Homologs in group_415

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05290 FBDBKF_05290 86.6 Morganella morganii S1 oppB oligopeptide ABC transporter permease OppB
EHELCC_12300 EHELCC_12300 86.6 Morganella morganii S2 oppB oligopeptide ABC transporter permease OppB
NLDBIP_12640 NLDBIP_12640 86.6 Morganella morganii S4 oppB oligopeptide ABC transporter permease OppB
LHKJJB_12500 LHKJJB_12500 86.6 Morganella morganii S3 oppB oligopeptide ABC transporter permease OppB
HKOGLL_11115 HKOGLL_11115 86.6 Morganella morganii S5 oppB oligopeptide ABC transporter permease OppB
F4V73_RS05745 F4V73_RS05745 85.6 Morganella psychrotolerans oppB oligopeptide ABC transporter permease OppB

Distribution of the homologs in the orthogroup group_415

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_415

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AFH5 0.0 536 86 0 306 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 0.0 536 86 0 306 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 0.0 536 86 0 306 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 0.0 536 86 0 306 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P08005 0.0 536 85 0 306 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45054 2.1e-175 489 76 0 306 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P24138 1.99e-94 285 48 1 305 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P26903 1.35e-82 254 42 1 305 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
P42062 5.23e-65 209 36 4 319 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
A0A0H2ZGW7 1.13e-63 207 35 4 335 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
A2RI75 1.32e-61 200 36 2 282 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
Q8FJK9 2.02e-60 197 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3Z3V2 8.11e-60 196 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q32IB7 1.05e-59 196 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 1.05e-59 196 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 1.05e-59 196 34 3 308 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 1.05e-59 196 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 1.05e-59 196 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8X6V7 1.8e-59 195 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q0T6D1 4.17e-59 194 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q83S26 8.86e-59 193 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q323W3 1.36e-58 193 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q2YJK1 5.22e-58 191 35 3 314 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 5.22e-58 191 35 3 314 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8YDG7 6.45e-58 191 35 3 314 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8Z862 9.25e-58 191 33 3 308 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 9.25e-58 191 33 3 308 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q8ZQM2 1.84e-57 190 33 3 308 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PGP5 2.52e-57 189 33 3 308 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8FUX0 4.25e-57 189 35 3 314 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
Q53191 3.62e-56 187 35 4 311 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P45096 4.67e-56 187 34 5 335 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEF8 1.16e-55 186 32 4 338 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 1.16e-55 186 32 4 338 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 1.16e-55 186 32 4 338 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
Q6D3B1 6.04e-55 183 34 3 308 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FWN8 2.66e-54 182 31 3 319 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
Q8YBN9 7.05e-54 181 31 3 319 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 7.05e-54 181 31 3 319 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
P94311 7.92e-54 181 35 5 335 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P33591 2.51e-50 172 33 3 310 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
P0A4N8 6.02e-46 160 34 4 319 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 6.02e-46 160 34 4 319 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
P66967 5.01e-40 145 32 6 285 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 5.01e-40 145 32 6 285 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 5.01e-40 145 32 6 285 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AFU0 5.52e-40 146 27 5 362 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 5.52e-40 146 27 5 362 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
Q2YXY7 6.4e-39 142 28 6 312 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A5Q6 6.82e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 6.82e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG38 7.41e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 7.41e-39 142 27 6 311 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 7.41e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q8NWT4 7.73e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 7.73e-39 142 27 6 311 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q6GH25 4.21e-38 140 27 4 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
A9CKL3 1.12e-36 137 26 6 360 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2FVE8 9.9e-36 134 28 4 311 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3K104 3.38e-35 132 27 4 311 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0AGH3 2.25e-31 122 30 3 259 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 2.25e-31 122 30 3 259 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
P77308 3.05e-31 122 31 6 316 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
P75554 1.38e-24 105 24 3 298 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P0A2J3 2.04e-24 103 30 5 260 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 2.04e-24 103 30 5 260 3 sapB Peptide transport system permease protein SapB Salmonella typhi
P47323 2.21e-24 105 25 7 316 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P45286 8.41e-19 88 24 4 274 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A4M8 8.79e-18 86 30 5 221 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 8.79e-18 86 30 5 221 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P94312 0.000328 45 24 9 226 3 dppC Dipeptide transport system permease protein DppC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8YDG8 0.000748 44 23 8 234 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 0.000748 44 23 8 234 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 0.000748 44 23 8 234 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07135
Feature type CDS
Gene oppB
Product oligopeptide ABC transporter permease OppB
Location 1557637 - 1558557 (strand: -1)
Length 921 (nucleotides) / 306 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_415
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF19300 Binding-prot-dependent transport system membrane comp, N-term

