Homologs in group_20

Help

18 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_08070 FBDBKF_08070 41.9 Morganella morganii S1 bisC Anaerobic selenocysteine-containing dehydrogenase
FBDBKF_10450 FBDBKF_10450 94.4 Morganella morganii S1 dmsA dimethylsulfoxide reductase subunit A
EHELCC_13900 EHELCC_13900 41.9 Morganella morganii S2 bisC Anaerobic selenocysteine-containing dehydrogenase
EHELCC_14785 EHELCC_14785 94.4 Morganella morganii S2 dmsA dimethylsulfoxide reductase subunit A
NLDBIP_14345 NLDBIP_14345 41.9 Morganella morganii S4 bisC Anaerobic selenocysteine-containing dehydrogenase
NLDBIP_14615 NLDBIP_14615 94.4 Morganella morganii S4 dmsA dimethylsulfoxide reductase subunit A
LHKJJB_08505 LHKJJB_08505 41.9 Morganella morganii S3 bisC Anaerobic selenocysteine-containing dehydrogenase
LHKJJB_14730 LHKJJB_14730 94.4 Morganella morganii S3 dmsA dimethylsulfoxide reductase subunit A
LHKJJB_19940 LHKJJB_19940 52.4 Morganella morganii S3 - Anaerobic dimethyl sulfoxide reductase, A subunit, DmsA/YnfE family
HKOGLL_08055 HKOGLL_08055 41.9 Morganella morganii S5 bisC Anaerobic selenocysteine-containing dehydrogenase
HKOGLL_13350 HKOGLL_13350 94.4 Morganella morganii S5 dmsA dimethylsulfoxide reductase subunit A
F4V73_RS05070 F4V73_RS05070 42.4 Morganella psychrotolerans - DMSO/selenate family reductase complex A subunit
F4V73_RS12925 F4V73_RS12925 40.7 Morganella psychrotolerans - DMSO/selenate family reductase complex A subunit
PMI_RS00825 PMI_RS00825 30.4 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase
PMI_RS05810 PMI_RS05810 44.2 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase
PMI_RS08345 PMI_RS08345 52.4 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase
PMI_RS08900 PMI_RS08900 26.6 Proteus mirabilis HI4320 phsA thiosulfate reductase PhsA
PMI_RS14655 PMI_RS14655 42.4 Proteus mirabilis HI4320 - molybdopterin-dependent oxidoreductase

