Homologs in group_927

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05035 FBDBKF_05035 100.0 Morganella morganii S1 rsxC electron transport complex subunit RsxC
EHELCC_12555 EHELCC_12555 100.0 Morganella morganii S2 rsxC electron transport complex subunit RsxC
LHKJJB_12755 LHKJJB_12755 100.0 Morganella morganii S3 rsxC electron transport complex subunit RsxC
HKOGLL_11370 HKOGLL_11370 100.0 Morganella morganii S5 rsxC electron transport complex subunit RsxC
F4V73_RS05475 F4V73_RS05475 85.9 Morganella psychrotolerans rsxC electron transport complex subunit RsxC
PMI_RS06300 PMI_RS06300 69.2 Proteus mirabilis HI4320 rsxC electron transport complex subunit RsxC

Distribution of the homologs in the orthogroup group_927

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_927

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5Z463 0.0 771 62 8 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58324 0.0 768 61 8 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O157:H7
Q8FH95 0.0 764 61 7 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83RB9 0.0 763 60 7 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri
Q0T4E8 0.0 763 60 7 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella flexneri serotype 5b (strain 8401)
B4TV17 0.0 763 60 12 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella schwarzengrund (strain CVM19633)
Q1CIY9 0.0 762 65 2 593 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8U6 0.0 762 65 2 593 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Angola)
Q0THJ8 0.0 761 61 7 752 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7URX0 0.0 761 61 7 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1C7K3 0.0 760 65 2 593 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pestis bv. Antiqua (strain Antiqua)
A1JM81 0.0 760 67 2 560 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JKN4 0.0 758 67 0 542 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FHZ3 0.0 758 67 0 542 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B7LQP1 0.0 757 62 7 677 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NB83 0.0 757 61 7 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5FIE7 0.0 757 60 10 733 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella dublin (strain CT_02021853)
B2K4K0 0.0 757 67 0 542 3 rnfC Ion-translocating oxidoreductase complex subunit C Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1RBG7 0.0 756 61 6 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain UTI89 / UPEC)
B7MVA7 0.0 756 61 6 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O81 (strain ED1a)
B7M9Y3 0.0 756 61 6 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LEQ7 0.0 756 62 5 693 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SMS-3-5 / SECEC)
B5XWP9 0.0 756 65 15 771 3 rnfC Ion-translocating oxidoreductase complex subunit C Klebsiella pneumoniae (strain 342)
B7NU04 0.0 755 61 8 769 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8AH10 0.0 754 60 9 731 3 rnfC Ion-translocating oxidoreductase complex subunit C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q32FE4 0.0 753 61 9 752 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella dysenteriae serotype 1 (strain Sd197)
A1ABH4 0.0 753 61 6 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O1:K1 / APEC
B4T594 0.0 753 60 12 772 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella newport (strain SL254)
A8A0H2 0.0 752 62 4 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O9:H4 (strain HS)
P77611 0.0 752 62 6 676 1 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12)
B1IQC5 0.0 752 62 6 676 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XFU1 0.0 752 62 6 676 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / DH10B)
C4ZY92 0.0 752 62 6 676 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain K12 / MC4100 / BW2952)
Q3Z1Y4 0.0 751 62 4 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella sonnei (strain Ss046)
A9MRW8 0.0 751 60 8 694 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7ZM89 0.0 751 62 4 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O139:H28 (strain E24377A / ETEC)
B6IB67 0.0 750 62 4 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain SE11)
B7M0I6 0.0 750 62 5 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli O8 (strain IAI1)
B7L5I2 0.0 750 62 5 638 3 rsxC Ion-translocating oxidoreductase complex subunit C Escherichia coli (strain 55989 / EAEC)
B4THD4 0.0 748 59 12 772 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella heidelberg (strain SL476)
Q320Y6 0.0 748 63 3 600 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 4 (strain Sb227)
B5F6J0 0.0 746 58 11 773 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella agona (strain SL483)
