Homologs in group_20

Help

18 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08070 FBDBKF_08070 69.6 Morganella morganii S1 bisC Anaerobic selenocysteine-containing dehydrogenase
FBDBKF_10450 FBDBKF_10450 44.6 Morganella morganii S1 dmsA dimethylsulfoxide reductase subunit A
EHELCC_13900 EHELCC_13900 69.6 Morganella morganii S2 bisC Anaerobic selenocysteine-containing dehydrogenase
EHELCC_14785 EHELCC_14785 44.6 Morganella morganii S2 dmsA dimethylsulfoxide reductase subunit A
NLDBIP_14345 NLDBIP_14345 69.6 Morganella morganii S4 bisC Anaerobic selenocysteine-containing dehydrogenase
NLDBIP_14615 NLDBIP_14615 44.6 Morganella morganii S4 dmsA dimethylsulfoxide reductase subunit A
LHKJJB_08505 LHKJJB_08505 69.6 Morganella morganii S3 bisC Anaerobic selenocysteine-containing dehydrogenase
LHKJJB_14730 LHKJJB_14730 44.6 Morganella morganii S3 dmsA dimethylsulfoxide reductase subunit A
LHKJJB_19940 LHKJJB_19940 63.5 Morganella morganii S3 - Anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family
HKOGLL_08055 HKOGLL_08055 69.6 Morganella morganii S5 bisC Anaerobic selenocysteine-containing dehydrogenase
HKOGLL_13350 HKOGLL_13350 44.6 Morganella morganii S5 dmsA dimethylsulfoxide reductase subunit A
F4V73_RS05070 F4V73_RS05070 85.3 Morganella psychrotolerans - DMSO/selenate family reductase complex A subunit
F4V73_RS12925 F4V73_RS12925 69.7 Morganella psychrotolerans - DMSO/selenate family reductase complex A subunit
F4V73_RS14150 F4V73_RS14150 44.2 Morganella psychrotolerans dmsA dimethylsulfoxide reductase subunit A
PMI_RS00825 PMI_RS00825 32.4 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase
PMI_RS08345 PMI_RS08345 41.0 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase
PMI_RS08900 PMI_RS08900 27.2 Proteus mirabilis HI4320 phsA thiosulfate reductase PhsA
PMI_RS14655 PMI_RS14655 72.2 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase

Distribution of the homologs in the orthogroup group_20

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_20

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P18775 0.0 614 43 16 797 1 dmsA Dimethyl sulfoxide reductase DmsA Escherichia coli (strain K12)
P45004 0.0 580 41 18 821 3 dmsA Dimethyl sulfoxide reductase DmsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77783 0.0 569 40 17 816 1 ynfF Probable dimethyl sulfoxide reductase chain YnfF Escherichia coli (strain K12)
P77374 0.0 568 40 19 823 1 ynfE Putative dimethyl sulfoxide reductase chain YnfE Escherichia coli (strain K12)
P44798 9.79e-91 306 31 25 747 1 torZ Trimethylamine-N-oxide reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P20099 3.87e-83 285 30 23 728 1 bisC Biotin sulfoxide reductase Escherichia coli (strain K12)
Q52675 2.24e-81 281 31 23 736 1 dorA Dimethyl sulfoxide/trimethylamine N-oxide reductase Rhodobacter capsulatus
P33225 1.4e-80 279 29 22 787 1 torA Trimethylamine-N-oxide reductase 1 Escherichia coli (strain K12)
Q57366 9.87e-80 276 29 23 741 1 dmsA Dimethyl sulfoxide/trimethylamine N-oxide reductase Cereibacter sphaeroides
P58360 3.6e-79 275 29 22 788 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O157:H7
Q8CW73 2.3e-78 273 28 22 787 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z2M4 7.8e-77 269 27 19 757 3 torA Trimethylamine-N-oxide reductase Salmonella typhi