Distribution of the homologs in the orthogroup group_20

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_20

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P18775 0.0 1369 79 2 814 1 dmsA Dimethyl sulfoxide reductase DmsA Escherichia coli (strain K12)
P45004 0.0 1262 74 3 800 3 dmsA Dimethyl sulfoxide reductase DmsA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77374 0.0 1131 66 7 805 1 ynfE Putative dimethyl sulfoxide reductase chain YnfE Escherichia coli (strain K12)
P77783 0.0 1103 64 8 818 1 ynfF Probable dimethyl sulfoxide reductase chain YnfF Escherichia coli (strain K12)
Q57366 2.85e-94 316 30 30 879 1 dmsA Dimethyl sulfoxide/trimethylamine N-oxide reductase Cereibacter sphaeroides
Q8Z2M4 3.86e-94 317 32 23 758 3 torA Trimethylamine-N-oxide reductase Salmonella typhi
Q8ZKZ7 1e-93 315 32 23 758 3 torA Trimethylamine-N-oxide reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33225 8.42e-92 310 32 24 759 1 torA Trimethylamine-N-oxide reductase 1 Escherichia coli (strain K12)
P44798 3.19e-91 308 31 23 761 1 torZ Trimethylamine-N-oxide reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8CW73 4.57e-91 308 32 24 759 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q52675 2.46e-90 305 30 23 759 1 dorA Dimethyl sulfoxide/trimethylamine N-oxide reductase Rhodobacter capsulatus
P58360 3.77e-90 305 31 24 760 3 torA Trimethylamine-N-oxide reductase 1 Escherichia coli O157:H7
Q8D8S3 2.31e-89 303 28 30 858 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain CMCP6)
Q7MLQ2 4.28e-88 299 28 30 858 3 torA Trimethylamine-N-oxide reductase Vibrio vulnificus (strain YJ016)
Q8CVZ3 9.82e-85 290 31 31 858 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KRF0 1.04e-84 290 28 29 862 3 torA Trimethylamine-N-oxide reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P58362 2.41e-84 289 31 31 858 3 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli O157:H7
Q8EHI9 2.5e-84 289 30 28 772 3 torA Trimethylamine-N-oxide reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P46923 2.98e-83 286 31 31 858 1 torZ Trimethylamine-N-oxide reductase 2 Escherichia coli (strain K12)
Q87QI7 6.53e-83 285 28 26 798 3 torA Trimethylamine-N-oxide reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O87948 1.98e-82 284 30 27 770 1 torA Trimethylamine-N-oxide reductase Shewanella massilia
P20099 2e-82 283 31 26 734 1 bisC Biotin sulfoxide reductase Escherichia coli (strain K12)
Q9CK41 1.85e-78 273 29 25 763 3 torA Trimethylamine-N-oxide reductase Pasteurella multocida (strain Pm70)
P54934 2.57e-75 263 30 29 759 3 None Biotin sulfoxide reductase Cereibacter sphaeroides
C0SP82 9.91e-68 241 29 27 779 3 yoaE Probable oxidoreductase YoaE Bacillus subtilis (strain 168)
Q9HR74 9.49e-57 212 25 26 824 2 dmsA Putative dimethyl sulfoxide reductase catalytic subunit A Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P37519 1.18e-52 198 28 28 765 3 yyaE Probable oxidoreductase YyaE Bacillus subtilis (strain 168)
P37600 1.64e-44 175 24 27 789 1 phsA Thiosulfate reductase molybdopterin-containing subunit PhsA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q71EW5 4.19e-40 162 24 24 764 1 None Acetylene hydratase Syntrophotalea acetylenica
P31075 2.4e-37 153 24 30 811 1 psrA Polysulfide reductase chain A Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P80563 8.64e-35 146 24 33 842 1 athL Pyrogallol hydroxytransferase large subunit Pelobacter acidigallici
P61159 5.65e-33 139 23 26 734 3 fdhA Formate dehydrogenase subunit alpha Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P07658 1.75e-32 138 24 33 777 1 fdhF Formate dehydrogenase H Escherichia coli (strain K12)
Q9S1H0 2.21e-32 139 24 32 815 1 serA Selenate reductase subunit alpha Thauera selenatis
Q7WTU0 3.79e-32 137 22 33 850 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Shewanella sp. (strain ANA-3)
P06131 5.01e-30 130 25 28 727 1 fdhA Formate dehydrogenase subunit alpha Methanobacterium formicicum
Q47CW6 8.5e-26 117 29 9 312 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
Q47CW6 2.88e-21 103 25 16 472 1 pcrA Perchlorate reductase subunit alpha Dechloromonas aromatica (strain RCB)
Q67QZ1 6.94e-25 114 24 32 803 3 napA Nitrate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q4L8G8 2.35e-24 113 24 20 567 3 SH0748 Putative formate dehydrogenase SH0748 Staphylococcus haemolyticus (strain JCSC1435)
P60068 2.35e-23 110 23 33 819 1 clrA Chlorate reductase subunit alpha Ideonella dechloratans
Q7A057 2.41e-23 110 24 19 543 3 MW2229 Putative formate dehydrogenase MW2229 Staphylococcus aureus (strain MW2)
