Homologs in group_1060

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05510 FBDBKF_05510 79.7 Morganella morganii S1 uup ATPase components of ABC transporters with duplicated ATPase domains
EHELCC_12080 EHELCC_12080 79.7 Morganella morganii S2 uup ATPase components of ABC transporters with duplicated ATPase domains
NLDBIP_12420 NLDBIP_12420 79.7 Morganella morganii S4 uup ATPase components of ABC transporters with duplicated ATPase domains
LHKJJB_12280 LHKJJB_12280 79.7 Morganella morganii S3 uup ATPase components of ABC transporters with duplicated ATPase domains
HKOGLL_10895 HKOGLL_10895 79.7 Morganella morganii S5 uup ATPase components of ABC transporters with duplicated ATPase domains
PMI_RS05370 PMI_RS05370 52.5 Proteus mirabilis HI4320 - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_1060

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1060

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O05519 4.35e-47 176 31 21 547 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 7.54e-21 99 31 10 256 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O34512 1.13e-37 148 27 14 530 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 1.94e-06 54 25 7 191 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
P63389 2.65e-37 149 28 17 531 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 9.2e-15 80 30 5 195 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 4.47e-11 68 27 6 264 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 2.65e-37 149 28 17 531 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 9.2e-15 80 30 5 195 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 4.47e-11 68 27 6 264 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 5.23e-37 148 28 17 531 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 8.5e-15 80 30 5 195 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 4.13e-11 69 27 6 264 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5R9Z5 4.68e-33 137 28 20 508 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 1.05e-07 58 28 10 231 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q9NUQ8 5.28e-33 137 29 21 508 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 7.34e-07 55 27 8 230 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
P43672 8.1e-33 135 29 21 552 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 9.88e-07 55 36 1 90 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O06476 8.59e-33 135 27 19 545 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q8K268 1.13e-32 135 28 21 502 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 5.62e-07 56 27 8 230 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q66H39 1.83e-32 135 27 17 503 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 1.56e-06 54 28 9 230 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
P9WQK3 3.1e-31 130 28 20 522 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 1.28e-11 70 30 6 205 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 3.1e-31 130 28 20 522 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 1.28e-11 70 30 6 205 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45127 4.38e-31 130 28 17 518 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 4.49e-11 68 28 9 233 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P39115 4.42e-31 130 26 18 534 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q9LV93 3.57e-30 128 28 20 521 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 5.68e-15 81 26 6 227 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
P43535 4.72e-30 128 28 14 421 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0H2VFI8 8.29e-30 126 28 16 520 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 2.3e-11 69 27 9 247 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9FIB4 8.57e-30 127 27 18 521 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 1.2e-15 83 26 7 275 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
P0A9W5 8.69e-30 126 28 15 514 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.64e-11 70 27 9 247 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 8.69e-30 126 28 15 514 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.64e-11 70 27 9 247 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 8.69e-30 126 28 15 514 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.64e-11 70 27 9 247 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
O59672 1.28e-29 127 30 12 386 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 3.25e-09 63 27 7 199 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0DX93 1.95e-29 124 26 16 502 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
O31716 1.5e-28 122 26 19 542 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 5.82e-08 58 27 8 208 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.47e-07 57 35 1 92 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
P0A9U3 4.09e-28 121 27 17 538 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 4.93e-13 75 26 3 219 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 4.09e-28 121 27 17 538 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 4.93e-13 75 26 3 219 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 4.09e-28 121 27 17 538 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 4.93e-13 75 26 3 219 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q57242 2.12e-27 119 28 22 546 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25256 2.26e-27 119 27 19 543 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 1.91e-05 50 31 6 169 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 0.000827 45 39 1 71 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P57445 2.94e-27 119 25 17 500 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O42943 6.77e-26 115 25 17 523 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 5.89e-07 55 26 4 173 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 4.67e-05 49 26 4 192 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23212 2.06e-25 112 25 19 511 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 7.29e-12 71 35 6 157 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
