Homologs in group_927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05035 FBDBKF_05035 69.2 Morganella morganii S1 rsxC electron transport complex subunit RsxC
EHELCC_12555 EHELCC_12555 69.2 Morganella morganii S2 rsxC electron transport complex subunit RsxC
NLDBIP_12895 NLDBIP_12895 69.2 Morganella morganii S4 rsxC electron transport complex subunit RsxC
LHKJJB_12755 LHKJJB_12755 69.2 Morganella morganii S3 rsxC electron transport complex subunit RsxC
HKOGLL_11370 HKOGLL_11370 69.2 Morganella morganii S5 rsxC electron transport complex subunit RsxC
F4V73_RS05475 F4V73_RS05475 66.7 Morganella psychrotolerans rsxC electron transport complex subunit RsxC

Distribution of the homologs in the orthogroup group_927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5Z463 0.0 773 57 10 836 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58324 0.0 762 58 9 787 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7
Q83RB9 0.0 761 58 10 789 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri
Q0T4E8 0.0 761 58 10 789 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri serotype 5b (strain 8401)
Q32FE4 0.0 760 57 10 836 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella dysenteriae serotype 1 (strain Sd197)
Q1CIY9 0.0 759 66 4 588 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8U6 0.0 759 66 4 588 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Angola)
Q1C7K3 0.0 757 66 4 588 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Antiqua)
A1JM81 0.0 757 67 2 545 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FHZ3 0.0 756 66 3 559 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JKN4 0.0 755 66 3 559 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B2K4K0 0.0 754 66 3 559 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B7URX0 0.0 750 58 9 787 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NU04 0.0 749 59 11 789 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7NB83 0.0 749 58 9 787 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8GE00 0.0 749 62 8 714 3 rnfC Ion-translocating oxidoreductase complex subunit C Serratia proteamaculans (strain 568)
Q0THJ8 0.0 747 58 10 794 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FH95 0.0 747 58 10 788 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A0H2 0.0 746 57 9 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O9:H4 (strain HS)
Q1RBG7 0.0 745 59 8 747 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain UTI89 / UPEC)
B7MVA7 0.0 745 59 8 747 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O81 (strain ED1a)
B7M9Y3 0.0 745 59 8 747 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O45:K1 (strain S88 / ExPEC)
B1IQC5 0.0 744 57 10 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZM89 0.0 744 57 9 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O139:H28 (strain E24377A / ETEC)
P77611 0.0 744 57 10 769 1 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12)
B1XFU1 0.0 744 57 10 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / DH10B)
C4ZY92 0.0 744 57 10 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / MC4100 / BW2952)
Q3Z1Y4 0.0 744 57 9 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella sonnei (strain Ss046)
B6IB67 0.0 743 57 9 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SE11)
A1ABH4 0.0 743 59 8 747 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O1:K1 / APEC
B7LQP1 0.0 741 58 10 688 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7M0I6 0.0 740 58 8 729 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O8 (strain IAI1)
B7L5I2 0.0 740 58 8 729 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain 55989 / EAEC)
B1LEQ7 0.0 739 59 7 705 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SMS-3-5 / SECEC)
B5XWP9 0.0 738 58 10 770 3 rnfC Ion-translocating oxidoreductase complex subunit C Klebsiella pneumoniae (strain 342)