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0601 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15581 oligopeptide transport system permease protein beta-Lactam resistance
ABC transporters
Quorum sensing
-

Protein Sequence

MLKFIFRRFLEAIPTLFILITISFFMMRLAPGSPFTGERKLPPEVMANIEAKYHLNDPIYKQYFDYLIQLSKGDLGPSFKYKDYSVNTLVGKAFPVSAKLGLSAFVLAVIFGVGAGVIAALNQNTKWDYTVMTFAMTGVVIPSFVVAPLLVLIFAITLRWLPAGGWNGGQIQYMLLPMVALSLSYIASISRITRSSMIEVLHSNFIRTAKAKGLPMKRIVLRHALKPALLPVISYMGPAFVGIITGSMVIETIFGLPGIGQLFVNGALNRDYSLVLSLTIIVGGLTILFNAIVDILYAVIDPKIRY

Flanking regions ( +/- flanking 50bp)

AGGTCTTTTTATCACCACGCCTGAATAGGTTTGTGTTATAGGAACGGGCAATGCTCAAATTTATTTTTCGTCGCTTTTTGGAAGCGATCCCGACACTTTTTATTCTAATAACGATTTCGTTCTTTATGATGCGCTTAGCGCCGGGTAGCCCTTTTACTGGGGAAAGGAAATTACCCCCTGAAGTTATGGCCAACATCGAAGCGAAATATCATTTAAACGATCCCATTTACAAACAATACTTCGATTATTTAATTCAATTATCGAAAGGGGATTTAGGGCCTTCTTTTAAATATAAAGACTACAGTGTTAACACTTTAGTCGGTAAAGCATTCCCTGTTTCTGCAAAATTAGGGCTATCGGCCTTTGTATTAGCGGTTATTTTTGGTGTGGGGGCAGGCGTGATAGCCGCACTGAATCAAAATACCAAATGGGATTATACCGTCATGACATTTGCCATGACGGGGGTTGTGATACCGAGCTTTGTGGTGGCGCCACTATTAGTGCTTATCTTTGCGATTACCTTACGTTGGTTACCGGCGGGAGGTTGGAATGGTGGGCAAATTCAGTACATGTTACTGCCGATGGTTGCATTATCGCTCTCCTACATTGCAAGTATTTCGCGTATCACACGTAGTTCTATGATTGAAGTTTTACACTCAAACTTTATCAGAACGGCCAAAGCTAAAGGCTTACCAATGAAACGCATAGTGCTACGTCATGCGTTAAAACCAGCATTACTGCCAGTGATCTCTTATATGGGGCCGGCATTTGTGGGGATTATTACAGGCTCTATGGTCATTGAAACCATTTTTGGATTACCGGGTATTGGTCAACTTTTCGTTAATGGTGCATTAAATCGAGACTACTCATTGGTATTGAGTTTAACCATTATTGTGGGTGGTTTAACCATTTTATTTAATGCCATTGTTGATATTTTATACGCCGTAATCGATCCGAAAATTCGTTATTAATAGAGACTGGAGCACGTTATGTTATCGATGAAAGAAAATAGCGAAGCTCT