.12e-07 51 23 2 147 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 7.12e-07 51 23 2 147 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 7.12e-07 51 23 2 147 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P15940 1.28e-06 50 25 2 141 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P23221 1.44e-06 50 25 4 159 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8TLG9 2.88e-06 50 26 4 145 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9WYN9 5.64e-06 49 29 4 135 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8Q009 6.15e-06 49 26 3 146 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
O58192 1.24e-05 48 29 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2SFK0 1.99e-05 48 31 3 106 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q9UYF3 2.59e-05 47 29 2 107 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pyrococcus abyssi (strain GE5 / Orsay)
A8R3T0 2.72e-05 47 24 4 206 3 agmR Glycerol metabolism activator Pseudomonas putida
Q56312 4.43e-05 45 23 1 117 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O54294 4.52e-05 46 23 4 146 1 csgD Probable csgAB operon transcriptional regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P52106 5.26e-05 46 22 3 144 1 csgD CsgBAC operon transcriptional regulatory protein Escherichia coli (strain K12)
P29369 5.93e-05 46 22 5 206 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P62646 6.5e-05 46 30 0 81 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
O83639 8.35e-05 46 32 0 81 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
B0R4K1 8.61e-05 44 24 1 112 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q9AAK0 0.00014 45 33 3 103 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45671 0.000187 45 25 1 91 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
Q5V0B3 0.000247 44 28 4 106 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q820K0 0.000267 44 29 2 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P10958 0.000397 43 22 1 168 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
Q6LTM2 0.000404 44 31 0 70 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Photobacterium profundum (strain SS9)
P52934 0.000406 43 25 1 116 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
A7N6S2 0.000443 44 25 3 116 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q15RF6 0.000473 43 30 0 66 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5JF95 0.000577 43 26 1 106 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9KA55 0.000602 43 27 2 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2WAJ8 0.000642 43 28 2 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P96126 0.000648 42 28 4 116 3 cheY Chemotaxis protein CheY Treponema pallidum (strain Nichols)
Q39S45 0.000711 43 23 5 163 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P62644 0.000745 43 28 5 147 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1IRH0 0.000746 43 24 2 147 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
Q65JK6 0.000777 43 36 0 69 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P0A4I0 0.000815 42 28 4 152 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P0A4H9 0.000815 42 28 4 152 3 dltR Transcriptional regulatory protein DltR Streptococcus agalactiae serotype III (strain NEM316)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18965
Feature type CDS
Gene citB
Product DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
Location 3672 - 4331 (strand: -1)
Length 660 (nucleotides) / 219 (amino acids)

Contig

Accession ZDB_710
Length 17998 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2094
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2197 Signal transduction mechanisms (T)
Transcription (K)		 TK DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains

Protein Sequence

MISVLVANSNEFYRAGIGAIITATPGMKMAGEVRDSTGAVRWCRDNHADVALLDIGFPVMSGLEAAKKITRYTSETKVIILTDEHSLISPYKVMNSGAAGYLYQSSDREDLLHAIRIISRGQRYVAPDIAQQTILDTRLHAHDSNPLDKLSHQERQVMVMIAQGIKVTQIADKMCLSSKTVNSYRYRIFNKLNINGDIKLTHLALRYGLIHIDSVVPDE

Flanking regions ( +/- flanking 50bp)

CCTTGTATAATTTACGGTAAATTTATTGAAAATTCAGAAAGGAGTTCTGTGTGATTTCAGTATTGGTGGCAAATTCGAATGAATTTTACCGTGCAGGGATTGGTGCCATTATCACGGCAACACCGGGTATGAAAATGGCGGGGGAGGTCAGGGACAGCACCGGTGCAGTGCGCTGGTGCCGTGATAATCATGCGGATGTGGCATTGCTTGATATCGGTTTTCCGGTGATGAGCGGCCTGGAAGCTGCAAAAAAAATCACCCGCTATACCTCAGAAACCAAAGTGATTATCCTGACAGATGAACACAGCCTGATCTCACCGTATAAAGTGATGAACAGCGGTGCGGCGGGGTATTTGTATCAGAGCAGTGACCGTGAGGATTTACTGCACGCCATCCGGATTATCAGCCGGGGCCAGCGCTATGTGGCACCGGATATCGCCCAGCAGACCATTCTTGACACCCGCCTGCATGCACATGACAGCAATCCGCTGGATAAACTGAGTCACCAGGAGCGCCAGGTGATGGTTATGATAGCGCAGGGCATCAAAGTCACACAAATTGCCGACAAAATGTGTCTCAGCAGCAAGACGGTGAACAGTTATAGATATAGAATATTTAATAAGCTGAATATTAATGGTGATATTAAACTCACCCATCTGGCACTGCGCTACGGACTGATCCATATTGACAGCGTGGTGCCGGATGAATGAATAAACACTGAGAGCAGAGAGTTTGTACCCTGTATGGAAAAAGCGGTTGT