Q8EHI9 1.37e-76 268 27 25 849 3 torA Trimethylamine-N-oxide reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8ZKZ7 2.12e-75 265 27 19 757 3 torA Trimethylamine-N-oxide reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O87948 3.23e-74 261 27 21 757 1 torA Trimethylamine-N-oxide reductase Shewanella massilia
Q8CVZ3 4.21e-73 258 29 26 735 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9CK41 2.82e-72 256 28 28 845 3 torA Trimethylamine-N-oxide reductase Pasteurella multocida (strain Pm70)
P46923 1.04e-71 254 29 25 734 1 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli (strain K12)
P58362 8.65e-70 248 29 26 735 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O157:H7
Q8D8S3 2.9e-69 247 26 28 850 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain CMCP6)
Q9KRF0 3.26e-69 247 26 27 846 3 torA Trimethylamine-N-oxide reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MLQ2 2.49e-68 244 26 27 850 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain YJ016)
Q87QI7 5.27e-66 238 27 25 784 3 torA Trimethylamine-N-oxide reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P54934 1.57e-64 233 29 25 729 3 None Biotin sulfoxide reductase Cereibacter sphaeroides
C0SP82 2.95e-61 222 28 28 747 3 yoaE Probable oxidoreductase YoaE Bacillus subtilis (strain 168)
Q9HR74 3.59e-54 204 25 27 826 2 dmsA Putative dimethyl sulfoxide reductase catalytic subunit A Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P37519 2.02e-50 191 26 27 754 3 yyaE Probable oxidoreductase YyaE Bacillus subtilis (strain 168)
P37600 2.69e-46 180 25 28 770 1 phsA Thiosulfate reductase molybdopterin-containing subunit PhsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61159 9.15e-45 175 25 20 739 3 fdhA Formate dehydrogenase subunit alpha Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P06131 2.35e-44 174 27 24 711 1 fdhA Formate dehydrogenase subunit alpha Methanobacterium formicicum
Q71EW5 1.68e-43 172 25 27 736 1 None Acetylene hydratase Syntrophotalea acetylenica
P31075 4.65e-42 168 24 21 770 1 psrA Polysulfide reductase chain A Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P07658 4.95e-42 167 26 28 761 1 fdhF Formate dehydrogenase H Escherichia coli (strain K12)
P80563 5.01e-32 137 30 13 386 1 athL Pyrogallol hydroxytransferase large subunit Pelobacter acidigallici
P80563 1.14e-22 107 26 13 393 1 athL Pyrogallol hydroxytransferase large subunit Pelobacter acidigallici
P42434 6.01e-31 133 24 27 712 2 nasC Assimilatory nitrate reductase catalytic subunit Bacillus subtilis (strain 168)
Q9S1H0 9.82e-30 130 23 32 793 1 serA Selenate reductase subunit alpha Thauera selenatis
Q7WTU0 3.89e-28 125 22 37 903 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Shewanella sp. (strain ANA-3)
P60068 1.08e-27 124 22 33 814 1 clrA Chlorate reductase subunit alpha Ideonella dechloratans
Q47CW6 3.16e-25 115 29 8 304 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
Q47CW6 2.58e-17 90 24 21 497 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
I3R9M9 2.19e-24 113 31 6 255 1 narG Respiratory nitrate reductase subunit alpha Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
I3R9M9 5.26e-11 70 21 15 466 1 narG Respiratory nitrate reductase subunit alpha Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