B2U2C8 0.0 746 64 2 565 3 rsxC Ion-translocating oxidoreductase complex subunit C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9N025 0.0 745 60 12 772 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BKB2 0.0 745 60 12 770 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain AKU_12601)
Q5PIB9 0.0 745 60 12 770 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5QV02 0.0 742 61 9 731 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella enteritidis PT4 (strain P125109)
Q8ZPM2 0.0 740 58 12 772 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5RAK2 0.0 739 62 7 693 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella gallinarum (strain 287/91 / NCTC 13346)
C0Q508 0.0 736 60 10 732 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella paratyphi C (strain RKS4594)
A8GE00 0.0 736 62 9 684 3 rnfC Ion-translocating oxidoreductase complex subunit C Serratia proteamaculans (strain 568)
Q57PI0 0.0 734 60 10 732 3 rsxC Ion-translocating oxidoreductase complex subunit C Salmonella choleraesuis (strain SC-B67)
C6DH15 0.0 720 64 3 601 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7MMK9 0.0 712 63 9 781 3 rnfC Ion-translocating oxidoreductase complex subunit C Cronobacter sakazakii (strain ATCC BAA-894)
Q6D4W2 0.0 707 62 6 657 3 rnfC Ion-translocating oxidoreductase complex subunit C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B2VEQ3 0.0 690 61 4 600 3 rnfC Ion-translocating oxidoreductase complex subunit C Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C5BDE7 0.0 633 63 2 514 3 rnfC Ion-translocating oxidoreductase complex subunit C Edwardsiella ictaluri (strain 93-146)
P71397 0.0 628 52 4 566 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65U33 0.0 620 52 4 561 3 rnfC Ion-translocating oxidoreductase complex subunit C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UBJ0 0.0 620 52 4 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain PittEE)
Q9CNP2 0.0 619 52 7 572 3 rnfC Ion-translocating oxidoreductase complex subunit C Pasteurella multocida (strain Pm70)
Q4QJQ6 0.0 619 52 4 564 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus influenzae (strain 86-028NP)
A6VQ42 0.0 584 52 2 509 3 rnfC Ion-translocating oxidoreductase complex subunit C Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VNT4 0.0 559 50 5 592 3 rnfC Ion-translocating oxidoreductase complex subunit C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0A0H3AJC2 0.0 555 51 11 670 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q9KT88 0.0 552 51 9 630 3 rnfC Ion-translocating oxidoreductase complex subunit C Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9HYB8 3.4e-131 411 50 3 454 3 rnfC Ion-translocating oxidoreductase complex subunit C Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P57215 4.15e-104 331 37 3 434 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
D8GR66 4.29e-99 317 39 7 431 2 rnfC Proton-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Clostridium ljungdahlii (strain ATCC 55383 / DSM 13528 / PETC)
Q89AW8 1.77e-97 315 35 4 446 3 rnfC Ion-translocating oxidoreductase complex subunit C Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
D5ARZ1 1.41e-95 310 41 5 436 3 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q52716 1.41e-95 310 41 5 436 1 rnfC Ion-translocating oxidoreductase complex subunit C Rhodobacter capsulatus
H6LC32 7.12e-88 287 38 6 444 1 rnfC Na(+)-translocating ferredoxin:NAD(+) oxidoreductase complex subunit C Acetobacterium woodii (strain ATCC 29683 / DSM 1030 / JCM 2381 / KCTC 1655 / WB1)
Q8TSY4 1.17e-32 135 30 18 449 1 rnfC Ion-translocating oxidoreductase complex subunit C Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9XDM9 5.44e-24 109 28 9 319 1 pduS Cobalamin reductase PduS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B1VB77 2.15e-18 92 28 9 311 1 pduS Cobalamin reductase PduS Citrobacter freundii
Q5WT28 8.7e-05 47 30 2 103 3 nuoI NADH-quinone oxidoreductase subunit I Legionella pneumophila (strain Lens)
Q5ZRU6 8.7e-05 47 30 2 103 3 nuoI NADH-quinone oxidoreductase subunit I Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHV5 8.96e-05 47 30 2 103 3 nuoI NADH-quinone oxidoreductase subunit I Legionella pneumophila (strain Corby)
Q5X1B5 8.96e-05 47 30 2 103 3 nuoI NADH-quinone oxidoreductase subunit I Legionella pneumophila (strain Paris)
P81292 0.000547 44 28 3 106 4 MJ0514.1 Uncharacterized polyferredoxin-like protein MJ0514.1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_12895
Feature type CDS
Gene rsxC
Product electron transport complex subunit RsxC
Location 166956 - 169298 (strand: -1)
Length 2343 (nucleotides) / 780 (amino acids)