Q8T6B4 2.68e-25 114 24 15 533 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
P40024 2.73e-25 113 25 19 536 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 5.46e-07 55 25 7 238 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8K9I3 3.35e-25 112 24 19 499 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 2.68e-07 57 27 4 174 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9FJH6 3.85e-25 112 23 13 535 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 6.52e-07 55 28 9 223 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q8T6B7 4.72e-25 112 24 14 509 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 5.33e-07 56 26 7 216 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8H0V6 9.71e-25 112 27 13 393 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 0.000174 48 33 5 123 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q9M1H3 1.66e-24 111 26 19 551 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 1.28e-08 61 25 7 219 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9USH9 1.38e-23 108 26 22 522 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1.51e-05 51 24 3 192 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q767L0 1.85e-21 102 25 16 507 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q7YR37 7.75e-21 100 25 16 507 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q8NE71 1.19e-20 99 25 16 507 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q9UG63 6.18e-20 97 25 17 535 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 2.07e-07 57 28 6 205 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q6P542 6.6e-20 97 27 15 408 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
P44808 7.03e-20 96 35 7 239 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 9.49e-17 87 34 3 172 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 2.47e-11 70 30 9 243 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 1.84e-07 57 26 5 197 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q99LE6 7.4e-20 96 24 13 528 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q6MG08 1.09e-19 96 27 15 408 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q2KJA2 1.8e-18 92 24 13 528 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q8SRV5 9.26e-18 89 26 13 382 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 8.32e-10 65 31 6 159 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
P12622 5.19e-17 85 28 10 294 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 7.55e-05 48 44 1 77 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
Q45978 1.29e-16 86 28 19 515 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P45167 6.02e-13 74 28 12 351 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1Q889 3.87e-12 69 29 10 243 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8U4L3 1.87e-11 68 26 6 213 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q08972 2.61e-11 70 31 5 199 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.01e-08 62 29 8 239 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 0.000124 48 38 1 65 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4FQ27 1.6e-10 65 29 8 214 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P29551 3.03e-10 66 29 7 197 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.31e-08 61 32 8 176 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 0.000106 48 37 1 64 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q4W575 3.95e-10 65 28 7 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 0.000397 46 30 7 180 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 3.95e-10 65 28 7 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 0.000397 46 30 7 180 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q28VN1 5.63e-10 63 33 9 182 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
O05779 9.44e-10 62 30 9 204 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U7B7 1.01e-09 62 30 9 204 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q5FA19 1.39e-09 63 27 6 206 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 0.000175 47 30 6 178 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5WBL0 2.1e-09 61 26 5 200 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q3K9F9 2.16e-09 61 30 6 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q81J16 2.22e-09 62 31 9 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P53978 3.2e-09 63 38 1 94 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.1e-05 52 36 2 77 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 0.000224 47 27 5 163 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q31GF5 3.22e-09 60 27 7 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P55476 4.45e-09 61 25 7 278 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6Q876 4.64e-09 63 26 6 233 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
O57872 4.85e-09 60 24 5 212 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P25997 6.46e-09 62 26 4 198 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 4.31e-05 50 35 2 77 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 5.58e-05 49 27 4 160 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q75EV6 6.73e-09 62 28 5 198 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 4.46e-05 50 35 2 77 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 5.07e-05 50 28 5 166 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P16521 6.85e-09 62 38 1 92 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.06e-06 55 28 5 163 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.55e-05 51 27 5 140 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O93796 8.43e-09 62 37 1 94 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.8e-05 50 28 4 166 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.93e-05 50 35 2 77 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q7UX73 9.75e-09 59 27 7 216 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q50966 9.82e-09 60 27 7 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q50966 5.85e-05 48 30 8 186 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q9X1Z1 1.09e-08 59 24 8 233 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8T6J2 1.16e-08 62 27 4 173 