D3RNN8 2.73e-23 109 23 18 594 1 soeA Sulfite dehydrogenase subunit A Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q67QZ1 5.85e-23 108 24 31 782 3 napA Nitrate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8GPG4 1.17e-22 107 30 12 316 1 ddhA Dimethylsulfide dehydrogenase subunit alpha Rhodovulum sulfidophilum
O34720 2.64e-22 106 23 21 711 3 yjgC Probable oxidoreductase YjgC Bacillus subtilis (strain 168)
P73448 5.83e-22 105 23 31 700 3 narB Nitrate reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5HDP9 6.8e-22 105 22 21 703 3 SACOL2301 Putative formate dehydrogenase SACOL2301 Staphylococcus aureus (strain COL)
Q2FVV9 6.8e-22 105 22 21 703 3 SAOUHSC_02582 Putative formate dehydrogenase SAOUHSC_02582 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEI5 6.8e-22 105 22 21 703 3 SAUSA300_2258 Putative formate dehydrogenase SAUSA300_2258 Staphylococcus aureus (strain USA300)
Q795Y4 1.12e-21 104 26 19 485 3 yrhE Putative formate dehydrogenase YrhE Bacillus subtilis (strain 168)
Q7A057 2.82e-21 103 22 21 703 3 MW2229 Putative formate dehydrogenase MW2229 Staphylococcus aureus (strain MW2)
Q6G711 2.82e-21 103 22 21 703 3 SAS2201 Putative formate dehydrogenase SAS2201 Staphylococcus aureus (strain MSSA476)
Q99RW4 2.82e-21 103 22 21 703 1 SA2102 Putative formate dehydrogenase SA2102 Staphylococcus aureus (strain N315)
Q931G2 4.29e-21 102 22 21 703 3 SAV2309 Putative formate dehydrogenase SAV2309 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P81186 4.54e-21 102 24 32 748 1 napA Periplasmic nitrate reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q49ZN0 5.75e-21 102 23 27 710 3 SSP0601 Putative formate dehydrogenase SSP0601 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q6GEC4 1.62e-20 100 22 24 709 3 SAR2393 Putative formate dehydrogenase SAR2393 Staphylococcus aureus (strain MRSA252)
Q5Y818 7.25e-20 98 23 35 738 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Chrysiogenes arsenatis
Q2YYT1 3.63e-19 96 22 24 711 3 SAB2186c Putative formate dehydrogenase SAB2186c Staphylococcus aureus (strain bovine RF122 / ET3-1)
P39458 3.28e-18 93 24 33 704 1 narB Nitrate reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L8G8 4.24e-18 93 24 17 519 3 SH0748 Putative formate dehydrogenase SH0748 Staphylococcus haemolyticus (strain JCSC1435)
A0A369NIV7 5.3e-16 86 22 8 323 1 dadH Dopamine dehydroxylase Eggerthella lenta
A0A369NIV7 7.82e-07 56 23 23 513 1 dadH Dopamine dehydroxylase Eggerthella lenta
C8WLC6 6.08e-16 86 22 8 323 2 Elen_0471 Uncharacterized oxidoreductase Elen_0471 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
C8WLC6 5.18e-06 53 23 23 513 2 Elen_0471 Uncharacterized oxidoreductase Elen_0471 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q2W3T1 7.14e-16 85 21 31 820 3 napA Periplasmic nitrate reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q93HX3 1.85e-15 84 21 32 880 3 napA Periplasmic nitrate reductase Paramagnetospirillum magnetotacticum
P39185 2.51e-15 84 23 20 607 1 napA Periplasmic nitrate reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q13I15 4.09e-15 83 22 15 516 3 napA Periplasmic nitrate reductase Paraburkholderia xenovorans (strain LB400)
A6VQY7 4.72e-15 83 22 35 817 3 napA Periplasmic nitrate reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VPJ7 4.94e-15 83 22 37 771 3 napA Periplasmic nitrate reductase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P09152 1.17e-14 82 26 11 340 1 narG Respiratory nitrate reductase 1 alpha chain Escherichia coli (strain K12)