Q6G711 2.41e-23 110 24 19 543 3 SAS2201 Putative formate dehydrogenase SAS2201 Staphylococcus aureus (strain MSSA476)
Q99RW4 2.41e-23 110 24 19 543 1 SA2102 Putative formate dehydrogenase SA2102 Staphylococcus aureus (strain N315)
Q931G2 2.82e-23 110 24 19 543 3 SAV2309 Putative formate dehydrogenase SAV2309 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P32176 4.9e-23 109 26 15 474 1 fdoG Formate dehydrogenase-O major subunit Escherichia coli (strain K12)
Q5HDP9 1.29e-22 107 24 19 543 3 SACOL2301 Putative formate dehydrogenase SACOL2301 Staphylococcus aureus (strain COL)
Q2FVV9 1.29e-22 107 24 19 543 3 SAOUHSC_02582 Putative formate dehydrogenase SAOUHSC_02582 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEI5 1.29e-22 107 24 19 543 3 SAUSA300_2258 Putative formate dehydrogenase SAUSA300_2258 Staphylococcus aureus (strain USA300)
Q8GPG4 1.46e-22 107 20 29 842 1 ddhA Dimethylsulfide dehydrogenase subunit alpha Rhodovulum sulfidophilum
D3RNN8 3.85e-22 106 31 12 265 1 soeA Sulfite dehydrogenase subunit A Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q2YYT1 1.28e-21 104 23 18 543 3 SAB2186c Putative formate dehydrogenase SAB2186c Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GEC4 2.24e-21 103 24 17 492 3 SAR2393 Putative formate dehydrogenase SAR2393 Staphylococcus aureus (strain MRSA252)
P39458 2.32e-21 103 23 32 755 1 narB Nitrate reductase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P73448 2.63e-21 103 21 33 789 3 narB Nitrate reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P42434 3.24e-21 102 22 24 585 2 nasC Assimilatory nitrate reductase catalytic subunit Bacillus subtilis (strain 168)
Q49ZN0 7.93e-21 102 23 17 551 3 SSP0601 Putative formate dehydrogenase SSP0601 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1SWQ0 6.65e-20 99 22 37 879 3 napA Periplasmic nitrate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
O34720 6.99e-20 99 23 27 725 3 yjgC Probable oxidoreductase YjgC Bacillus subtilis (strain 168)
P24183 3.35e-19 97 25 18 474 1 fdnG Formate dehydrogenase, nitrate-inducible, major subunit Escherichia coli (strain K12)
P81186 7.17e-19 95 22 29 753 1 napA Periplasmic nitrate reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
C1D9G3 9.88e-19 95 22 36 895 3 napA Periplasmic nitrate reductase Laribacter hongkongensis (strain HLHK9)
Q1CK03 1.44e-18 94 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCF3 1.44e-18 94 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pestis
Q1C5S8 1.44e-18 94 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
Q487G4 1.81e-18 94 22 38 896 3 napA Periplasmic nitrate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5Y818 3.15e-18 93 26 14 372 1 arrA Arsenate respiratory reductase molybdopterin-containing subunit ArrA Chrysiogenes arsenatis
B1JSJ0 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668I0 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMK8 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pestis (strain Pestoides F)
A9QZL3 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pestis bv. Antiqua (strain Angola)
B2K970 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FG75 4.09e-18 93 24 37 861 3 napA Periplasmic nitrate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7N7J3 6.78e-18 92 22 36 888 3 napA Periplasmic nitrate reductase Vibrio campbellii (strain ATCC BAA-1116)
P39185 6.8e-18 92 21 39 903 1 napA Periplasmic nitrate reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
C6DK59 8.19e-18 92 23 39 889 3 napA Periplasmic nitrate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6LQJ3 1.13e-17 91 22 36 900 3 napA2 Periplasmic nitrate reductase 2 Photobacterium profundum (strain SS9)
I3R9M9 1.2e-17 91 27 13 338 1 narG Respiratory nitrate reductase subunit alpha Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
I3R9M9 8.45e-15 82 24 19 476 1 narG Respiratory nitrate reductase subunit alpha Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q6LTV9 2.42e-17 90 22 36 874 3 napA1 Periplasmic nitrate reductase 1 Photobacterium profundum (strain SS9)
Q5E3J6 2.6e-17 90 22 36 887 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KIM1 2.64e-17 90 22 33 880 3 napA Periplasmic nitrate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1JL26 3.46e-17 90 23 34 859 3 napA Periplasmic nitrate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5FGW1 3.54e-17 90 22 36 887 3 napA Periplasmic nitrate reductase Aliivibrio fischeri (strain MJ11)
Q795Y4 5.87e-17 89 25 18 491 3 yrhE Putative formate dehydrogenase YrhE Bacillus subtilis (strain 168)