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q6G4Q8 1.18e-08 59 25 9 213 3 BH02760 Putative ABC transporter ATP-binding protein BH02760 Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5MZ54 1.48e-08 61 31 5 192 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 1.48e-08 61 31 5 192 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9CJB8 1.69e-08 60 27 7 217 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q88KY4 1.69e-08 58 30 7 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87RE5 1.75e-08 59 32 6 163 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4KFA2 1.81e-08 58 29 6 186 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O14134 1.85e-08 60 30 6 185 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 8.03e-08 58 38 2 101 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.64e-05 51 33 2 90 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3BTD3 1.89e-08 58 29 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q63H62 2.15e-08 58 30 8 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
P44656 2.17e-08 58 31 12 214 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6HPN0 2.27e-08 58 30 8 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 2.27e-08 58 30 8 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 2.27e-08 58 30 8 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q73F67 2.32e-08 58 30 8 197 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5RFQ9 2.8e-08 60 25 7 231 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q5E6M2 3.29e-08 58 32 6 163 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q884I3 3.51e-08 57 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q32I01 3.74e-08 57 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q9LSJ2 4.08e-08 60 25 8 210 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
O94489 4.16e-08 60 31 9 173 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 6.03e-08 59 28 8 200 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 0.000109 48 39 1 66 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B5BA33 4.3e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain AKU_12601)
Q5PH81 4.3e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q2LVL0 4.56e-08 59 24 7 250 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
P63351 4.67e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63352 4.67e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhi
B4TGI0 4.67e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella heidelberg (strain SL476)
B5FJ99 4.67e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella dublin (strain CT_02021853)
Q57PU4 4.67e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella choleraesuis (strain SC-B67)
D0MYB4 4.68e-08 59 29 6 201 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 5.13e-07 56 30 6 162 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 0.000204 48 39 1 61 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
B5QVV9 4.76e-08 57 32 5 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella enteritidis PT4 (strain P125109)
Q035B2 4.91e-08 58 27 8 226 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8P8V9 4.94e-08 57 28 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV71 4.94e-08 57 28 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q5H0G3 5.58e-08 57 29 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E1 5.58e-08 57 29 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2GFZ6 6.75e-08 57 27 10 201 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q080S4 6.77e-08 57 30 6 181 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella frigidimarina (strain NCIMB 400)
Q48KI4 6.94e-08 57 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
O34314 7.29e-08 57 28 8 192 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q00564 7.57e-08 58 25 5 218 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q9HZL7 7.69e-08 56 26 5 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q483B6 7.69e-08 58 27 6 221 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9JXR3 8.1e-08 58 25 6 202 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4ZV73 8.36e-08 56 30 7 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q2KBP5 9.79e-08 56 26 7 215 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KBP5 2.98e-05 48 25 8 188 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6D2F6 1.08e-07 57 24 9 233 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P37624 1.12e-07 58 29 5 156 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 0.000198 48 39 1 71 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q63TY1 1.13e-07 57 30 8 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8PKT0 1.18e-07 56 28 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
Q5HBR8 1.28e-07 56 27 9 189 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.28e-07 56 27 9 189 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q62K82 1.29e-07 57 30 8 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q609Q1 1.3e-07 57 30 10 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q15TB1 1.32e-07 55 27 8 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q9KQB8 1.33e-07 56 30 8 184 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 0.000375 45 27 7 208 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9LID6 1.33e-07 58 28 7 188 2 ABCE1 ABC transporter E family member 1 Arabidopsis thaliana