Q65Q72 1.34e-14 81 21 34 814 3 napA Periplasmic nitrate reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P19319 1.58e-14 81 27 8 280 1 narZ Respiratory nitrate reductase 2 alpha chain Escherichia coli (strain K12)
B0BR28 1.82e-14 81 23 19 498 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2D1 1.82e-14 81 23 19 498 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N277 1.82e-14 81 23 19 498 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9CKL8 1.97e-14 81 22 18 523 3 napA Periplasmic nitrate reductase Pasteurella multocida (strain Pm70)
A1JL26 6.91e-14 79 22 29 775 3 napA Periplasmic nitrate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1CK03 1.19e-13 78 22 31 770 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCF3 1.19e-13 78 22 31 770 3 napA Periplasmic nitrate reductase Yersinia pestis
Q1C5S8 1.19e-13 78 22 31 770 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
Q46RX3 1.2e-13 78 20 20 606 3 napA Periplasmic nitrate reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1SWQ0 1.43e-13 78 22 20 555 3 napA Periplasmic nitrate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C6DK59 3.67e-13 77 22 22 603 3 napA Periplasmic nitrate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1JSJ0 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I0 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK8 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pestis (strain Pestoides F)
A9QZL3 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Angola)
B2K970 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FG75 3.91e-13 77 21 31 770 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q0I5G9 4.87e-13 76 23 24 528 3 napA Periplasmic nitrate reductase Histophilus somni (strain 129Pt)
Q6D5Z2 1.2e-12 75 21 31 829 3 napA Periplasmic nitrate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B3R8B4 1.61e-12 75 22 19 554 3 napA Periplasmic nitrate reductase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C5B7B9 2.13e-12 74 22 31 767 3 napA Periplasmic nitrate reductase Edwardsiella ictaluri (strain 93-146)
Q6LQJ3 2.34e-12 74 22 34 818 3 napA2 Periplasmic nitrate reductase 2 Photobacterium profundum (strain SS9)
B0URQ3 2.97e-12 74 23 24 528 3 napA Periplasmic nitrate reductase Histophilus somni (strain 2336)
Q7W733 3.19e-12 73 22 22 550 3 napA Periplasmic nitrate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
I3R634 3.82e-12 73 22 18 490 1 nasA Assimilatory nitrate reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
B8F7K2 4.15e-12 73 21 18 520 3 napA Periplasmic nitrate reductase Glaesserella parasuis serovar 5 (strain SH0165)
Q92Z36 4.17e-12 73 22 17 501 3 napA Periplasmic nitrate reductase Rhizobium meliloti (strain 1021)
P9WJQ3 5.19e-12 73 23 8 282 1 narG Nitrate reductase alpha subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJQ2 5.19e-12 73 23 8 282 3 narG Nitrate reductase alpha subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7WIQ1 5.81e-12 73 22 21 547 3 napA Periplasmic nitrate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q53176 9.01e-12 72 21 16 544 1 napA Periplasmic nitrate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B1Y6A6 1.32e-11 72 21 28 768 3 napA Periplasmic nitrate reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