Contig

Accession ZDB_527
Length 181446 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_927
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01512 Respiratory-chain NADH dehydrogenase 51 Kd subunit
PF10531 SLBB domain
PF12838 4Fe-4S dicluster domain
PF13375 RnfC Barrel sandwich hybrid domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4656 Energy production and conversion (C) C Na+-translocating ferredoxin:NAD+ oxidoreductase RNF, RnfC subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03615 H+/Na+-translocating ferredoxin:NAD+ oxidoreductase subunit C [EC:7.1.1.11 7.2.1.2] - -

Protein Sequence

MFNLLNFLKKDRVWDFDGGIHPPEMKLQSSRTPMRVCPVPEELIIPLQQHIGNEGDVLVSPGDHVLKGQPLTRGTGRSLPVHASSSGTVTAVEPCVTAHPSGLTAPCIRIRTDGLDTPYPAEKTTDFTSLSKTELTDRIHQAGIAGLGGAGFPTASKLKGGGDLIRTLIINAAECEPYITADDRLMQEHAGEILTGIRILMHLLEPEQVLIGIEDNKPEAIAALRDVTAGEKQIFVRVIPTKYPSGGAKQLTKILTGREVPSGGRSSDIGVLMQNVGTVVAIKRAITDGEPLIQRVVTVTGEAVESPGNFWTRLGTPVRFLLQQAGFRPQHEQMVVMGGPLMGFTLPDLDVPVVKICNCILAPTTNEMEPAAPEEACIRCSHCADACPAGLLPQQLYWFSKGNEHEKAEQHHLFDCIECGACAWVCPSNIPLVQYYRQEKAQVIEIREEAQRAADAKIRFEAKQARMAREKEAREARHKSAAVQVDEKDSAAISAALARVKAKDSNAGMTISVNPSVLPDNSAVIAAREARKAQARARQAEKAALAAETTQPATEADADPRKAAVAAALARAKAKKAAQAAEAPAEAAQPAAETDTDPRKAAVAAAIARAKAKKAAQAAEAPAEAAQPAAETETDPRKAAVAAAIARAKAKKAAQAAEAPAEAAQPAADAETDPRKAAVAAAIARAKAKKAAQTAEAPAEAAQPAADAETDPRKAAVAAAIARAKAKKAAQTAEAPAEAAQPAAEAETDPRKAAVAAAIARAKAKKAAQAAAQHSEETTD

Flanking regions ( +/- flanking 50bp)