Q320Y6 0.0 736 57 10 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 4 (strain Sb227)
B5FIE7 0.0 732 58 8 691 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella dublin (strain CT_02021853)
A8AH10 0.0 731 58 12 749 3 rnfC Ion-translocating oxidoreductase complex subunit C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B4TV17 0.0 730 56 12 716 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella schwarzengrund (strain CVM19633)
B2U2C8 0.0 730 58 9 729 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MRW8 0.0 721 56 10 709 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZPM2 0.0 720 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q508 0.0 719 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi C (strain RKS4594)
B4T594 0.0 718 56 15 792 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella newport (strain SL254)
B4THD4 0.0 716 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella heidelberg (strain SL476)
A9N025 0.0 716 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5F6J0 0.0 716 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella agona (strain SL483)
A7MMK9 0.0 716 58 11 773 3 rnfC Ion-translocating oxidoreductase complex subunit C Cronobacter sakazakii (strain ATCC BAA-894)
Q57PI0 0.0 715 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella choleraesuis (strain SC-B67)
B5BKB2 0.0 715 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain AKU_12601)
Q5PIB9 0.0 715 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C6DH15 0.0 714 64 3 550 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5RAK2 0.0 713 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QV02 0.0 712 63 2 532 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella enteritidis PT4 (strain P125109)
Q6D4W2 0.0 695 61 9 662 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VEQ3 0.0 674 60 3 568 3 rnfC Ion-translocating oxidoreductase complex subunit C Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BDE7 0.0 645 61 3 526 3 rnfC Ion-translocating oxidoreductase complex subunit C Edwardsiella ictaluri (strain 93-146)
P71397 0.0 624 54 6 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CNP2 0.0 622 54 5 551 3 rnfC Ion-translocating oxidoreductase complex subunit C Pasteurella multocida (strain Pm70)
Q65U33 0.0 618 52 6 585 3 rnfC Ion-translocating oxidoreductase complex subunit C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QJQ6 0.0 616 54 6 561 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain 86-028NP)
A5UBJ0 0.0 615 54 6 561 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain PittEE)
A6VQ42 0.0 581 51 5 562 3 rnfC Ion-translocating oxidoreductase complex subunit C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VNT4 0.0 563 49 5 562 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0A0H3AJC2 1.92e-173 523 46 9 670 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KT88 2.09e-173 523 45 9 678 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9HYB8 4.16e-136 426 49 3 457 3 rnfC Ion-translocating oxidoreductase complex subunit C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q89AW8 2.59e-107 342 38 8 472 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P57215 4.29e-106 338 41 8 442 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
D8GR66 3.07e-104 332 41 7 436 2 rnfC Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)
D5ARZ1 2.16e-95 311 37 5 458 3 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q52716 2.16e-95 311 37 5 458 1 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus
H6LC32 6.2e-87 286 39 6 434 1 rnfC Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q8TSY4 3.08e-32 134 28 11 446 1 rnfC Ion-translocating oxidoreductase complex subunit C Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9XDM9 3.1e-25 113 28 8 314 1 pduS Cobalamin reductase PduS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1VB77 6.99e-22 103 29 8 317 1 pduS Cobalamin reductase PduS Citrobacter freundii