P32176 4.31e-11 70 22 11 379 1 fdoG Formate dehydrogenase-O major subunit Escherichia coli (strain K12)
Q47A87 4.64e-11 70 23 25 558 3 napA Periplasmic nitrate reductase Dechloromonas aromatica (strain RCB)
Q2SGV7 9.65e-11 69 22 20 559 3 napA Periplasmic nitrate reductase Hahella chejuensis (strain KCTC 2396)
C3LVU3 1.08e-10 69 23 23 560 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain M66-2)
Q9KLR4 1.08e-10 69 23 23 560 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5EZX9 1.08e-10 69 23 23 560 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8GHJ4 1.26e-10 68 21 19 554 3 napA Periplasmic nitrate reductase Serratia proteamaculans (strain 568)
B0UCB6 1.44e-10 68 21 17 538 3 napA Periplasmic nitrate reductase Methylobacterium sp. (strain 4-46)
Q487G4 1.85e-10 68 24 20 504 3 napA Periplasmic nitrate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P24183 2.02e-10 68 22 11 379 1 fdnG Formate dehydrogenase, nitrate-inducible, major subunit Escherichia coli (strain K12)
A7ZP28 2.56e-10 67 21 17 496 3 napA Periplasmic nitrate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
A8AE11 2.86e-10 67 21 13 511 3 napA Periplasmic nitrate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6LTV9 3.63e-10 67 23 24 561 3 napA1 Periplasmic nitrate reductase 1 Photobacterium profundum (strain SS9)
A8LLY9 4.17e-10 67 21 20 572 3 napA Periplasmic nitrate reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
B7NN18 5.12e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3Z001 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Shigella sonnei (strain Ss046)
B7LJU7 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I1A4 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain SE11)
B7N5G7 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IY66 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8CVW4 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A268 5.21e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O9:H4 (strain HS)
A7N7J3 5.25e-10 67 23 24 559 3 napA Periplasmic nitrate reductase Vibrio campbellii (strain ATCC BAA-1116)
B2TV30 5.53e-10 67 21 16 495 3 napA Periplasmic nitrate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7UFL9 5.62e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31Z29 5.72e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Shigella boydii serotype 4 (strain Sb227)
Q32I06 5.82e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Shigella dysenteriae serotype 1 (strain Sd197)
P33937 5.82e-10 66 21 16 495 1 napA Periplasmic nitrate reductase Escherichia coli (strain K12)
B1X8A2 5.82e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / DH10B)
C4ZU48 5.82e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B1LKV2 6.18e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain SMS-3-5 / SECEC)
Q0TFN6 6.18e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5YWZ7 6.5e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE47 6.5e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7
B7M5P6 7.78e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O8 (strain IAI1)
B7LAM9 7.78e-10 66 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain 55989 / EAEC)
Q87GW6 8.78e-10 66 22 22 557 3 napA Periplasmic nitrate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E3J6 1.02e-09 65 23 23 558 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FGW1 1.04e-09 65 22 23 558 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain MJ11)
