Homologs in group_993

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05510 FBDBKF_05510 53.3 Morganella morganii S1 uup ATPase components of ABC transporters with duplicated ATPase domains
EHELCC_12080 EHELCC_12080 53.3 Morganella morganii S2 uup ATPase components of ABC transporters with duplicated ATPase domains
NLDBIP_12420 NLDBIP_12420 53.3 Morganella morganii S4 uup ATPase components of ABC transporters with duplicated ATPase domains
LHKJJB_12280 LHKJJB_12280 53.3 Morganella morganii S3 uup ATPase components of ABC transporters with duplicated ATPase domains
HKOGLL_10895 HKOGLL_10895 53.3 Morganella morganii S5 uup ATPase components of ABC transporters with duplicated ATPase domains
F4V73_RS03795 F4V73_RS03795 52.5 Morganella psychrotolerans - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_993

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_993

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O05519 1.24e-44 169 29 17 543 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.22e-17 89 30 6 222 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
P39115 4.87e-40 155 28 16 499 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 4.73e-10 65 32 6 164 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 3.88e-09 62 27 6 193 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P63389 4.61e-38 151 28 18 525 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 2.25e-08 60 30 4 130 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 4.61e-38 151 28 18 525 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 2.25e-08 60 30 4 130 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 7.47e-38 150 28 18 525 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 2.35e-08 60 30 4 130 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P43672 4.79e-37 148 29 18 508 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 2.74e-09 63 26 9 302 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 2.85e-07 57 46 2 67 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O34512 3.17e-35 141 28 21 532 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 4.97e-12 72 29 8 213 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q57242 2.72e-34 140 28 18 502 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 2.31e-09 63 33 8 186 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 2.85e-07 57 30 8 231 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A9U3 5.96e-34 138 27 19 543 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 2.16e-11 69 26 6 225 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 5.96e-34 138 27 19 543 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 2.16e-11 69 26 6 225 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 5.96e-34 138 27 19 543 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 2.16e-11 69 26 6 225 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q9FIB4 1.35e-33 138 28 18 533 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 5.51e-15 81 28 4 200 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q66H39 6.16e-33 136 27 16 535 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 1.47e-08 61 26 5 185 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q9LV93 1.97e-32 135 29 18 535 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 1.57e-13 77 27 7 223 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q8K268 2.67e-32 134 26 16 536 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q5R9Z5 1.02e-31 133 26 16 536 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q9NUQ8 1.28e-31 132 26 16 541 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
P9WQK3 6.93e-31 129 26 14 513 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 6.93e-31 129 26 14 513 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45127 2.04e-30 128 26 16 548 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2VFI8 2.42e-29 125 27 17 535 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 6.19e-07 55 25 5 216 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 2.46e-29 125 27 17 535 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 5.88e-07 55 25 5 216 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 2.46e-29 125 27 17 535 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 5.88e-07 55 25 5 216 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 2.46e-29 125 27 17 535 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 5.88e-07 55 25 5 216 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0DX93 2.54e-29 124 26 14 499 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 2.87e-06 53 27 5 176 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 0.000596 46 23 6 206 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
O06476 7.95e-29 124 26 23 542 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 1.47e-07 57 29 10 226 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 1.88e-05 51 26 6 190 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q8T6B7 6.96e-28 120 24 15 546 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 2.93e-10 66 26 5 207 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
P25256 2.48e-27 119 26 17 527 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 6.98e-08 58 31 8 215 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P23212 3.06e-27 118 26 21 540 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 3.08e-12 72 34 5 164 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
O42943 7.73e-27 117 26 18 520 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8H0V6 3.68e-26 116 27 11 396 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 5.14e-11 68 28 5 199 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
O31716 4.73e-26 115 24 21 550 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 3.56e-06 53 35 2 93 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q9FJH6 1.98e-25 113 25 14 510 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.24e-06 54 26 6 194 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q8K9I3 2.26e-25 113 27 20 499 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 8.87e-08 58 28 4 173 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9M1H3 2.54e-25 113 26 10 400 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 1.33e-11 70 33 6 173 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 2.5e-05 50 39 1 64 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q8T6B4 1.91e-23 108 26 11 374 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 3.05e-14 79 30 6 206 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 0.00017 48 40 1 64 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
P57445 1.77e-22 104 27 18 500 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P40024 4.71e-22 103 26 21 515 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 1.17e-07 58 29 6 196 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 9.26e-06 52 25 5 182 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q45978 9.8e-22 102 28 17 510 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9USH9 4.41e-20 97 26 14 396 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 2.59e-10 67 25 5 231 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P44808 5.09e-19 94 39 4 153 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 1.98e-15 82 31 10 244 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 1.38e-13 77 26 10 320 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 2.56e-09 63 32 3 178 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8SRV5 8.13e-19 93 25 20 509 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