Q66AT7 1.46e-07 56 28 7 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 7.15e-06 51 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJG3 1.5e-07 56 28 7 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 7.76e-06 51 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 1.5e-07 56 28 7 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 7.76e-06 51 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 1.5e-07 56 28 7 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 7.76e-06 51 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9V2E4 1.56e-07 56 26 5 172 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q3KCC5 1.59e-07 57 26 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q9RRL9 1.91e-07 55 25 4 218 3 DR_2469 Putative ABC transporter ATP-binding protein DR_2469 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q5HM28 2.02e-07 56 26 6 188 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P08183 2.02e-07 57 25 7 242 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q89AJ0 2.07e-07 55 25 7 202 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 9.92e-06 50 28 6 169 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9JW59 2.09e-07 57 25 6 202 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9NUT2 2.2e-07 57 25 9 252 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q60AB3 2.21e-07 55 30 7 192 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8CRI7 2.23e-07 56 26 6 188 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7MMN0 2.34e-07 55 31 6 163 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 2.34e-07 55 31 6 163 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q5F4X8 2.53e-07 57 25 6 202 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q92CK1 2.58e-07 55 27 4 176 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q31I51 2.59e-07 55 28 6 191 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1JPQ1 2.89e-07 55 34 9 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7UPK3 2.89e-07 55 25 8 234 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UPK3 0.000507 45 25 7 186 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q87EF4 2.96e-07 55 30 6 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q83J77 3.13e-07 55 30 9 197 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q83J77 3.24e-05 49 29 8 205 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q9WXX8 3.66e-07 55 28 8 187 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 7.32e-07 53 26 6 194 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q98DT6 3.8e-07 55 30 7 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q57538 3.87e-07 56 26 4 176 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57538 3.33e-05 50 27 10 216 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6LTB1 4.33e-07 55 27 10 241 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 1.89e-06 53 32 7 164 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q7VMV4 4.66e-07 54 26 6 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q12NL5 5.59e-07 54 30 6 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P57032 5.7e-07 54 30 6 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xylella fastidiosa (strain 9a5c)
Q5RKI8 6.19e-07 55 25 5 204 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q5NN23 6.92e-07 53 31 7 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q9TKX3 7.1e-07 55 27 7 192 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q6D4A8 7.24e-07 54 30 8 182 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4L8L7 7.33e-07 53 21 6 236 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q9NRK6 7.4e-07 55 25 6 227 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q8Z5W6 7.44e-07 54 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q58429 7.63e-07 54 27 5 167 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7N6Z2 7.78e-07 55 25 7 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 1.77e-06 53 29 9 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8PP41 8.01e-07 53 29 9 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q1IKM7 8.02e-07 53 27 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q44613 8.27e-07 53 24 6 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q3YSK9 8.34e-07 53 25 9 203 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q5PIA5 8.94e-07 53 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 2.05e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 8.94e-07 53 30 8 183 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 2.05e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q2KYS6 9.28e-07 55 26 5 205 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
Q9CXJ4 9.48e-07 55 23 6 248 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
Q9I190 9.49e-07 55 27 8 217 1 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02MI4 9.49e-07 55 27 8 217 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas aeruginosa (strain UCBPP-PA14)
P44513 9.5e-07 54 25 7 198 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9LSJ5 9.57e-07 55 25 8 210 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q981Y8 9.61e-07 53 32 6 179 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1CHI9 1.03e-06 53 27 5 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CHI9 0.000239 46 31 9 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD58 1.03e-06 53 27 5 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q8ZD58 0.000239 46 31 9 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q1C647 1.03e-06 53 27 5 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C647 0.000239 46 31 9 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q10418 1.06e-06 55 24 8 245 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q10418 0.000111 48 24 6 215 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q4QP85 1.07e-06 54 25 6 198 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
A1JRI2 1.08e-06 53 31 9 185 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 9.08e-06 50 30 8 200 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P59852 1.12e-06 55 28 5 167 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q2JGF5 1.13e-06 53 28 3 159 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q9LSJ6 1.16e-06 55 23 10 283 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q21JQ9 1.2e-06 53 25 5 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q668T8 1.49e-06 52 27 5 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668T8 0.000244 46 31 9 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8GNH6 1.57e-06 53 29 7 171 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q4UMZ3 1.62e-06 54 23 7 214 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q8ZNV7 1.65e-06 53 30 8 183 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 2.39e-05 49 28 7 200 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3KBH4 1.72e-06 53 28 9 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