Q83QV0 1.11e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Shigella flexneri
B7MXN6 1.27e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O81 (strain ED1a)
Q1R9L3 1.32e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli (strain UTI89 / UPEC)
A1AD59 1.32e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O1:K1 / APEC
B7MFB8 1.32e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0T2R8 1.33e-09 65 21 16 495 3 napA Periplasmic nitrate reductase Shigella flexneri serotype 5b (strain 8401)
A5UAE1 2.27e-09 64 21 18 515 3 napA Periplasmic nitrate reductase Haemophilus influenzae (strain PittEE)
A7GZP5 2.5e-09 64 22 8 257 3 napA Periplasmic nitrate reductase Campylobacter curvus (strain 525.92)
Q4QNJ6 2.64e-09 64 21 17 540 3 napA Periplasmic nitrate reductase Haemophilus influenzae (strain 86-028NP)
Q9Z4S6 3.1e-09 64 32 2 128 1 ttrA Tetrathionate reductase subunit A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7MD44 3.89e-09 63 22 24 561 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain YJ016)
P46448 4.22e-09 63 24 13 382 3 fdxG Formate dehydrogenase major subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A4SPG7 4.27e-09 63 21 20 600 3 napA Periplasmic nitrate reductase Aeromonas salmonicida (strain A449)
Q8D623 4.38e-09 63 22 24 561 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain CMCP6)
C1D9G3 4.97e-09 63 23 21 558 3 napA Periplasmic nitrate reductase Laribacter hongkongensis (strain HLHK9)
P0DV66 6.78e-09 63 26 11 310 1 idrA Iodate reductase subunit IdrA Denitromonas iodatirespirans
B9L8L4 1.27e-08 62 24 9 257 3 napA Periplasmic nitrate reductase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q8U7P1 1.51e-08 62 21 20 568 3 napA Periplasmic nitrate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
B9KCQ2 1.81e-08 62 22 11 309 3 napA Periplasmic nitrate reductase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
P42175 1.93e-08 62 22 9 296 3 narG Nitrate reductase alpha chain Bacillus subtilis (strain 168)
Q8Z570 2.8e-08 61 20 13 512 3 napA Periplasmic nitrate reductase Salmonella typhi
B5BDZ4 2.8e-08 61 20 13 512 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain AKU_12601)
A9N5G2 2.8e-08 61 20 13 512 3 napA Periplasmic nitrate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PI61 2.8e-08 61 20 13 512 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B7VRL0 3.38e-08 61 22 24 607 3 napA Periplasmic nitrate reductase Vibrio atlanticus (strain LGP32)
Q3HS05 3.39e-08 61 22 26 580 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri
A4VJ11 3.39e-08 61 22 26 580 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri (strain A1501)
A0KIM1 3.5e-08 60 21 18 555 3 napA Periplasmic nitrate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A9MJZ6 4.12e-08 60 20 14 512 3 napA Periplasmic nitrate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A6Q604 4.35e-08 60 23 8 256 3 napA Periplasmic nitrate reductase Nitratiruptor sp. (strain SB155-2)
Q934F5 4.46e-08 60 20 10 320 1 fdhA Formate dehydrogenase subunit alpha Megalodesulfovibrio gigas
A7ZCK4 6.14e-08 60 23 10 281 3 napA Periplasmic nitrate reductase Campylobacter concisus (strain 13826)
A0A391NTR7 1.25e-07 59 24 5 199 1 idrA Iodate reductase subunit IdrA Pseudomonas sp. (strain SCT)