O59672 1.2e-17 90 37 4 154 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 1.32e-10 67 28 7 194 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 1.14e-06 55 34 3 114 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 0.000154 48 35 1 68 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P45167 1.39e-17 89 28 12 342 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 3.75e-07 56 31 9 232 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43535 6.85e-15 81 35 3 144 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 8.35e-12 71 32 5 184 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 2.64e-06 53 27 9 243 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 0.000274 47 35 1 70 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q767L0 3.92e-14 79 24 14 511 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 0.000119 48 26 1 91 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
P12622 4.18e-14 76 26 10 301 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
Q7YR37 5.14e-14 78 25 15 512 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 0.000134 48 26 1 91 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q88RL1 3.6e-12 70 27 5 203 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 2.91e-07 55 28 7 166 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5NQX0 5.08e-12 68 33 5 162 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q99LE6 6.5e-12 71 30 6 215 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 3.45e-10 66 32 3 153 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 4.16e-05 50 25 7 190 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 4.69e-05 49 26 1 102 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q1IGY7 1.08e-11 68 26 5 203 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 4.4e-07 54 28 8 182 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q9UG63 1.94e-11 70 30 6 215 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 3.23e-10 66 32 3 153 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 8.43e-06 52 25 7 190 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 4.48e-05 50 26 1 102 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q2KJA2 3.78e-11 69 30 6 215 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 5.22e-10 65 32 3 153 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 4.64e-05 49 36 2 75 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 4.93e-05 49 26 1 107 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q4ZZS2 3.99e-11 67 30 3 169 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 1.46e-06 53 27 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
O57872 5.49e-11 66 27 8 212 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57872 0.000326 46 26 6 188 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q87UN0 1.12e-10 65 29 3 169 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 1.53e-07 56 29 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1JRI2 1.46e-10 65 27 8 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 4.55e-08 57 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q48PV0 1.7e-10 65 30 4 169 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 2.78e-07 55 28 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q042G7 2.56e-10 65 25 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q4KKK4 2.57e-10 64 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 2.79e-06 52 27 7 166 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q74K65 3.03e-10 65 25 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q03ZQ0 4.3e-10 65 22 6 249 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P45275 4.43e-10 63 30 5 183 3 HI_1618 Uncharacterized ABC transporter ATP-binding protein HI_1618 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0RP01 4.58e-10 65 25 8 232 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter fetus subsp. fetus (strain 82-40)
Q72D73 4.95e-10 63 33 6 178 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q3KKA1 5.16e-10 63 28 3 169 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 3.11e-06 52 28 7 166 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q884D4 6.47e-10 65 28 8 189 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q92L55 6.91e-10 62 29 3 158 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium meliloti (strain 1021)
Q92L55 0.000296 45 24 7 202 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium meliloti (strain 1021)
Q3KF57 7e-10 65 29 8 188 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain Pf0-1)
Q9JXR3 7.5e-10 65 28 8 207 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW59 8.33e-10 65 27 8 207 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9WXX8 8.38e-10 62 30 6 172 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 3.4e-06 52 26 7 175 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6D4A8 9.05e-10 62 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 5.04e-08 57 27 8 203 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4ZV10 9.25e-10 65 27 9 223 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas syringae pv. syringae (strain B728a)
Q9I6T2 9.55e-10 63 27 5 220 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6T2 0.000108 48 27 7 177 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8U4L3 9.94e-10 62 28 8 202 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q31I51 1.18e-09 62 29 6 196 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5F4X8 1.19e-09 64 25 9 236 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A5U7B7 1.86e-09 61 29 6 185 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P57032 2.01e-09 61 26 6 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
Q6NDA6 2.13e-09 60 28 4 153 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
O05779 2.17e-09 61 29 6 185 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4L8L7 2.22e-09 61 27 7 205 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q4L8L7 0.000232 46 27 7 183 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q555Z5 2.24e-09 63 30 10 210 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q6D606 2.53e-09 60 27 6 198 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D606 1.3e-05 49 28 5 167 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P47425 2.77e-09 61 24 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47425 1.75e-05 50 26 8 184 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q4K681 2.82e-09 62 26 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K681 9.49e-05 48 28 8 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7VWD8 2.85e-09 63 28 8 208 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W9N7 2.85e-09 63 28 8 208 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 2.85e-09 63 28 8 208 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0A9E2 2.85e-09 61 30 5 181 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 3.29e-06 52 31 8 154 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q87EF4 2.9e-09 61 25 3 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q6D2F6 2.96e-09 62 25 7 234 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8RD07 3e-09 61 29 6 188 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 1.29e-08 59 26 4 179 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1GIE5 3.08e-09 62 25 9 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q4K9A4 3.13e-09 63 28 8 188 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q92NU9 3.29e-09 63 26 6 195 3 macB Macrolide export ATP-binding/permease protein MacB Rhizobium meliloti (strain 1021)