Q6D5Z2 7.1e-17 89 23 38 882 3 napA Periplasmic nitrate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7W733 7.37e-17 89 23 19 516 3 napA Periplasmic nitrate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A8GHJ4 8.15e-17 89 23 38 867 3 napA Periplasmic nitrate reductase Serratia proteamaculans (strain 568)
Q2SGV7 1.07e-16 88 20 37 899 3 napA Periplasmic nitrate reductase Hahella chejuensis (strain KCTC 2396)
Q7WIQ1 1.23e-16 88 23 19 516 3 napA Periplasmic nitrate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A4SPG7 1.35e-16 88 22 32 817 3 napA Periplasmic nitrate reductase Aeromonas salmonicida (strain A449)
P09152 1.61e-16 88 25 11 345 1 narG Respiratory nitrate reductase 1 alpha chain Escherichia coli (strain K12)
Q12P44 1.98e-16 87 21 32 849 3 napA Periplasmic nitrate reductase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P46448 2.99e-16 87 22 16 481 3 fdxG Formate dehydrogenase major subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A7ZP28 3.57e-16 87 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q934F5 4.48e-16 86 24 18 469 1 fdhA Formate dehydrogenase subunit alpha Megalodesulfovibrio gigas
Q1R9L3 5.93e-16 86 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain UTI89 / UPEC)
A1AD59 5.93e-16 86 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O1:K1 / APEC
B7MFB8 5.93e-16 86 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LKV2 7.42e-16 85 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain SMS-3-5 / SECEC)
Q0TFN6 7.42e-16 85 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NN18 8.81e-16 85 23 36 868 3 napA Periplasmic nitrate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q31Z29 9.04e-16 85 23 37 879 3 napA Periplasmic nitrate reductase Shigella boydii serotype 4 (strain Sb227)
Q13I15 9.67e-16 85 21 35 879 3 napA Periplasmic nitrate reductase Paraburkholderia xenovorans (strain LB400)
B2TV30 1.17e-15 85 23 37 879 3 napA Periplasmic nitrate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P33937 1.21e-15 85 23 37 879 1 napA Periplasmic nitrate reductase Escherichia coli (strain K12)
B1X8A2 1.21e-15 85 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / DH10B)
C4ZU48 1.21e-15 85 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B7UFL9 1.21e-15 85 23 38 879 3 napA Periplasmic nitrate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q0T2R8 1.3e-15 85 23 36 878 3 napA Periplasmic nitrate reductase Shigella flexneri serotype 5b (strain 8401)
Q3Z001 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Shigella sonnei (strain Ss046)
B7LJU7 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I1A4 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain SE11)
B7N5G7 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IY66 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8CVW4 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A268 1.86e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O9:H4 (strain HS)
Q32I06 1.93e-15 84 23 37 878 3 napA Periplasmic nitrate reductase Shigella dysenteriae serotype 1 (strain Sd197)
B7MXN6 1.98e-15 84 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O81 (strain ED1a)
B7M5P6 2.37e-15 84 23 37 881 3 napA Periplasmic nitrate reductase Escherichia coli O8 (strain IAI1)
B7LAM9 2.37e-15 84 23 37 881 3 napA Periplasmic nitrate reductase Escherichia coli (strain 55989 / EAEC)
A8AE11 2.62e-15 84 24 39 881 3 napA Periplasmic nitrate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q83QV0 2.65e-15 84 23 36 878 3 napA Periplasmic nitrate reductase Shigella flexneri
B5YWZ7 3.36e-15 83 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE47 3.36e-15 83 23 37 879 3 napA Periplasmic nitrate reductase Escherichia coli O157:H7
B7VRL0 5.73e-15 83 22 39 891 3 napA Periplasmic nitrate reductase Vibrio atlanticus (strain LGP32)
Q21AR4 7.03e-15 82 23 35 855 3 napA Periplasmic nitrate reductase Rhodopseudomonas palustris (strain BisB18)
Q3HS05 9.64e-15 82 23 35 876 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri
A4VJ11 9.64e-15 82 23 35 876 3 napA Periplasmic nitrate reductase Stutzerimonas stutzeri (strain A1501)
C5B7B9 1.2e-14 82 23 35 867 3 napA Periplasmic nitrate reductase Edwardsiella ictaluri (strain 93-146)
A0A369NIV7 1.54e-14 81 25 13 323 1 dadH Dopamine dehydroxylase Eggerthella lenta
C8WLC6 1.56e-14 81 25 13 323 2 Elen_0471 Uncharacterized oxidoreductase Elen_0471 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
P19319 2.01e-14 81 25 10 312 1 narZ Respiratory nitrate reductase 2 alpha chain Escherichia coli (strain K12)