A4XWM0 1.29e-07 59 20 17 498 3 napA Periplasmic nitrate reductase Pseudomonas mendocina (strain ymp)
Q8VL02 1.38e-07 58 21 23 525 3 napA Periplasmic nitrate reductase Aggregatibacter actinomycetemcomitans
B0TSW5 2.1e-07 58 22 20 506 3 napA Periplasmic nitrate reductase Shewanella halifaxensis (strain HAW-EB4)
A9I7M5 2.72e-07 58 21 26 567 3 napA Periplasmic nitrate reductase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q21PN1 3.46e-07 57 22 18 498 3 napA Periplasmic nitrate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B2UBL7 5.18e-07 57 23 12 314 3 napA Periplasmic nitrate reductase Ralstonia pickettii (strain 12J)
Q12P44 7.39e-07 56 22 18 495 3 napA Periplasmic nitrate reductase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7M962 1.38e-06 55 25 10 296 3 napA Periplasmic nitrate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q56350 1.42e-06 55 23 6 249 1 napA Periplasmic nitrate reductase Paracoccus pantotrophus
A5ED21 2.41e-06 55 21 17 541 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A4Z0A1 3.19e-06 54 21 17 541 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain ORS 278)
A8FLJ3 3.65e-06 54 24 8 252 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HV12 3.78e-06 54 24 8 252 3 napA Periplasmic nitrate reductase Campylobacter jejuni (strain RM1221)
Q9PPD9 3.78e-06 54 24 8 252 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VZC8 3.81e-06 54 24 8 252 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7I3Y7 4.55e-06 54 22 8 241 3 napA Periplasmic nitrate reductase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A0RQ36 6.41e-06 53 23 12 265 3 napA Periplasmic nitrate reductase Campylobacter fetus subsp. fetus (strain 82-40)
O30078 8.35e-06 53 25 4 157 1 ttrA Tetrathionate reductase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P65409 1.2e-05 52 23 8 224 3 BQ2027_MB2924C Uncharacterized oxidoreductase Mb2924c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WJP9 1.2e-05 52 23 8 224 1 Rv2900c Uncharacterized oxidoreductase Rv2900c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJP8 1.2e-05 52 23 8 224 3 MT2968 Uncharacterized oxidoreductase MT2968 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8EIJ1 1.75e-05 52 21 22 498 3 napA Periplasmic nitrate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q727P3 1.86e-05 52 21 19 482 1 fdnG-3 Formate dehydrogenase 2 subunit alpha (cytochrome c-553) Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A6V924 6.38e-05 50 19 15 508 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain PA7)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05810
Feature type CDS
Gene -
Product molybdopterin-dependent oxidoreductase
Location 1270635 - 1273031 (strand: 1)
Length 2397 (nucleotides) / 798 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_20
Orthogroup size 19
N. genomes 7

Actions

Genomic region

Domains

PF00384 Molybdopterin oxidoreductase
PF01568 Molydopterin dinucleotide binding domain
PF04879 Molybdopterin oxidoreductase Fe4S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0243 Energy production and conversion (C) C Anaerobic selenocysteine-containing dehydrogenase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07306 anaerobic dimethyl sulfoxide reductase subunit A [EC:1.8.5.3] Sulfur metabolism
Metabolic pathways		 -

Protein Sequence