Q5FL41 4.46e-09 62 26 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q1GS38 5.02e-09 59 28 4 151 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q1GS38 8.02e-07 53 27 4 161 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
P78966 5.37e-09 62 31 7 170 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 1.21e-08 61 29 5 196 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.38e-09 62 30 6 166 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 9.89e-07 55 28 7 178 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.07e-06 55 37 1 66 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 9.02e-06 52 28 2 117 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q88F88 5.78e-09 62 28 8 188 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q48KB2 7.32e-09 62 28 9 188 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P63402 8e-09 60 31 10 193 3 BQ2027_MB2593 Uncharacterized ABC transporter ATP-binding protein Mb2593 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQI5 8e-09 60 31 10 193 1 Rv2564 Uncharacterized ABC transporter ATP-binding protein Rv2564 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI4 8e-09 60 31 10 193 3 MT2640 Uncharacterized ABC transporter ATP-binding protein MT2640 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P13568 9.04e-09 62 23 8 230 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
Q04G50 9.86e-09 60 23 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q2SPI3 1.06e-08 59 33 9 166 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 9.72e-05 47 26 3 169 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q9V2E4 1.21e-08 59 27 8 195 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q08972 1.24e-08 61 28 6 208 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.34e-05 52 39 1 66 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.67e-05 51 26 5 151 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 4.09e-05 50 24 8 222 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2KYS6 1.48e-08 60 25 8 233 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q9WY65 1.49e-08 59 27 7 193 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q97KZ3 1.8e-08 58 27 6 190 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2RPB4 1.91e-08 60 28 7 203 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RPB4 1.14e-05 52 31 10 190 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O28437 1.94e-08 58 30 7 193 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0A9U0 2.18e-08 58 30 6 192 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 2.18e-08 58 30 6 192 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 2.18e-08 58 30 6 192 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
A0R6H8 2.24e-08 60 26 11 255 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6CX96 2.29e-08 60 26 8 206 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q66AT7 2.37e-08 58 27 8 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 2.41e-08 58 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJG3 2.37e-08 58 27 8 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 2.39e-08 58 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 2.37e-08 58 27 8 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 2.39e-08 58 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 2.37e-08 58 27 8 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 2.39e-08 58 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
P45032 2.51e-08 57 33 8 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45032 8.43e-06 50 25 6 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6KHL1 2.56e-08 58 24 6 215 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q2JGF5 2.58e-08 58 28 5 171 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
P53978 2.6e-08 60 38 1 92 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.43e-06 55 39 2 76 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 4.6e-06 53 28 6 159 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q981Y8 3.16e-08 58 32 7 182 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A0KPH6 3.33e-08 58 29 7 165 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 1.72e-07 56 28 9 211 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q03ZL5 3.35e-08 58 23 7 242 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P16521 3.43e-08 60 34 2 129 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.64e-07 55 35 4 103 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.66e-05 49 29 4 153 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HT73 3.5e-08 58 26 7 207 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 1.01e-07 57 31 8 162 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 3.5e-08 58 26 7 207 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 1.01e-07 57 31 8 162 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1I7I9 3.74e-08 59 28 8 188 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas entomophila (strain L48)
Q31FG2 4.01e-08 59 26 6 208 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8TIW9 4.43e-08 58 31 7 195 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q97JB8 4.59e-08 58 25 8 209 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 1.69e-07 56 27 6 182 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5WCI1 4.66e-08 57 31 9 177 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q3J7R8 5.02e-08 59 29 7 207 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6F1W5 5.61e-08 58 26 7 212 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q8PZN0 5.88e-08 58 26 7 212 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2G9A9 5.93e-08 56 26 5 176 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q2G9A9 3.01e-05 48 27 4 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q6F0V4 6.22e-08 58 26 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q1RGL1 6.41e-08 57 28 7 175 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q2J3F7 6.51e-08 56 27 4 152 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain HaA2)