Q65Q72 2.29e-14 80 21 35 876 3 napA Periplasmic nitrate reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q46RX3 3.31e-14 80 21 34 881 3 napA Periplasmic nitrate reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P9WJQ3 5.11e-14 80 25 12 311 1 narG Nitrate reductase alpha subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJQ2 5.11e-14 80 25 12 311 3 narG Nitrate reductase alpha subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q87GW6 8.34e-14 79 23 24 568 3 napA Periplasmic nitrate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8EIJ1 8.54e-14 79 21 34 842 3 napA Periplasmic nitrate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VPJ7 8.69e-14 79 22 35 814 3 napA Periplasmic nitrate reductase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MD44 9.57e-14 79 23 24 568 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain YJ016)
Q8D623 1.08e-13 79 23 24 568 3 napA Periplasmic nitrate reductase Vibrio vulnificus (strain CMCP6)
B3R8B4 2.24e-13 77 22 22 604 3 napA Periplasmic nitrate reductase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q53176 2.57e-13 77 23 20 569 1 napA Periplasmic nitrate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O33732 2.64e-13 77 21 19 541 3 Sfri_1505 Nitrate reductase Shewanella frigidimarina (strain NCIMB 400)
A9MJZ6 3.67e-13 77 22 36 897 3 napA Periplasmic nitrate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8VL02 3.74e-13 77 22 37 875 3 napA Periplasmic nitrate reductase Aggregatibacter actinomycetemcomitans
C3LVU3 4.64e-13 77 22 35 831 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain M66-2)
Q9KLR4 4.64e-13 77 22 35 831 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5EZX9 4.64e-13 77 22 35 831 3 napA Periplasmic nitrate reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0BR28 7.61e-13 76 22 34 811 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2D1 7.61e-13 76 22 34 811 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N277 7.61e-13 76 22 34 811 3 napA Periplasmic nitrate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q8Z570 7.68e-13 76 22 36 895 3 napA Periplasmic nitrate reductase Salmonella typhi
B5BDZ4 7.68e-13 76 22 36 895 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain AKU_12601)
A9N5G2 7.68e-13 76 22 36 895 3 napA Periplasmic nitrate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PI61 7.68e-13 76 22 36 895 3 napA Periplasmic nitrate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q56350 7.9e-13 76 22 16 533 1 napA Periplasmic nitrate reductase Paracoccus pantotrophus
P42175 8.09e-13 76 24 10 325 3 narG Nitrate reductase alpha chain Bacillus subtilis (strain 168)
B5RC85 8.66e-13 75 22 35 886 3 napA Periplasmic nitrate reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FNQ2 8.96e-13 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella dublin (strain CT_02021853)
B4TPE6 9.2e-13 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella schwarzengrund (strain CVM19633)
Q8ZNH6 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4SYT3 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella newport (strain SL254)
B4TAT3 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella heidelberg (strain SL476)
B5R233 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella enteritidis PT4 (strain P125109)
Q57M92 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella choleraesuis (strain SC-B67)
B5EYU5 1.07e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella agona (strain SL483)
Q4QNJ6 1.5e-12 75 22 34 814 3 napA Periplasmic nitrate reductase Haemophilus influenzae (strain 86-028NP)
C0Q0P2 1.83e-12 75 22 36 895 3 napA Periplasmic nitrate reductase Salmonella paratyphi C (strain RKS4594)
Q2W3T1 3.1e-12 74 21 34 843 3 napA Periplasmic nitrate reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A5UAE1 3.62e-12 73 22 34 814 3 napA Periplasmic nitrate reductase Haemophilus influenzae (strain PittEE)
B9KCQ2 3.97e-12 73 24 11 321 3 napA Periplasmic nitrate reductase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q92Z36 6.35e-12 73 23 24 578 3 napA Periplasmic nitrate reductase Rhizobium meliloti (strain 1021)
A9I7M5 1.28e-11 72 22 23 623 3 napA Periplasmic nitrate reductase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0UCB6 1.33e-11 72 23 17 403 3 napA Periplasmic nitrate reductase Methylobacterium sp. (strain 4-46)
A4XWM0 1.6e-11 72 23 25 540 3 napA Periplasmic nitrate reductase Pseudomonas mendocina (strain ymp)
Q727P3 1.81e-11 71 22 18 468 1 fdnG-3 Formate dehydrogenase 2 subunit alpha (cytochrome c-553) Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q21PN1 1.91e-11 71 23 22 534 3 napA Periplasmic nitrate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A6Q604 2.81e-11 71 24 12 319 3 napA Periplasmic nitrate reductase Nitratiruptor sp. (strain SB155-2)
