Homologs in group_2480

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20010 FBDBKF_20010 60.8 Morganella morganii S1 fimA type 1 fimbrial major subunit FimA
EHELCC_03520 EHELCC_03520 60.8 Morganella morganii S2 fimA type 1 fimbrial major subunit FimA
NLDBIP_03520 NLDBIP_03520 60.8 Morganella morganii S4 fimA type 1 fimbrial major subunit FimA
LHKJJB_09350 LHKJJB_09350 60.8 Morganella morganii S3 fimA type 1 fimbrial major subunit FimA
HKOGLL_09625 HKOGLL_09625 60.8 Morganella morganii S5 fimA type 1 fimbrial major subunit FimA

Distribution of the homologs in the orthogroup group_2480

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2480

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37921 1.27e-53 172 48 3 190 1 fimA Type-1 fimbrial protein, A chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55223 2.4e-50 163 54 2 161 3 None Fimbrial subunit type 1 Salmonella typhimurium
P37920 1.55e-49 161 47 4 190 3 fimA Type-1 fimbrial protein, A chain Salmonella typhi
P12903 1.78e-41 140 48 5 188 1 fim Fimbrial subunit type 1 Klebsiella pneumoniae
P62605 9.73e-41 139 44 3 185 3 pilC Type-1 fimbrial protein, C chain Escherichia coli
P62606 9.73e-41 139 44 3 185 3 pilC Type-1 fimbrial protein, C chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABW5 2.82e-40 137 50 1 163 2 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli (strain K12)
P0ABW6 2.82e-40 137 50 1 163 3 sfmA Uncharacterized fimbrial-like protein SfmA Escherichia coli O157:H7
Q47223 4.8e-38 132 45 5 190 1 fimA Type-1 fimbrial protein, A chain Escherichia coli
P12730 2.51e-36 127 42 2 185 1 sfaA S-fimbrial protein subunit SfaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P04128 6.29e-34 121 45 3 159 1 fimA Type-1 fimbrial protein, A chain Escherichia coli (strain K12)
P12266 1.15e-32 118 45 3 161 1 None Fimbrial subunit type 1 Klebsiella pneumoniae
P43660 3.22e-30 112 39 2 181 3 lpfA Long polar fimbria protein A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5K5 9.28e-29 108 39 2 181 2 lpfA Probable major fimbrial subunit LpfA Escherichia coli O157:H7
P39264 1.84e-25 99 31 3 185 1 fimI Fimbrin-like protein FimI Escherichia coli (strain K12)
P22595 1.95e-22 92 41 7 173 3 fimA Type-1 fimbrial protein subunit Serratia marcescens
Q08456 7.67e-22 90 28 3 182 5 fimI Putative fimbrin-like protein FimI Salmonella typhi
P37922 1.03e-19 84 26 3 182 3 fimI Fimbrin-like protein FimI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P08189 7.45e-16 74 31 3 155 1 fimF Protein FimF Escherichia coli (strain K12)
P13421 8e-15 72 34 7 188 1 smfA Fimbria A protein Serratia marcescens
P77789 8.05e-14 69 29 4 157 3 ydeS Uncharacterized fimbrial-like protein YdeS Escherichia coli (strain K12)
P38052 2.87e-13 67 31 5 155 2 sfmF Uncharacterized fimbrial-like protein SfmF Escherichia coli (strain K12)
P75859 3.06e-13 67 29 5 187 2 ycbU Uncharacterized fimbrial-like protein YcbU Escherichia coli (strain K12)
P43664 4.1e-13 67 31 4 173 3 lpfE Protein LpfE Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P13429 5.1e-13 67 27 4 185 1 sfaG S-fimbrial protein subunit SfaG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q03011 1.06e-12 66 33 6 184 1 mrpA Major MR/P fimbria protein Proteus mirabilis (strain HI4320)
P37926 2.44e-12 65 27 6 185 3 fimF Fimbrial-like protein FimF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q04681 9.72e-12 63 32 5 158 1 pmfA Major fimbrial subunit Proteus mirabilis (strain HI4320)
P62607 2.7e-11 62 29 7 196 3 F7-2 F7-2 fimbrial protein Escherichia coli
P62608 2.7e-11 62 29 7 196 3 F7-2 F7-2 fimbrial protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42913 3.12e-11 62 32 9 187 2 yraH Uncharacterized fimbrial-like protein YraH Escherichia coli (strain K12)
Q8X582 9.25e-11 61 28 6 187 1 elfA Laminin-binding fimbrial subunit ElfA Escherichia coli O157:H7
P04740 1.57e-10 60 30 8 195 3 KS71A KS71A fimbrillin Escherichia coli
P37909 4.03e-10 59 31 11 199 1 ybgD Uncharacterized fimbrial-like protein YbgD Escherichia coli (strain K12)
P75855 6.75e-10 58 27 6 187 1 elfA Fimbrial subunit ElfA Escherichia coli (strain K12)
P42184 6.89e-10 58 29 5 165 1 prsA PRS fimbrial major pilin protein (Fragment) Escherichia coli
Q8X5L0 2.15e-09 57 30 5 184 2 lpfE Probable fimbrial subunit LpfE Escherichia coli O157:H7
P45992 6.3e-09 56 29 4 163 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
P39834 4.49e-08 53 29 5 171 3 ygiL Uncharacterized fimbrial-like protein YgiL Escherichia coli (strain K12)
P11312 2.56e-07 51 30 5 169 3 F17a-A F17 fimbrial protein Escherichia coli
P21413 1.19e-06 50 29 5 137 3 fasA Fimbrial protein 987P Escherichia coli
P04127 1.56e-06 49 29 8 199 1 papA Pap fimbrial major pilin protein Escherichia coli
P45993 2.82e-05 46 29 3 120 3 hifD Minor fimbrial subunit HifD Haemophilus influenzae
P53521 4.32e-05 45 23 5 188 3 pmfF Putative minor fimbrial subunit PmfF Proteus mirabilis (strain HI4320)
Q03846 0.000237 43 24 7 219 3 hifA Major fimbrial subunit Haemophilus influenzae