Q2J3T0 7.21e-08 57 32 3 146 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q75EV6 7.32e-08 58 28 6 198 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 8.37e-07 55 35 4 103 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 5.01e-05 50 28 4 153 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q1WVI7 7.63e-08 58 25 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q68VV5 7.65e-08 56 26 5 197 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8CRI7 7.66e-08 57 28 8 199 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q668L6 7.82e-08 58 28 8 188 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q5HM28 7.87e-08 57 28 8 199 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8NE71 8e-08 58 26 6 212 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.4e-05 51 37 1 66 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 0.000115 48 31 4 154 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 0.000147 48 26 1 91 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q0BUR6 8.11e-08 57 30 5 171 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q7CJG3 8.38e-08 58 28 8 188 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q1C5W7 8.38e-08 58 28 8 188 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CJW8 8.38e-08 58 28 8 188 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q2KBP5 8.9e-08 56 25 5 174 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A0LCH8 8.9e-08 57 28 7 180 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 6.58e-07 54 31 9 172 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q6MU19 8.93e-08 57 25 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9SIT6 9.1e-08 58 23 12 332 2 ABCG5 ABC transporter G family member 5 Arabidopsis thaliana
Q65V02 9.1e-08 56 31 9 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65V02 0.000168 46 23 7 212 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5WBL0 9.21e-08 56 25 7 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 3.89e-07 55 31 8 185 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
P9WQM1 9.34e-08 57 29 11 235 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 9.34e-08 57 29 11 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 9.34e-08 57 29 11 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7N3Q4 9.45e-08 57 31 7 171 3 btuD Vitamin B12 import ATP-binding protein BtuD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8RHL0 9.67e-08 57 24 5 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2VZJ1 9.8e-08 56 28 6 179 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2SSS4 1.07e-07 57 25 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P94367 1.09e-07 58 29 7 220 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
E7F6F7 1.09e-07 58 24 7 265 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q0I3C2 1.12e-07 56 27 7 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q1Q889 1.14e-07 56 29 5 168 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P40416 1.14e-07 58 26 8 200 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6FIK3 1.2e-07 58 28 9 200 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B2GUP8 1.26e-07 58 26 4 201 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q704E8 1.33e-07 58 24 8 266 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q884I3 1.38e-07 55 30 8 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1WXT0 1.38e-07 56 31 7 154 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 1.43e-07 56 26 4 174 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q9I190 1.39e-07 58 28 9 188 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02MI4 1.39e-07 58 28 9 188 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3IWB5 1.41e-07 56 31 8 167 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 1.43e-06 53 25 5 175 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q61102 1.43e-07 58 24 6 254 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
Q4QLJ9 1.45e-07 55 33 8 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus influenzae (strain 86-028NP)
Q4QLJ9 4.57e-05 48 25 6 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus influenzae (strain 86-028NP)
Q89AJ0 1.46e-07 56 29 7 156 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q73R11 1.47e-07 57 29 6 175 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P72297 1.52e-07 56 29 10 209 3 occP Octopine permease ATP-binding protein P Rhizobium meliloti
Q751N2 1.56e-07 57 26 5 214 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q3K9F9 1.62e-07 55 27 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 1.63e-07 57 25 9 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q97WH0 1.68e-07 57 30 4 110 3 rad50 DNA double-strand break repair Rad50 ATPase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q2FRT7 1.68e-07 57 29 9 219 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q1QE80 1.73e-07 57 25 7 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0C1N8 1.81e-07 57 28 8 202 3 macB Macrolide export ATP-binding/permease protein MacB Hyphomonas neptunium (strain ATCC 15444)
P25997 1.84e-07 57 27 6 194 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 9.3e-07 55 35 4 103 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 0.000149 48 28 3 146 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q57538 1.89e-07 57 24 9 221 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57538 0.000145 48 26 10 205 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q73XU8 1.91e-07 57 28 11 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q57213 1.91e-07 55 32 7 170 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6AMR9 1.95e-07 55 26 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Desulfotalea psychrophila (strain LSv54 / DSM 12343)
O93796 1.97e-07 57 36 1 92 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.37e-06 55 35 4 103 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 0.00016 48 26 5 156 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4A8A2 2.01e-07 56 26 5 193 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mesomycoplasma hyopneumoniae (strain 7448)
Q601T5 2.01e-07 56 26 5 193 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mesomycoplasma hyopneumoniae (strain 232)
Q16BC5 2.02e-07 55 29 5 161 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A1JPQ1 2.11e-07 55 33 8 171 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JPQ1 0.000402 45 27 8 242 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
H2LNR5 2.21e-07 57 24 8 266 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
Q03AH0 2.3e-07 56 24 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03AH0 0.000102 48 29 10 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8TK65 2.31e-07 57 25 7 212 3 MA_3551 Putative ABC transporter ATP-binding protein MA_3551 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8Y8T6 2.35e-07 56 21 9 298 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O83658 2.36e-07 56 28 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q5H0G3 2.38e-07 55 25 4 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E1 2.38e-07 55 25 4 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
O34314 2.38e-07 55 31 9 180 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q7MJ07 2.49e-07 57 27 10 238 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q0RT43 2.53e-07 55 32 7 158 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8ELR4 2.61e-07 56 24 10 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0S0X2 2.72e-07 55 29 6 172 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 3.4e-06 52 27 4 167 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