Q7VJT5 3.06e-11 70 26 13 326 3 napA Periplasmic nitrate reductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9CKL8 8.99e-11 69 23 24 572 3 napA Periplasmic nitrate reductase Pasteurella multocida (strain Pm70)
A6VQY7 9.29e-11 69 23 24 567 3 napA Periplasmic nitrate reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B2UBL7 9.68e-11 69 21 36 888 3 napA Periplasmic nitrate reductase Ralstonia pickettii (strain 12J)
A6V924 1.27e-10 68 22 16 505 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain PA7)
B7UX15 1.42e-10 68 23 18 560 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain LESB58)
B0TSW5 1.42e-10 68 21 25 620 3 napA Periplasmic nitrate reductase Shewanella halifaxensis (strain HAW-EB4)
B1Y6A6 2.05e-10 68 22 23 606 3 napA Periplasmic nitrate reductase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q02IZ4 2.12e-10 68 23 18 560 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0I5G9 2.15e-10 68 22 22 564 3 napA Periplasmic nitrate reductase Histophilus somni (strain 129Pt)
A7ZCK4 3.21e-10 67 24 15 320 3 napA Periplasmic nitrate reductase Campylobacter concisus (strain 13826)
Q9I4G3 3.36e-10 67 22 17 515 3 napA Periplasmic nitrate reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A8FLJ3 4.88e-10 67 23 12 321 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q5HV12 4.92e-10 67 23 12 321 3 napA Periplasmic nitrate reductase Campylobacter jejuni (strain RM1221)
Q9PPD9 4.92e-10 67 23 12 321 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B0URQ3 5.42e-10 67 22 22 564 3 napA Periplasmic nitrate reductase Histophilus somni (strain 2336)
A7GZP5 5.84e-10 67 22 28 626 3 napA Periplasmic nitrate reductase Campylobacter curvus (strain 525.92)
A1VZC8 9.58e-10 66 23 12 321 3 napA Periplasmic nitrate reductase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q8U7P1 9.98e-10 66 23 25 565 3 napA Periplasmic nitrate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
A8LLY9 1.04e-09 65 23 14 357 3 napA Periplasmic nitrate reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q9Z4S6 1.4e-09 65 23 10 300 1 ttrA Tetrathionate reductase subunit A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q47A87 1.76e-09 65 23 24 624 3 napA Periplasmic nitrate reductase Dechloromonas aromatica (strain RCB)
B9L8L4 2.15e-09 65 24 11 313 3 napA Periplasmic nitrate reductase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A4Z0A1 2.56e-09 64 21 32 832 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain ORS 278)
A5ED21 2.58e-09 64 21 32 832 3 napA Periplasmic nitrate reductase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
P0DV66 4.01e-09 64 27 14 304 1 idrA Iodate reductase subunit IdrA Denitromonas iodatirespirans
Q89EN5 9.97e-09 62 22 38 865 3 napA Periplasmic nitrate reductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A0A391NTR7 1.22e-08 62 25 13 304 1 idrA Iodate reductase subunit IdrA Pseudomonas sp. (strain SCT)
Q93HX3 2.29e-08 61 21 13 392 3 napA Periplasmic nitrate reductase Paramagnetospirillum magnetotacticum
A0RQ36 3.07e-08 61 24 13 320 3 napA Periplasmic nitrate reductase Campylobacter fetus subsp. fetus (strain 82-40)
Q06457 6.45e-08 60 20 20 554 2 nasA Nitrate reductase Klebsiella oxytoca
B8F7K2 6.84e-08 60 24 26 562 3 napA Periplasmic nitrate reductase Glaesserella parasuis serovar 5 (strain SH0165)
I3R634 1.64e-07 58 20 17 530 1 nasA Assimilatory nitrate reductase Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q7M962 3.64e-07 57 23 13 319 3 napA Periplasmic nitrate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P65409 7.43e-07 56 22 10 320 3 BQ2027_MB2924C Uncharacterized oxidoreductase Mb2924c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WJP9 7.43e-07 56 22 10 320 1 Rv2900c Uncharacterized oxidoreductase Rv2900c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJP8 7.43e-07 56 22 10 320 3 MT2968 Uncharacterized oxidoreductase MT2968 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8GGJ6 1.27e-06 55 24 15 345 2 aioA Arsenite oxidase subunit AioA Herminiimonas arsenicoxydans
Q7SIF4 2.78e-06 54 23 14 357 1 aioA Arsenite oxidase subunit AioA Alcaligenes faecalis
O30078 0.00054 47 33 2 102 1 ttrA Tetrathionate reductase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A7I3Y7 0.000543 47 23 9 260 3 napA Periplasmic nitrate reductase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14150
Feature type CDS
Gene dmsA
Product dimethylsulfoxide reductase subunit A
Location 44180 - 46627 (strand: 1)
Length 2448 (nucleotides) / 815 (amino acids)