ACCGGCGGTACTCCTGTCAAACCTGTTCAGATTGAGGCGTCGTAAGTTTTATGTTCAATTTGCTCAACTTTCTGAAAAAAGACCGGGTATGGGATTTTGACGGCGGCATTCATCCGCCGGAAATGAAATTACAGTCCAGCCGGACACCGATGCGGGTGTGCCCGGTACCGGAAGAACTGATTATTCCGCTCCAGCAGCATATCGGGAACGAAGGCGATGTGCTGGTCAGCCCCGGCGACCATGTCCTGAAAGGTCAGCCGCTGACACGCGGAACCGGCCGCAGCCTGCCGGTGCACGCCTCATCATCCGGCACGGTGACTGCCGTGGAGCCTTGTGTGACCGCGCATCCGTCCGGGCTGACCGCGCCGTGCATCCGTATCCGGACTGACGGGCTGGATACCCCGTACCCGGCGGAAAAAACAACGGATTTTACCTCTCTTTCCAAAACAGAGCTGACTGACCGCATTCATCAGGCCGGGATTGCCGGTCTCGGCGGCGCAGGCTTCCCGACCGCCAGCAAGCTGAAAGGCGGCGGTGATCTTATCCGCACTCTGATTATCAATGCGGCGGAATGTGAGCCCTATATCACGGCGGATGACCGTCTGATGCAGGAACATGCCGGGGAAATTCTCACCGGTATCCGTATTCTGATGCACCTTCTTGAGCCGGAACAGGTGCTTATCGGCATTGAAGATAATAAACCGGAGGCGATTGCCGCACTGCGTGACGTTACTGCCGGGGAAAAACAGATTTTCGTGCGGGTGATCCCGACCAAGTACCCGTCCGGCGGCGCCAAACAGCTGACCAAAATTCTCACCGGCCGCGAAGTACCATCCGGCGGACGCTCTTCTGATATCGGCGTGCTGATGCAGAACGTCGGAACTGTGGTTGCCATCAAGCGCGCCATTACCGACGGCGAACCGCTGATCCAGCGCGTGGTAACAGTAACCGGCGAAGCGGTTGAATCACCGGGTAACTTCTGGACACGACTCGGTACGCCGGTCCGTTTCCTGCTGCAACAGGCAGGTTTCCGTCCGCAGCATGAACAAATGGTTGTGATGGGCGGCCCGCTGATGGGCTTTACACTGCCTGATCTCGATGTGCCGGTGGTGAAAATCTGTAACTGCATTCTGGCACCAACCACGAACGAGATGGAACCAGCTGCACCGGAAGAAGCCTGTATCCGCTGCAGTCACTGTGCGGATGCCTGTCCTGCCGGATTACTGCCGCAACAGCTTTACTGGTTCAGTAAAGGTAATGAACACGAAAAAGCAGAACAGCACCATCTGTTTGACTGCATTGAATGCGGTGCCTGTGCCTGGGTCTGCCCGAGCAATATTCCGCTGGTGCAGTATTACCGTCAGGAAAAAGCACAGGTCATTGAGATCCGCGAAGAAGCCCAACGCGCCGCAGATGCCAAAATCCGCTTTGAAGCCAAACAGGCACGAATGGCACGGGAAAAAGAAGCCCGTGAAGCCCGCCATAAAAGCGCGGCTGTTCAGGTGGATGAGAAAGACAGTGCGGCTATCAGCGCCGCCCTTGCCCGCGTGAAAGCCAAAGACAGCAATGCAGGGATGACGATTTCTGTTAATCCGTCCGTTTTACCGGATAACAGCGCCGTGATTGCTGCCCGCGAAGCCCGTAAAGCACAGGCCCGCGCACGTCAGGCAGAAAAAGCGGCTCTCGCGGCTGAAACAACACAACCGGCGACAGAAGCAGACGCCGATCCGCGTAAAGCCGCAGTGGCTGCCGCCCTTGCCCGCGCCAAAGCGAAGAAAGCCGCTCAGGCTGCCGAAGCTCCGGCGGAAGCTGCACAACCGGCAGCGGAAACAGACACAGATCCGCGCAAAGCTGCTGTTGCTGCCGCCATTGCCCGCGCCAAAGCGAAGAAAGCGGCTCAGGCCGCAGAAGCTCCGGCGGAAGCTGCTCAACCGGCAGCGGAAACAGAGACAGATCCGCGCAAAGCTGCTGTTGCTGCCGCCATTGCCCGCGCCAAAGCGAAGAAAGCCGCTCAGGCTGCCGAAGCTCCGGCGGAAGCTGCTCAACCAGCCGCAGACGCAGAAACGGATCCGCGCAAAGCCGCTGTTGCTGCCGCCATTGCCCGCGCCAAAGCGAAGAAAGCCGCTCAGACTGCTGAAGCTCCGGCGGAAGCTGCTCAACCAGCCGCAGACGCAGAGACAGATCCGCGCAAAGCCGCTGTTGCTGCCGCCATTGCCCGCGCTAAAGCGAAAAAAGCCGCTCAGACTGCTGAAGCTCCGGCGGAAGCTGCTCAACCGGCAGCGGAAGCAGAGACAGATCCGCGCAAAGCCGCTGTCGCTGCCGCCATTGCCCGTGCCAAAGCGAAGAAAGCCGCTCAGGCCGCTGCACAACATTCTGAAGAAACCACTGATTAATGAAGCGAAATAAGCATGAAATTTAGGCCCGTTTCCTCAAACGCCCCGCA