A6MMR2 5.62e-05 45 35 1 64 3 psaC Photosystem I iron-sulfur center Dioscorea elephantipes
P49477 0.000166 44 32 1 67 3 psaC Photosystem I iron-sulfur center Trieres chinensis
Q8M9U0 0.000219 43 34 2 67 3 psaC Photosystem I iron-sulfur center Chaetosphaeridium globosum
A0T0W4 0.000221 43 32 1 67 3 psaC Photosystem I iron-sulfur center Thalassiosira pseudonana
O96804 0.000221 43 32 1 67 3 psaC Photosystem I iron-sulfur center Skeletonema costatum
Q0MQI6 0.000229 48 31 6 145 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Pan troglodytes
A4GGE7 0.000261 43 34 1 64 3 psaC Photosystem I iron-sulfur center Phaseolus vulgaris
P10793 0.000261 43 34 1 64 1 psaC Photosystem I iron-sulfur center Pisum sativum
P42046 0.000261 43 34 1 64 1 psaC Photosystem I iron-sulfur center Cucumis sativus
P49821 0.000272 48 31 6 145 1 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Homo sapiens
Q2JWZ0 0.000276 43 32 1 67 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain JA-3-3Ab)
A7M9B0 0.000282 43 34 2 64 3 psaC Photosystem I iron-sulfur center Cuscuta reflexa
A8W3G7 0.000288 43 34 2 64 3 psaC Photosystem I iron-sulfur center Cuscuta exaltata
P10098 0.000361 43 34 1 64 1 psaC Photosystem I iron-sulfur center Spinacia oleracea
A0T0L2 0.000364 43 32 1 67 3 psaC Photosystem I iron-sulfur center Phaeodactylum tricornutum (strain CCAP 1055/1)
Q58132 0.000371 43 36 2 60 3 MJ0722 Uncharacterized ferredoxin MJ0722 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q85AC1 0.000372 43 34 2 64 2 psaC Photosystem I iron-sulfur center Anthoceros angustus
Q2JNW5 0.000381 43 32 1 64 3 psaC Photosystem I iron-sulfur center Synechococcus sp. (strain JA-2-3B'a(2-13))
Q3BAH7 0.000406 43 34 1 64 3 psaC Photosystem I iron-sulfur center Phalaenopsis aphrodite subsp. formosana
Q0MQI4 0.000426 47 30 6 142 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Pongo pygmaeus
P00194 0.000459 42 37 1 62 1 None Ferredoxin-1 Rhodospirillum rubrum
P58870 0.000461 43 34 2 64 3 psaC Photosystem I iron-sulfur center Psilotum nudum
Q91YT0 0.000498 47 28 4 138 1 Ndufv1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Mus musculus
Q85WU9 0.000508 43 34 1 64 3 psaC Photosystem I iron-sulfur center Pinus koraiensis
A6H5P3 0.000508 43 34 1 64 3 psaC Photosystem I iron-sulfur center Cycas taitungensis
Q1ACE8 0.000518 42 34 1 64 3 psaC Photosystem I iron-sulfur center Chara vulgaris
Q0ZIW7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Vitis vinifera
P62094 0.000523 42 34 1 64 1 psaC Photosystem I iron-sulfur center Nicotiana tabacum
Q2PMN3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Glycine max
Q2VEC9 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Solanum tuberosum
Q2MI49 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Solanum lycopersicum
Q2MID6 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Solanum bulbocastanum
A4GYW7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Populus trichocarpa
Q14FA7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Populus alba
Q09FZ5 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Platanus occidentalis
Q06GK6 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Piper cenocladum
Q06FQ3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Pelargonium hortorum
A4QJY3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Olimarabidopsis pumila
P62093 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Oenothera elata subsp. hookeri
Q6EVZ9 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Nymphaea alba
Q33BX1 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Nicotiana tomentosiformis
Q3C1Q3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Nicotiana sylvestris
A4QLY6 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Nasturtium officinale