Contig

Accession term accessions NZ_VXKB01000004 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_20
Orthogroup size 19
N. genomes 7

Actions

Genomic region

Domains

PF00384 Molybdopterin oxidoreductase
PF01568 Molydopterin dinucleotide binding domain
PF04879 Molybdopterin oxidoreductase Fe4S4 domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0243 Energy production and conversion (C) C Anaerobic selenocysteine-containing dehydrogenase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07306 anaerobic dimethyl sulfoxide reductase subunit A [EC:1.8.5.3] Sulfur metabolism
Metabolic pathways		 -

Protein Sequence

MTKIKETALFTAPLTRRGFVKATGAAGGLAVAAGGLSLPFSHAASAADSTPAAAPQEKIVWSACTVNCGSRCPLRMHVTDGEIRYVETDNTGDDNYEEFHQVRACLRGRSMRRRVYNPDRLKYPMKRVGKRGENKFERISWEEAFDTIAGTMKRLISDYGNESIYLNYGTGTLGGTMTKSWPPGATLIARLMNCCGGYLNHYGDYSTAQIAAGLNYTYGGWADGNSPSDIENSKLVVMFGNNPGETRMSGGGVTYYVEQAREKSNARMIIIDPRYTDTGAGREDEWIPIRPGTDAALISALAYVMINEDLVDKPFLDKYCVGYDETTMPAGAPENGHYKAYILGQGADGVAKTPEWAAKITGIPAARIVKLAREIGTAKPAYITQGWGPQRRSNGETASRAISMLSILTGNVGINGGNTGAREGSYAIPFVRMPTLTNPVETSISMFMWTDAILRGKEMTATRDGVRGKDKLDVPIKMVWNYAGNCLVNQHSDINRTHDILQDDTKCEMIVVIDNHLTSSAKYADIILPDCTASEQMDFCMDASAGNMGYVIFADQAIAPRFESRNIYDMTSEIAKRMGVGDEFTENRTQEEWLRHLYEQSRAALPELPEFDEFRKQGMFKKRDPQGHHVAYRAFREDPQANPLTTPSGKIEIYSSQLAEIQKTWELSEGDEIHPLPVYAAGFEHGGDPLMEKYPLQMTGFHYKSRTHSTYGNVDVLQAACPQELWINPADAAKRGIAQGDKVRIFNDRGEVRVNVKVTPRILPGVVGLGEGAWYSPDGNRIDHAGSINVLTTQRPSPLAKGNPSHSNLVEVVKA

Flanking regions ( +/- flanking 50bp)