A5F1V0 2.75e-07 55 31 8 186 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8H1R4 2.77e-07 55 30 7 166 1 ABCI10 ABC transporter I family member 10 Arabidopsis thaliana
Q9X196 2.93e-07 56 25 4 159 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q20ZS6 3e-07 55 26 6 192 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q7MMN0 3.02e-07 55 29 6 162 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 2.71e-06 52 27 8 205 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 3.02e-07 55 29 6 162 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 2.71e-06 52 27 8 205 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
O94489 3.06e-07 57 28 6 157 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.36e-06 55 35 2 93 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.92e-05 51 35 5 110 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q823C4 3.38e-07 55 29 7 188 3 metN Methionine import ATP-binding protein MetN Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q3BTD3 3.5e-07 55 25 7 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q2HIE9 3.63e-07 56 27 3 201 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P9WQK5 3.8e-07 55 30 7 186 1 Rv0073 Uncharacterized ABC transporter ATP-binding protein Rv0073 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK4 3.8e-07 55 30 7 186 3 MT0079 Uncharacterized ABC transporter ATP-binding protein MT0079 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4WD46 3.84e-07 57 28 7 201 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9PPV1 3.87e-07 55 23 8 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q7ANN4 3.88e-07 56 31 2 97 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
Q492R2 4.03e-07 54 30 7 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
Q492R2 0.000636 45 28 9 172 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
Q9Y7M7 4.03e-07 56 25 6 204 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q0BV49 4.12e-07 55 28 5 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q8DAV2 4.24e-07 56 27 10 238 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q6P542 4.26e-07 56 26 5 211 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 1.78e-05 51 37 1 66 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 2.15e-05 51 27 1 91 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 0.000188 48 31 4 154 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
A1K323 4.35e-07 56 27 9 190 3 macB Macrolide export ATP-binding/permease protein MacB Azoarcus sp. (strain BH72)
P59852 4.53e-07 56 26 6 221 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
P55476 4.78e-07 55 25 6 243 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 0.000206 47 29 7 175 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7A3X3 4.86e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 4.86e-07 54 35 2 78 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9FLX5 4.9e-07 56 28 12 257 2 ABCG8 ABC transporter G family member 8 Arabidopsis thaliana
Q9FLX5 2.51e-05 50 30 7 189 2 ABCG8 ABC transporter G family member 8 Arabidopsis thaliana
Q6GE75 4.95e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q722B1 5e-07 55 20 9 298 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q8EB59 5.04e-07 54 32 9 173 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P29551 5.17e-07 56 36 3 96 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 4.4e-06 53 28 5 156 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 3.4e-05 50 40 1 66 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q1GJU0 5.18e-07 54 29 9 202 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q8NV47 5.23e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 5.23e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 5.23e-07 54 35 2 78 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 5.23e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 5.23e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 5.23e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q0I2G0 5.32e-07 53 30 8 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Histophilus somni (strain 129Pt)
Q0I2G0 1.39e-05 49 27 5 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Histophilus somni (strain 129Pt)
Q2YZ26 5.33e-07 54 35 2 78 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2SRI1 5.34e-07 55 26 9 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SRI1 0.000134 48 23 9 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q8XXY9 5.39e-07 55 24 4 186 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 4.13e-05 49 29 8 184 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5E3S7 5.41e-07 53 26 7 196 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8PY26 5.49e-07 55 25 8 253 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P72335 5.55e-07 55 26 5 210 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q92DL6 5.56e-07 55 21 8 294 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q1LX78 5.61e-07 56 29 3 171 1 cftr Cystic fibrosis transmembrane conductance regulator Danio rerio
Q7MFH3 5.74e-07 55 29 7 185 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8PYH5 5.81e-07 55 32 8 177 3 MM_0887 Putative ABC transporter ATP-binding protein MM_0887 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P22638 5.97e-07 55 24 7 206 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q87JM4 5.99e-07 55 27 6 187 3 macB Macrolide export ATP-binding/permease protein MacB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q32I01 6.01e-07 53 26 4 201 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q1CHI9 6.02e-07 53 26 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CHI9 0.000811 44 28 7 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD58 6.02e-07 53 26 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q8ZD58 0.000811 44 28 7 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q1C647 6.02e-07 53 26 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C647 0.000811 44 28 7 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q8PKT0 6.26e-07 54 25 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
P50332 6.35e-07 55 28 6 181 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 0.00064 45 31 8 176 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q2SJ99 6.37e-07 55 25 4 184 3 rbsA Ribose import ATP-binding protein RbsA Hahella chejuensis (strain KCTC 2396)
Q4KFA2 6.4e-07 53 29 8 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q66AF5 6.4e-07 55 26 6 198 3 araG Arabinose import ATP-binding protein AraG Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CIX6 6.4e-07 55 26 6 198 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WER5 6.4e-07 55 26 6 198 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis
Q1C7J0 6.4e-07 55 26 6 198 3 araG Arabinose import ATP-binding protein AraG Yersinia pestis bv. Antiqua (strain Antiqua)
F2RPA4 6.45e-07 56 24 5 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q4AA75 6.45e-07 54 25 5 193 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