Q09FQ9 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Nandina domestica
Q09WW7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Morus indica
P62092 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Lotus japonicus
A4QLP8 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Lobularia maritima
A4QLG0 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Lepidium virginicum
Q06R79 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Jasminum nudiflorum
A7Y3L3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Ipomoea purpurea
Q2L956 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Gossypium hirsutum
A0ZZ86 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Gossypium barbadense
Q49KU7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Eucalyptus globulus subsp. globulus
A4QL72 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Draba nemorosa
A4QKY5 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Crucihimalaya wallichii
A0A386 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Coffea arabica
Q09MC5 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Citrus sinensis
A4QKP6 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Capsella bursa-pastoris
Q7HKX2 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Calycanthus floridus var. glaucus
A6MM88 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Buxus microphylla
A4QKF8 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Barbarea verna
P62091 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Atropa belladonna
P62090 0.000523 42 34 1 64 1 psaC Photosystem I iron-sulfur center Arabidopsis thaliana
Q70XW3 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Amborella trichopoda
A4QJQ1 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Aethionema grandiflorum
A4QJG7 0.000523 42 34 1 64 3 psaC Photosystem I iron-sulfur center Aethionema cordifolium
Q332S6 0.000583 42 34 1 64 3 psaC Photosystem I iron-sulfur center Lactuca sativa
Q1KXQ4 0.000583 42 34 1 64 3 psaC Photosystem I iron-sulfur center Helianthus annuus
P00211 0.000619 42 38 2 55 1 None Ferredoxin-2 Desulfomicrobium norvegicum (strain DSM 1741 / NCIMB 8310)
Q3V4Y3 0.000643 42 34 1 64 3 psaC Photosystem I iron-sulfur center Acorus calamus
Q8THW2 0.000656 47 30 4 112 3 cdhA3 Acetyl-CoA decarbonylase/synthase complex subunit alpha 3 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B2Y205 0.000662 42 35 2 68 3 psaC Photosystem I iron-sulfur center Welwitschia mirabilis
A6MMZ6 0.000689 42 34 1 64 3 psaC Photosystem I iron-sulfur center Illicium oligandrum
O07112 0.00073 42 31 1 67 3 psaC Photosystem I iron-sulfur center Mastigocladus laminosus
A4QK71 0.000798 42 34 1 64 3 psaC Photosystem I iron-sulfur center Arabis hirsuta
Q8TJC6 0.000819 47 30 4 112 3 cdhA2 Acetyl-CoA decarbonylase/synthase complex subunit alpha 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P56301 0.000821 42 32 1 67 3 psaC Photosystem I iron-sulfur center Chlorella vulgaris
Q0G9G8 0.000838 42 34 1 64 3 psaC Photosystem I iron-sulfur center Liriodendron tulipifera
Q5SCZ7 0.000838 42 32 2 64 3 psaC Photosystem I iron-sulfur center Huperzia lucidula
Q1KVW1 0.000846 42 31 1 64 3 psaC Photosystem I iron-sulfur center Tetradesmus obliquus
Q8HXQ9 0.00085 46 30 6 142 2 NDUFV1 NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial Macaca fascicularis
O19905 0.00088 42 32 1 64 3 psaC Photosystem I iron-sulfur center Cyanidium caldarium
A2T384 0.001 42 34 2 64 3 psaC Photosystem I iron-sulfur center Angiopteris evecta
Q85FH4 0.001 42 34 2 64 2 psaC Photosystem I iron-sulfur center Adiantum capillus-veneris

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06300
Feature type CDS
Gene rsxC
Product electron transport complex subunit RsxC
Location 1380196 - 1382715 (strand: 1)
Length 2520 (nucleotides) / 839 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01512 Respiratory-chain NADH dehydrogenase 51 Kd subunit