CCACGATAACAATAACGACGATAACAAAATTAATTAAGCGAGCAATGTATATGACGAAAATTAAAGAAACGGCGTTGTTCACTGCACCGCTGACACGACGGGGGTTTGTCAAAGCCACCGGGGCTGCCGGCGGATTAGCCGTCGCAGCCGGTGGATTATCACTTCCTTTCAGTCATGCAGCCTCTGCGGCAGATAGCACACCAGCAGCAGCGCCACAGGAAAAAATTGTCTGGAGTGCCTGTACAGTCAACTGCGGCAGCCGTTGTCCGCTGCGTATGCATGTGACTGACGGCGAAATCAGATATGTCGAAACCGATAATACGGGCGATGATAATTACGAAGAATTTCATCAGGTTCGCGCCTGTCTGCGCGGGCGCTCAATGCGCCGCCGTGTTTATAATCCCGATCGCCTGAAATACCCGATGAAACGCGTGGGTAAACGTGGTGAAAATAAATTTGAACGGATAAGCTGGGAAGAAGCGTTTGATACTATCGCCGGCACCATGAAACGTTTGATCAGTGATTACGGCAATGAATCTATTTATCTGAACTATGGTACCGGGACACTCGGCGGCACCATGACTAAATCCTGGCCGCCGGGAGCGACTCTGATCGCCCGTCTGATGAACTGTTGCGGCGGTTATCTTAACCATTATGGCGACTACAGTACCGCGCAGATAGCAGCGGGTCTGAATTATACCTACGGCGGTTGGGCAGATGGTAACAGCCCGTCAGATATCGAAAACAGCAAGCTGGTGGTGATGTTCGGGAACAACCCGGGCGAAACCCGTATGAGCGGCGGCGGCGTAACCTACTATGTTGAGCAGGCACGCGAAAAATCAAATGCCCGCATGATTATCATTGACCCGCGTTATACTGATACCGGTGCCGGTCGTGAAGACGAATGGATCCCGATCCGTCCGGGAACTGATGCGGCACTGATCAGTGCGCTCGCTTATGTGATGATCAATGAAGATCTGGTGGATAAACCGTTCCTCGATAAATATTGCGTGGGTTATGACGAAACCACTATGCCTGCGGGTGCGCCGGAAAACGGGCACTATAAAGCCTACATTTTAGGTCAGGGTGCGGACGGTGTGGCGAAAACACCTGAATGGGCAGCAAAAATCACCGGTATTCCGGCAGCCAGAATTGTAAAACTGGCGCGTGAAATCGGAACAGCAAAACCGGCTTATATTACACAAGGCTGGGGTCCGCAGCGCCGCTCAAACGGCGAAACTGCATCGCGGGCAATCTCAATGCTGTCTATTCTGACCGGCAATGTGGGGATTAATGGCGGAAATACCGGCGCGCGCGAAGGCTCTTATGCCATCCCGTTTGTCCGTATGCCGACACTGACCAATCCGGTGGAAACCAGTATCTCCATGTTTATGTGGACTGACGCTATCCTGCGCGGCAAAGAAATGACCGCGACCCGCGATGGTGTACGCGGCAAAGACAAGCTGGATGTGCCGATCAAAATGGTCTGGAACTATGCCGGTAACTGTCTGGTTAATCAGCATTCTGATATCAACCGCACTCATGACATTCTTCAGGATGACACCAAGTGCGAGATGATTGTGGTTATCGACAATCACCTGACGTCTTCTGCAAAATATGCCGATATTATCCTGCCGGACTGTACTGCATCTGAGCAGATGGATTTTTGTATGGATGCGTCTGCGGGCAACATGGGATATGTGATTTTTGCAGACCAGGCTATCGCACCGCGTTTTGAAAGCCGCAATATCTATGACATGACCAGTGAAATAGCCAAACGTATGGGTGTCGGTGACGAATTCACCGAAAACCGTACTCAGGAAGAGTGGTTGCGCCATCTCTATGAGCAATCCAGAGCGGCATTGCCGGAACTGCCGGAGTTTGATGAGTTCCGCAAACAAGGTATGTTCAAAAAACGCGATCCGCAGGGGCATCATGTGGCGTACCGCGCTTTCCGTGAAGATCCGCAGGCAAATCCGCTGACCACGCCATCGGGAAAAATCGAGATCTATTCATCTCAGTTGGCTGAGATCCAGAAAACCTGGGAACTCAGTGAAGGTGATGAAATTCATCCGCTGCCGGTATATGCCGCCGGGTTTGAACACGGTGGTGATCCGTTAATGGAAAAATACCCGTTACAGATGACCGGTTTCCATTACAAATCCCGCACGCACTCAACTTACGGCAATGTGGATGTCTTGCAGGCAGCCTGCCCGCAGGAATTGTGGATAAACCCGGCGGATGCCGCGAAACGCGGAATTGCACAGGGTGACAAGGTGCGGATCTTTAACGACCGTGGCGAAGTCCGCGTCAATGTGAAAGTCACACCGCGCATTCTGCCGGGTGTCGTCGGACTGGGTGAAGGCGCATGGTACAGCCCGGATGGTAATCGTATCGACCACGCGGGCAGCATTAACGTGTTAACCACTCAGCGCCCGTCGCCGCTGGCGAAAGGGAACCCGTCCCACTCCAACCTTGTTGAAGTCGTTAAGGCCTGAGGAAGCGAATTATGTCAACGCAATATGGTTTCTACATTGATTCAAGTCGC