P75370 6.5e-07 54 25 7 187 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 0.000221 46 21 7 226 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q98HF7 6.54e-07 55 25 7 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q21GS5 6.61e-07 55 30 11 215 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q3Z2Z3 6.79e-07 55 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 6.79e-07 55 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
C3LLU1 6.89e-07 54 31 8 186 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 6.89e-07 54 31 8 186 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q92WJ0 7.3e-07 55 25 10 236 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q8D3Z9 7.45e-07 55 29 7 185 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q5X627 7.6e-07 55 24 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q478L3 7.72e-07 53 28 7 178 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Dechloromonas aromatica (strain RCB)
Q5HVG3 7.76e-07 55 23 5 195 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni (strain RM1221)
Q885N4 7.91e-07 54 30 9 189 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A0KGB3 7.94e-07 55 28 9 210 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O34946 8.05e-07 53 24 5 187 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q9ZCF9 8.38e-07 53 25 5 197 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rickettsia prowazekii (strain Madrid E)
Q0PAR0 8.39e-07 55 23 5 195 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9LZB8 8.49e-07 55 26 8 252 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
P06611 8.83e-07 53 32 8 181 1 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12)
B1XG16 8.83e-07 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / DH10B)
C4ZYH1 8.83e-07 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / MC4100 / BW2952)
Q3Z2L6 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 9e-07 53 26 8 214 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 1.56e-06 53 30 8 176 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 9e-07 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 1.56e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
O34392 9e-07 53 26 6 183 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 2.29e-06 52 26 8 194 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q82VK1 9.11e-07 55 28 7 189 3 macB Macrolide export ATP-binding/permease protein MacB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7TNJ2 9.22e-07 55 26 2 173 1 Abca7 ATP-binding cassette sub-family A member 7 Rattus norvegicus
Q668T8 9.24e-07 53 26 5 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668T8 0.00013 47 28 7 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q63VX7 9.29e-07 55 28 6 207 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 9.29e-07 55 28 6 207 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 9.29e-07 55 28 6 207 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
Q1IKM7 9.36e-07 53 30 11 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q1MAL7 9.42e-07 53 27 5 175 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A1VYW8 9.55e-07 55 23 5 195 3 macB Macrolide export ATP-binding/permease protein MacB Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A0L0V9 9.57e-07 55 25 5 187 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella sp. (strain ANA-3)
Q3ARY3 9.91e-07 53 27 8 211 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium chlorochromatii (strain CaD3)
Q8KLG1 9.92e-07 54 24 3 204 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A0AGP9 9.99e-07 54 20 9 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8UC12 1e-06 53 27 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q87RE5 1.01e-06 53 27 6 206 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 1.17e-05 50 30 6 156 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P30963 1.02e-06 52 28 5 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q32HA3 1.02e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 4.12e-06 52 27 8 207 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
P0CU83 1.03e-06 55 24 5 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
O75027 1.03e-06 55 23 6 254 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q13DS7 1.03e-06 52 27 5 162 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q1ARR5 1.08e-06 55 26 5 194 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q58429 1.08e-06 53 26 5 165 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q28VN1 1.1e-06 53 32 8 158 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 2.73e-06 52 26 7 182 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q8CPN0 1.11e-06 54 24 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q146E7 1.11e-06 53 32 7 165 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q8Z5W6 1.14e-06 53 30 9 177 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 3.56e-06 52 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q480N3 1.16e-06 55 26 10 224 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5HQ70 1.17e-06 54 24 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q66EN1 1.17e-06 53 33 9 176 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pseudotuberculosis serotype I (strain IP32953)
Q21WN9 1.18e-06 55 27 5 195 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1VZQ5 1.18e-06 53 24 5 186 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A0A059JK44 1.19e-06 55 24 5 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
Q81J16 1.19e-06 53 28 8 204 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1RB86 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain UTI89 / UPEC)
Q8FH28 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THB9 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABP5 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O1:K1 / APEC
B7MV91 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O81 (strain ED1a)
B7MAS0 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US48 1.2e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P33311 1.2e-06 55 26 10 232 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0P9X7 1.2e-06 53 24 5 186 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q92G95 1.25e-06 52 27 4 161 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rickettsia conorii (strain ATCC VR-613 / Malish 7)
F2Q5G0 1.26e-06 55 24 5 205 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q97UY8 1.28e-06 54 25 10 232 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6MSQ1 1.38e-06 54 26 9 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MSQ1 0.000314 47 23 9 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q7VN12 1.39e-06 52 26 5 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P37624 1.4e-06 55 26 7 234 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 0.000709 46 24 8 241 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q890D1 1.41e-06 53 31 7 177 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B2U358 1.42e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z257 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella sonnei (strain Ss046)