PF10531 SLBB domain
PF12838 4Fe-4S dicluster domain
PF13375 RnfC Barrel sandwich hybrid domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4656 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03615 H+/Na+-translocating ferredoxin:NAD+ oxidoreductase subunit C [EC:7.1.1.11 7.2.1.2] - -

Protein Sequence

MFNLFSLFKKDKIWDFKGGIHPPEMKLQSSRTPMRIAQLPDEVTIPIHQHLGTPGQLCVKVGDHVLKGQALTRGVGRTLPVHASISGTVTAIEPFPSTHPSGLPEIAVKIVSDGKDEWREKSPLVDYQSQSKEVLLTRIHEAGIAGLGGAGFPTATKLKGGGDLVKTLIINAAECEPYITADDRLMQEHADEVIAGCQILMHILSPDEVLIGIEDNKPEAIAALKQALAALTNEKRIFIRVIPTKYPSGGAKQLTKILTGKEVPSGGRSSDIGVLMQNVGTVVAIKRAIIDDEPLIERVVTVTGQGAKTPGNFWARLGTPIYALIKQAGFVAGSEQMVIMGGPLMGFTLPDLNAPVIKITNCLLIPSPEEMDTDNIEEACIRCGQCVDACPSGLLPQQLYWFSKGKEHEKAQQHNLFDCIECGACAFVCPSNIPLVQYYRQEKAEIREIDAEAKRAAEAKARFEAKKIRMEREKLEREARHQRAAVKLDDHQQNEVQSALSRVKEKHSIGKIIAVKAGEQPDNAAAIAARKKRKEEARAKQAAKLAQQVPQNTHTTADAESDPRKAAVAAALARVKAKKAQQAQATTKVDTPAETQAEVETDPRKAAVAAALARVKAKKAQQAQATAKVDTPTETPADAELEIDPRKAAVAAAIARVKAKKSQQAQATAKVDTPAETQAEVETDPRKAAVTAALARVKAKKAQQAQATAKVDTPTETPADAELEIDPRKAAVAAAIARVKAKKSQQTQATAKVDTPAESPAEVETDPRKAAVAAAIARVKAKKSQQAQATAKVDTPAETPADAEVETDPRKAAVAAAIARVKAKKEAQQRHAKEEVTLD

Flanking regions ( +/- flanking 50bp)

AGAAGAAACACCCGAAGATGAACCGTCATTAAAGACGGAGGATAACGCTCATGTTTAATCTCTTTTCGTTATTTAAAAAAGATAAAATTTGGGATTTTAAAGGCGGCATTCATCCTCCCGAAATGAAATTACAATCAAGTCGCACGCCTATGCGTATAGCCCAGTTACCGGATGAGGTTACCATCCCTATTCATCAACACTTAGGTACTCCTGGGCAACTTTGCGTTAAAGTGGGTGATCATGTTTTAAAAGGCCAAGCCTTAACTCGTGGTGTAGGAAGAACATTACCCGTTCATGCTTCTATATCAGGTACGGTCACGGCAATAGAGCCATTTCCAAGCACTCACCCTTCTGGTCTGCCTGAAATTGCAGTGAAAATTGTCTCTGATGGTAAAGACGAATGGCGAGAAAAATCACCACTAGTTGACTATCAATCACAAAGTAAAGAAGTATTGCTTACCCGTATTCATGAAGCAGGCATTGCTGGATTAGGGGGAGCGGGTTTTCCAACAGCCACAAAATTAAAAGGTGGTGGTGATTTAGTTAAAACGCTCATCATAAATGCCGCTGAATGTGAGCCTTATATCACAGCTGATGACAGACTTATGCAAGAGCACGCAGATGAAGTTATTGCGGGTTGTCAGATATTAATGCATATACTGTCACCGGATGAAGTGCTGATTGGTATTGAAGATAACAAACCTGAAGCTATTGCCGCCTTAAAACAAGCATTAGCAGCACTCACAAATGAAAAACGTATTTTTATTCGGGTGATCCCTACCAAATATCCATCTGGAGGCGCTAAACAGTTAACCAAAATATTAACGGGCAAAGAAGTTCCTTCTGGCGGTCGCTCCTCTGATATTGGCGTATTAATGCAAAATGTGGGGACGGTAGTGGCAATTAAACGTGCCATTATCGATGATGAACCTTTAATTGAACGTGTCGTCACCGTAACTGGACAAGGGGCTAAAACCCCAGGTAACTTTTGGGCACGTTTAGGTACTCCTATTTATGCACTTATAAAACAAGCAGGCTTTGTTGCTGGCTCTGAGCAGATGGTCATTATGGGGGGGCCTTTAATGGGCTTCACCTTACCTGACTTAAATGCCCCCGTTATAAAAATTACTAACTGCTTATTAATTCCCTCTCCAGAAGAGATGGATACAGATAATATTGAAGAAGCCTGTATCCGTTGTGGTCAATGTGTTGACGCCTGCCCTAGTGGTTTACTACCACAACAACTTTACTGGTTTAGTAAAGGGAAAGAGCATGAGAAAGCGCAACAACATAATTTATTTGACTGCATTGAGTGCGGGGCTTGTGCTTTTGTCTGCCCTAGTAATATTCCATTAGTGCAATATTACCGCCAAGAAAAAGCAGAAATACGAGAAATTGATGCGGAAGCTAAGCGAGCGGCTGAAGCTAAGGCTCGCTTTGAAGCGAAAAAAATCCGTATGGAACGAGAAAAGCTTGAACGTGAGGCAAGACATCAACGTGCTGCAGTTAAGCTTGATGATCACCAACAAAATGAAGTGCAATCTGCACTTTCTCGTGTAAAAGAAAAACATAGCATTGGCAAAATTATTGCTGTTAAAGCAGGAGAACAACCTGACAACGCAGCGGCTATTGCTGCACGCAAAAAACGTAAAGAAGAAGCCCGAGCAAAACAAGCTGCTAAATTGGCACAACAGGTACCACAAAATACCCATACCACCGCCGATGCAGAAAGTGATCCGCGCAAAGCCGCTGTAGCGGCAGCATTAGCTCGTGTAAAAGCTAAGAAAGCTCAACAAGCGCAAGCAACTACAAAAGTAGACACTCCTGCTGAAACTCAGGCTGAGGTGGAAACCGATCCACGCAAAGCCGCTGTAGCGGCAGCATTGGCCCGCGTAAAAGCTAAGAAGGCTCAACAAGCGCAAGCAACCGCAAAAGTAGACACACCTACTGAAACTCCTGCTGATGCTGAGCTGGAAATCGATCCGCGTAAAGCTGCTGTGGCTGCTGCTATTGCTCGGGTAAAAGCTAAAAAATCCCAGCAAGCGCAAGCAACTGCAAAAGTAGACACTCCTGCTGAAACTCAGGCTGAGGTGGAAACCGATCCGCGCAAAGCTGCTGTAACCGCAGCATTGGCTCGGGTAAAAGCTAAGAAGGCTCAACAAGCACAGGCAACTGCAAAAGTAGACACACCTACTGAAACTCCTGCTGATGCTGAGCTGGAAATCGATCCGCGTAAAGCTGCTGTGGCTGCTGCTATTGCTCGGGTAAAAGCTAAAAAATCCCAGCAAACGCAAGCAACCGCAAAAGTAGACACACCCGCTGAATCTCCGGCTGAGGTGGAAACCGATCCACGTAAAGCTGCTGTGGCTGCTGCTATTGCCCGCGTAAAAGCTAAAAAATCTCAACAAGCACAGGCAACTGCAAAAGTAGACACACCCGCTGAAACTCCAGCTGATGCTGAGGTGGAAACCGATCCACGTAAAGCTGCTGTCGCCGCTGCTATTGCTCGGGTAAAAGCTAAAAAAGAAGCACAGCAACGCCATGCTAAAGAAGAAGTGACATTGGATTAATACAAATGAAATTTAGACCAATACAAAATAACAATAGCAAATTGAAAATC