P50332 1.76e-06 53 28 5 175 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q46ZU5 1.76e-06 53 29 7 181 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3IWB5 1.81e-06 52 32 6 167 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 0.000239 46 26 8 234 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q56927 1.82e-06 53 27 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
O28437 1.84e-06 52 23 8 231 3 AF_1841 Putative ABC transporter ATP-binding protein AF_1841 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P78966 1.87e-06 54 31 8 180 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P97027 1.88e-06 52 28 7 184 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
O66646 1.92e-06 52 26 4 181 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O66646 0.000123 47 26 8 202 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q8XZQ4 1.94e-06 53 29 11 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q74DN5 1.95e-06 52 28 5 170 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 3.89e-05 48 30 8 191 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q9KQE3 1.96e-06 52 27 7 187 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1RJ91 1.96e-06 54 27 5 199 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
Q88XV2 1.97e-06 53 26 6 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q4K681 1.98e-06 53 30 8 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q668K6 2e-06 53 25 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 9.38e-05 48 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
P21410 2.01e-06 53 26 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q3M5J9 2.13e-06 52 31 8 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5E0F2 2.17e-06 53 26 9 237 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0I4A9 2.22e-06 52 34 6 162 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
P21447 2.24e-06 54 25 7 242 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
Q5E0B3 2.36e-06 52 30 7 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aliivibrio fischeri (strain ATCC 700601 / ES114)
P21448 2.36e-06 54 27 4 180 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
Q93DX8 2.38e-06 52 29 8 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q5F8K2 2.5e-06 52 24 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8D0W8 2.53e-06 53 25 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8D0W8 9.63e-05 48 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q9ZR72 2.66e-06 54 25 7 239 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q0K9I2 2.77e-06 52 29 7 184 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1IGZ0 2.78e-06 53 28 9 212 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q55462 2.9e-06 53 28 5 192 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0A9U0 3.11e-06 52 27 7 207 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9U0 7.41e-06 50 28 6 194 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 3.11e-06 52 27 7 207 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T8 7.41e-06 50 28 6 194 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 3.11e-06 52 27 7 207 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
P0A9T9 7.41e-06 50 28 6 194 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q21TG3 3.16e-06 52 28 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q02151 3.21e-06 52 30 7 160 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
Q7N3S7 3.28e-06 52 31 9 210 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q47C66 3.55e-06 51 28 7 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q5WCI1 4.01e-06 52 30 8 178 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q9VSS1 4.27e-06 53 29 7 185 1 pix Protein Pixie Drosophila melanogaster
Q0AGF4 4.27e-06 52 25 11 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1CJS9 4.37e-06 52 25 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 4.37e-06 52 25 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 4.37e-06 52 25 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q668Q3 4.41e-06 52 25 5 183 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q0SK28 4.46e-06 51 32 7 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q0SK28 0.000318 46 29 8 194 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q6D201 4.68e-06 52 25 9 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1U776 4.9e-06 51 34 7 163 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3ARY3 4.98e-06 51 25 7 211 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium chlorochromatii (strain CaD3)
Q0VTB6 5.35e-06 51 33 9 169 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q73XU8 5.55e-06 52 27 7 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P22638 5.56e-06 52 24 8 239 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7ULB5 5.91e-06 52 30 9 207 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q2M3G0 6e-06 53 20 6 274 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q0HJG0 6.01e-06 51 28 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q8U648 6.2e-06 51 27 6 185 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q89UD2 6.52e-06 52 29 9 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 0.000436 46 28 9 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1TXH7 6.55e-06 52 30 7 173 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
O52618 6.83e-06 52 29 6 171 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q72PP0 6.86e-06 51 25 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q31FG2 7.25e-06 52 23 4 200 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8F6L8 7.46e-06 50 25 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8RD07 7.81e-06 50 28 9 179 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0KPH6 7.83e-06 51 30 9 178 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q12ES3 7.87e-06 50 28 8 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q881Q1 7.99e-06 52 25 7 209 2 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q881Q1 0.000589 46 32 11 188 2 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21GS5 8.19e-06 51 29 6 178 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1RGL1 8.31e-06 50 25 7 188 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