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07110
Feature type CDS
Gene fimA
Product type 1 fimbrial major subunit FimA
Location 1552778 - 1553338 (strand: -1)
Length 561 (nucleotides) / 186 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2480
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00419 Fimbrial protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3539 Cell motility (N) N Pilin (type 1 fimbrial protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07352 type 1 fimbrial protein - -

Protein Sequence

MLKKKMLVKALFTVSVLSLSGVASAATIVNGGKINFTGEIVNAACVVSTKSIDQTVNIGQYRTAQFDSVGKTVGNTDFYINLEACDTTVAQNASVSFSGVSDSNDKTVLAVSNITTGGAGAATGVGIEITDHTGKVLPPDGSVFSTAKQLIDGSNTLNFVARYKSTLDTVTPGHADADVTFKMQYE

Flanking regions ( +/- flanking 50bp)

ATAAGTGAAGTTGTTGTGTATATTTACCTGTAATGTAAAAGGAAAAGTCAATGCTTAAAAAAAAGATGTTAGTTAAAGCTCTATTTACAGTATCTGTTTTATCACTGAGCGGTGTTGCTTCTGCAGCGACTATTGTTAATGGTGGTAAAATTAATTTTACTGGAGAAATTGTTAATGCTGCATGTGTTGTTAGTACAAAATCAATAGATCAAACTGTTAATATTGGACAATATCGTACCGCACAATTTGATAGTGTAGGGAAAACAGTTGGTAATACTGATTTTTATATCAATTTAGAAGCTTGTGATACGACTGTCGCACAAAATGCCTCAGTTTCATTTTCAGGTGTAAGTGATTCAAATGATAAAACAGTATTAGCTGTAAGCAATATTACAACAGGTGGTGCGGGTGCTGCGACGGGCGTTGGTATTGAAATTACAGACCATACAGGAAAAGTGTTACCACCAGACGGCTCTGTTTTTTCTACAGCAAAACAGTTAATTGATGGATCAAATACACTTAACTTTGTTGCACGTTATAAATCTACATTAGATACCGTTACCCCTGGTCATGCTGATGCTGATGTAACTTTCAAAATGCAATATGAATAAATAAATTGGATTAATTTAAAGTATGACCTGATAAAGGTCATACTTTTATA