Q7C1M3 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri
Q0T4R9 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri serotype 5b (strain 8401)
Q32FJ0 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella dysenteriae serotype 1 (strain Sd197)
B1LE21 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SMS-3-5 / SECEC)
B6I8R4 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SE11)
B7N547 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPL8 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q1 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O9:H4 (strain HS)
B7M1B8 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O8 (strain IAI1)
B7NTS2 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L6I2 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain 55989 / EAEC)
A7ZMH7 1.44e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8G358 1.46e-06 52 27 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella suis biovar 1 (strain 1330)
Q57FS7 1.46e-06 52 27 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus biovar 1 (strain 9-941)
Q2YNU0 1.46e-06 52 27 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella abortus (strain 2308)
B5YPZ7 1.46e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5W0 1.46e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7
Q8YEM5 1.49e-06 52 27 5 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q83KR7 1.49e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 1.5e-06 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.49e-06 53 30 8 176 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 1.5e-06 53 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
B5QVV9 1.5e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella enteritidis PT4 (strain P125109)
Q7M8U0 1.51e-06 54 26 7 188 3 macB Macrolide export ATP-binding/permease protein MacB Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q49ZT6 1.53e-06 52 33 2 81 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B5BA33 1.59e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain AKU_12601)
Q5PH81 1.59e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P23886 1.6e-06 54 29 4 207 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q4FQ27 1.62e-06 53 29 5 168 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2SRI2 1.64e-06 53 24 9 212 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q91V24 1.64e-06 55 26 2 173 1 Abca7 ATP-binding cassette sub-family A member 7 Mus musculus
E9PU17 1.64e-06 55 31 7 180 2 Abca17 ATP-binding cassette sub-family A member 17 Rattus norvegicus
Q9HYG4 1.64e-06 53 33 7 160 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q321G6 1.65e-06 53 32 8 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 4 (strain Sb227)
P69877 1.66e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.66e-06 53 25 9 231 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.66e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.66e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.66e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q4KG27 1.66e-06 52 30 7 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KG27 5.63e-06 50 31 5 161 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P63351 1.71e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63352 1.71e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhi
B4TGI0 1.71e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella heidelberg (strain SL476)
B5FJ99 1.71e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella dublin (strain CT_02021853)
Q57PU4 1.71e-06 53 30 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella choleraesuis (strain SC-B67)
Q5WKG4 1.73e-06 53 24 8 245 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 2.43e-06 52 31 7 163 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
P0A2U7 1.73e-06 52 24 5 190 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 1.73e-06 52 24 5 190 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9WYI7 1.74e-06 52 26 7 200 3 TM_0352 Uncharacterized ABC transporter ATP-binding protein TM_0352 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1RD28 1.76e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.76e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q8PKS5 1.79e-06 54 26 7 211 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q6LTB1 1.79e-06 53 25 6 213 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 0.000244 46 30 6 153 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q7UPK3 1.79e-06 53 22 7 225 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7A169 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.8e-06 53 23 6 210 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.8e-06 53 23 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q32EY4 1.81e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1MEG2 1.88e-06 53 32 7 164 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MEG2 5.37e-05 48 27 4 170 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q7NZU6 1.9e-06 54 25 5 211 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q58967 1.92e-06 53 28 7 181 3 MJ1572 Putative ABC transporter ATP-binding protein MJ1572 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8GNH6 1.97e-06 53 24 6 215 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q8GNH6 9.25e-05 48 30 7 176 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
P29959 1.98e-06 52 29 2 138 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q73F67 2e-06 53 27 10 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9KQW9 2.02e-06 54 27 6 204 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8X4L6 2.06e-06 53 27 9 250 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
P45247 2.1e-06 52 30 8 163 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 2.1e-06 52 30 8 163 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q7VMF9 2.1e-06 54 25 5 183 3 macB Macrolide export ATP-binding/permease protein MacB Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5ZWE4 2.11e-06 53 23 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8NVB5 2.14e-06 52 28 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MW2)
Q6G799 2.14e-06 52 28 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MSSA476)
Q6YRJ4 2.16e-06 53 29 7 196 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 0.000216 47 25 4 175 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6HPN0 2.19e-06 53 27 8 204 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 2.19e-06 53 27 8 204 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 2.19e-06 53 27 8 204 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q5PMK1 2.32e-06 53 24 9 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P44513 2.32e-06 53 27 9 213 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40790 2.34e-06 53 24 9 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.34e-06 53 24 9 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q0T5R2 2.36e-06 53 25 9 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q73L25 2.36e-06 52 30 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73L25 5.42e-05 48 21 6 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q7A470 2.36e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 2.36e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q3BTC8 2.38e-06 53 25 6 210 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q03727 2.38e-06 53 23 4 199 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1CMQ3 2.39e-06 52 32 9 176 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 2.39e-06 52 32 9 176 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 2.39e-06 52 32 9 176 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q6MSQ2 2.4e-06 53 24 9 214 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