MSIKKQEKRLANQEGMPLTRRHFVQASAALVSMPFFAQNAQANLDKSLPIANIDEKPATVVATCSTFDCGGKCDIRAHVKEGIVTRITTRPDADLDEQMPIMRACVRGRGYRKFTYHADRLKYPMKRVGKRGEGKFERISWDEATSLIAENVTRLTQQHGAASRFLTVNTAVTGGIFSGDTMMKKLFNLTGGYLPYYHSVSLGNTAKVTPYTYGVSKTGSSLDTLADTPLVILWGHNPNETIFGHTNHYFQKMKNNGTKFIVVDPRYSDTAQSLADQWIPLLPTTDNALMDAMMYVIVTENLHDKAFIDKYVLGFDEDHMPEGVPANESLMAYLLGKKDGIAKTPEWATKITRVPANTIRQLAREYAMTKPAALIQGWGPQRHICGERTARGSTLLAAITGNVGKKGAWAAGYGGIGNRQSIRGPNIGKNPVTAQISIMNWMQAVEDASKVTPEDGLIGVDKLDSNIKMIFSLAGNYLVNQNPDVNAAAKLLEDESKVEFIVVSDLYMSPSAKYADLVLPETSFLERWNIGNTWGTGNYFLLSEKVVEPAFERRSDYEWISDVAEKMGVKEAFTEGRTEKEWIAYLVNTNKERFKDRPDFPTFDELLKTRRYLFKDAPFVAFEENIRDPENHPFPTPSGKIEIFSKRLYDMNNVDIPALSHYVPAIEGPEDKLTEKYPLQMLTWKGKNRANSTQYANPWLQEVQRQEMWINPIDAQNRGIKNGDMVRIYNDRGITQIPALVTERIIPGVVGLQAGAWWSPDKDGVDHGGCPNVLTSTRMTPLAHGNSHLTVLVEVTKA

Flanking regions ( +/- flanking 50bp)

CCACTATCTTTTATCATTTTCATTAATAAAAATAGTTATGTGAGAATGATATGTCTATAAAAAAACAAGAAAAAAGGCTTGCTAATCAAGAGGGGATGCCATTAACGCGTCGTCATTTTGTACAAGCCAGTGCAGCATTAGTGAGTATGCCTTTTTTCGCACAAAATGCACAGGCCAATCTTGATAAAAGCCTACCTATTGCCAACATTGATGAGAAACCTGCTACTGTCGTCGCAACATGCAGCACCTTTGACTGTGGTGGTAAATGTGATATCCGAGCTCATGTTAAAGAGGGAATTGTTACCCGTATTACCACAAGACCAGATGCTGATTTAGATGAACAAATGCCGATAATGAGAGCCTGCGTAAGAGGTAGAGGTTATCGTAAATTCACTTATCATGCGGATAGACTTAAATATCCCATGAAACGTGTGGGTAAGCGCGGTGAAGGCAAATTTGAGCGTATCTCTTGGGATGAAGCAACCTCTTTAATTGCTGAGAATGTAACACGATTAACTCAACAGCATGGTGCAGCAAGTCGTTTTCTTACGGTAAATACCGCCGTCACTGGGGGGATCTTCTCTGGTGATACTATGATGAAAAAACTCTTTAATCTCACAGGAGGATATCTTCCTTATTATCACTCAGTGAGCTTAGGGAATACCGCTAAAGTCACACCTTATACTTATGGCGTATCTAAAACAGGAAGTTCTCTTGATACTTTAGCGGATACGCCTTTAGTTATTTTGTGGGGACATAATCCCAACGAAACCATTTTTGGTCACACCAATCACTATTTTCAAAAAATGAAAAATAATGGGACCAAATTTATTGTTGTCGATCCTCGTTATTCAGATACAGCCCAATCTTTAGCTGATCAATGGATCCCATTACTTCCTACCACAGATAATGCACTGATGGATGCAATGATGTATGTCATTGTGACCGAAAATTTACATGATAAAGCGTTTATCGATAAATATGTGCTAGGTTTTGATGAAGATCATATGCCTGAAGGGGTGCCAGCTAACGAATCATTAATGGCTTATTTATTAGGGAAAAAAGACGGTATAGCGAAAACCCCAGAATGGGCGACAAAAATCACACGAGTCCCAGCCAATACTATCCGTCAATTAGCACGTGAATATGCGATGACAAAACCCGCGGCCTTAATTCAAGGTTGGGGGCCACAACGTCATATTTGTGGTGAACGTACCGCCCGTGGTTCAACGTTATTAGCAGCAATTACTGGGAATGTGGGTAAAAAAGGCGCTTGGGCGGCTGGATATGGCGGAATTGGTAACCGTCAATCTATTCGTGGTCCTAATATTGGCAAAAATCCGGTAACTGCACAAATATCCATTATGAATTGGATGCAAGCTGTTGAGGATGCGAGCAAAGTGACGCCAGAAGATGGCCTTATTGGCGTCGATAAACTTGATAGTAATATCAAAATGATCTTTTCTTTAGCGGGTAACTATCTTGTCAATCAAAACCCTGATGTTAATGCGGCAGCTAAGTTACTTGAAGATGAATCTAAAGTAGAGTTTATCGTTGTTAGTGATCTATATATGTCTCCGTCAGCCAAATACGCAGACTTAGTTTTACCAGAAACGAGCTTTTTAGAGCGTTGGAATATCGGTAATACATGGGGAACGGGCAACTATTTCTTACTGTCAGAAAAAGTCGTTGAACCTGCTTTTGAAAGACGTTCTGATTATGAATGGATCAGCGATGTTGCTGAGAAAATGGGAGTCAAAGAGGCTTTTACCGAAGGACGAACAGAAAAAGAGTGGATAGCTTATCTCGTTAATACTAACAAAGAACGCTTTAAAGATAGACCTGATTTCCCAACTTTTGATGAATTACTCAAGACTCGCCGCTATCTTTTCAAAGATGCACCTTTTGTTGCATTTGAAGAAAATATTCGTGATCCAGAAAATCATCCTTTCCCAACTCCATCAGGAAAAATTGAAATTTTCTCTAAACGTCTCTATGACATGAATAATGTCGATATTCCTGCATTATCTCATTATGTTCCTGCAATTGAAGGTCCAGAAGATAAATTGACCGAGAAATATCCACTACAAATGTTAACTTGGAAAGGAAAAAATAGAGCTAATTCAACGCAATATGCTAACCCTTGGTTACAAGAGGTACAACGCCAAGAAATGTGGATAAACCCTATTGATGCACAAAATAGAGGCATCAAAAATGGCGATATGGTGCGTATCTATAACGACAGAGGGATCACCCAAATACCCGCTTTAGTTACCGAGCGAATTATTCCTGGTGTGGTTGGTTTACAGGCGGGGGCTTGGTGGTCTCCTGATAAAGACGGTGTTGATCATGGTGGGTGCCCTAACGTTTTGACATCAACACGTATGACACCATTAGCCCATGGTAATTCACATTTAACCGTTTTAGTTGAGGTAACCAAAGCATGAGTGAATTCAAACAATATGCGCCTGTTAGCGATGAACAGCTTGGTTTTTTT