O57896 2.43e-06 53 28 7 171 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8EIL8 2.46e-06 53 25 5 187 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7NIW1 2.49e-06 53 28 7 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5P6D5 2.5e-06 53 27 8 192 3 macB Macrolide export ATP-binding/permease protein MacB Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q48FT0 2.52e-06 52 31 8 174 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q6GEL3 2.54e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q6MD10 2.55e-06 52 25 3 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q8Z7H7 2.56e-06 53 24 9 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q2IF17 2.63e-06 52 23 6 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaeromyxobacter dehalogenans (strain 2CP-C)
Q6XYZ3 2.7e-06 52 22 4 202 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Spiroplasma kunkelii
Q110U3 2.77e-06 53 25 5 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q110U3 2.46e-05 50 28 8 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q2YYM4 2.83e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8U648 2.84e-06 52 29 7 171 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8E8K8 2.98e-06 53 24 5 207 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q50294 3.05e-06 52 25 8 189 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50294 0.000137 47 24 8 196 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P40735 3.09e-06 52 25 6 192 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
A3CRB8 3.1e-06 52 25 9 222 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
Q5PIA5 3.13e-06 52 30 9 177 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 3.4e-06 52 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 3.13e-06 52 30 9 177 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 3.4e-06 52 26 8 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q5WXF0 3.19e-06 53 24 6 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q2Y9Q1 3.2e-06 51 28 7 166 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q30V33 3.22e-06 53 22 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q63H62 3.27e-06 52 29 8 196 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q5HDY6 3.31e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 3.31e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 3.31e-06 52 27 6 180 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
D0MYB4 3.31e-06 53 35 3 105 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 2.58e-05 50 39 1 61 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 0.000134 48 27 7 162 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
Q1IGL4 3.36e-06 52 31 7 176 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q12ES3 3.41e-06 51 29 8 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
P53706 3.64e-06 53 25 7 220 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
A1U776 3.65e-06 52 31 6 156 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8VNL9 3.68e-06 52 23 7 242 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q8LPJ4 3.75e-06 53 25 6 181 2 ABCE2 ABC transporter E family member 2 Arabidopsis thaliana
P26362 3.87e-06 53 25 5 232 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
Q3M5J9 3.97e-06 52 28 11 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 6.11e-05 48 28 8 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4ZQE3 4e-06 52 30 9 189 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q160M2 4.04e-06 52 27 8 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A3CVD3 4.05e-06 52 27 6 191 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q65TB7 4.32e-06 51 25 7 184 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8ZNV7 4.52e-06 51 26 8 214 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 4.69e-06 51 30 9 177 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZR72 4.52e-06 53 21 7 273 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05370
Feature type CDS
Gene -
Product ATP-binding cassette domain-containing protein
Location 1175287 - 1176849 (strand: -1)
Length 1563 (nucleotides) / 520 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_993
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Protein Sequence

MTIACQFSQLNIEFNQEALFPPLTHSLTCQRNALIGQNGKGKSVLLKLLAQKLLPSSGHIMWRMPFIHVDQLTRLTGNTIADALGIETFFQAFKRVDNGSASLEDFELLEDKWHLPMTWQNLLHSAQLPVSLDTPIPHLSGGEQTRLALCQAFLHDDHFLLLDEPDNHLDHQGQQWLVEQLMHHKSGVLFISHNRHLLSYAENIFELSEKGLQEYGGNYSLYETQKNAQIASIEAANERINSQIKQEKRQQHVTLQKALQRRKQGEKIRNSGSQSLLLLDMQTNRAEKKQSSIAKRHQRVMDDMQSQKQQLEQELTHIHQQKLILNYQGDGHRLNVFATELVLPFGKQTPYSFSAYGGEHWHIQGKNGSGKSTLLKCLMGKLSPLSGEYRLNPNYCYLDQHLTLLDKSLPVAEALYQYQPLMTIEQWRTKLGMLRIRGNKSLFPLETLSGGEQLKATLLALIYSPQPPAVLLLDEPDNYLDLDSKQLLENLLSQYQGTLLLISHDEDFVKQCGITNTLLL

Flanking regions ( +/- flanking 50bp)

CTCAATTAAGATCATTGCTGTCTGCCACCTATTTTTTAGGAGGCTTAATTATGACGATCGCCTGTCAATTTTCTCAGCTTAATATTGAATTCAATCAAGAAGCGCTTTTCCCACCGCTGACTCATTCACTGACTTGCCAAAGAAATGCTTTAATTGGTCAGAACGGTAAAGGAAAATCGGTGCTGTTAAAATTGTTAGCACAAAAACTATTGCCTTCATCAGGCCATATCATGTGGCGTATGCCTTTTATTCATGTCGACCAGCTTACTCGCCTAACAGGTAATACCATTGCTGATGCTTTAGGTATAGAGACTTTTTTTCAAGCATTTAAGCGGGTTGATAACGGCAGTGCTTCATTAGAAGATTTTGAGTTACTTGAAGATAAGTGGCATTTGCCCATGACTTGGCAAAATTTACTTCATTCAGCACAACTGCCGGTTTCACTTGATACACCTATTCCCCACTTAAGTGGTGGTGAGCAAACGCGTTTAGCATTATGTCAGGCTTTTTTACATGACGATCATTTTCTATTATTAGATGAACCAGATAACCATCTCGATCATCAAGGTCAGCAATGGCTCGTTGAACAATTAATGCATCATAAATCAGGTGTATTATTTATTAGCCATAATCGACATTTATTATCTTATGCTGAAAATATATTTGAACTGAGTGAAAAAGGCTTACAAGAATATGGCGGTAATTATTCGCTTTATGAAACACAAAAAAATGCGCAAATAGCCTCAATCGAAGCTGCAAATGAGCGTATCAATAGTCAAATAAAACAGGAAAAACGCCAACAACATGTAACATTACAAAAAGCATTACAGCGACGTAAACAAGGTGAAAAGATAAGAAACAGCGGCTCTCAATCACTGTTACTTCTTGATATGCAAACCAATCGAGCTGAGAAAAAACAGTCATCAATAGCTAAACGACATCAGCGCGTTATGGATGATATGCAGTCACAAAAACAACAGTTAGAACAAGAGTTAACTCATATTCATCAGCAAAAATTAATATTAAACTATCAAGGCGATGGCCATCGGTTAAATGTATTTGCCACAGAGCTTGTTTTACCTTTTGGCAAGCAAACTCCCTACTCCTTTTCCGCTTATGGTGGTGAACATTGGCATATACAAGGTAAAAATGGCAGCGGTAAGTCAACCTTATTAAAATGTTTAATGGGCAAGCTATCCCCGTTATCCGGCGAATATCGTCTCAACCCAAATTATTGCTATCTTGATCAACATTTAACTTTATTAGATAAATCATTACCCGTTGCTGAAGCGTTATATCAATACCAGCCATTAATGACCATTGAGCAGTGGCGCACAAAACTGGGTATGTTACGTATTCGAGGTAACAAGTCTTTATTTCCTTTAGAAACACTCAGTGGCGGTGAGCAATTAAAAGCAACACTATTAGCATTAATTTATAGTCCTCAACCCCCTGCCGTTTTATTATTAGATGAACCAGATAATTATTTAGATTTAGACTCTAAACAATTATTGGAAAATTTATTATCTCAATATCAAGGAACATTATTATTAATCTCTCACGATGAAGATTTTGTTAAACAATGTGGTATAACAAATACATTATTACTCTAATAGCAACATACCAAACTAATTAGCCCCCAGGTTAAAACAGTATAGACGCT