A0ALT7 8.34e-06 51 27 8 175 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6F813 8.4e-06 52 27 8 216 3 macB Macrolide export ATP-binding/permease protein MacB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q65TB7 9.08e-06 50 28 6 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q71WH7 9.13e-06 51 27 8 175 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serotype 4b (strain F2365)
Q8Y454 9.55e-06 51 27 8 175 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q0RYP7 9.79e-06 51 28 5 171 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q5WUF8 9.95e-06 50 26 6 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Lens)
Q1QX69 1.01e-05 52 24 6 227 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q927N8 1.01e-05 50 27 8 175 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0RT43 1.02e-05 50 30 7 182 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q4K9A4 1.03e-05 52 28 7 195 3 pvdT Pyoverdine export ATP-binding/permease protein PvdT Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KKA1 1.03e-05 50 27 8 202 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q81IN8 1.04e-05 51 28 7 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q4KKK4 1.05e-05 50 26 7 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P94366 1.05e-05 52 28 5 195 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
A0R6H8 1.05e-05 52 28 6 208 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0HVQ0 1.07e-05 50 28 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-7)
Q21NS8 1.07e-05 52 26 9 224 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q2RPB4 1.08e-05 52 29 7 192 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P10091 1.09e-05 51 37 4 86 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q6GE75 1.19e-05 50 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q7A7E3 1.25e-05 51 23 6 182 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 1.25e-05 51 23 6 182 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P43245 1.28e-05 52 26 4 180 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q8ZPK4 1.3e-05 51 24 6 185 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0LM36 1.31e-05 51 27 8 219 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q9I6T2 1.32e-05 51 27 6 178 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8TI15 1.33e-05 50 24 4 214 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q2YZ26 1.37e-05 50 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A3X3 1.39e-05 50 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 1.39e-05 50 37 2 75 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
P21449 1.39e-05 52 26 4 180 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
Q8Z8R5 1.43e-05 50 29 7 183 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q82WT5 1.44e-05 50 28 9 205 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82WT5 0.001 45 37 2 87 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8NV47 1.44e-05 49 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 1.44e-05 49 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 1.44e-05 49 37 2 75 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 1.44e-05 49 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 1.44e-05 49 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 1.44e-05 49 37 2 75 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q0SBZ1 1.45e-05 50 28 5 171 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q5PCG9 1.46e-05 50 29 7 183 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9LSJ8 1.47e-05 51 25 7 195 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q6FFL0 1.47e-05 50 32 8 171 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4ZZS2 1.51e-05 50 27 5 177 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q8FFB3 1.52e-05 50 27 7 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFB3 3.05e-05 50 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZR89 1.54e-05 50 29 7 183 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2NU23 1.54e-05 50 24 8 244 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 0.000559 45 28 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
A0KMJ3 1.59e-05 51 30 7 184 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O34392 1.6e-05 49 26 8 196 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 3.97e-05 48 22 8 223 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q0S0Z3 1.64e-05 50 28 5 171 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q8EB59 1.65e-05 50 34 6 143 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87MK8 1.65e-05 49 24 5 190 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6MD10 1.72e-05 49 25 5 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
P47425 1.74e-05 50 20 8 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8XBJ8 1.77e-05 50 27 7 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8XBJ8 2.65e-05 50 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q668L6 1.78e-05 51 26 9 204 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6F9A8 1.8e-05 50 28 9 193 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4KES7 1.8e-05 51 30 8 186 3 PFL_2149 Probable export ATP-binding/permease protein PFL_2149 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P16676 1.81e-05 50 27 7 203 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
P16676 2.82e-05 50 29 8 181 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q57S53 1.83e-05 50 29 7 183 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q1I966 1.9e-05 51 25 7 203 3 macB Probable export ATP-binding/permease protein MacB Pseudomonas entomophila (strain L48)
Q1I966 0.000314 47 29 8 192 3 macB Probable export ATP-binding/permease protein MacB Pseudomonas entomophila (strain L48)
Q8KZQ6 1.93e-05 50 33 9 172 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8XXB6 1.93e-05 51 28 6 206 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q83KR7 1.94e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 2.67e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.94e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 2.67e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q73EL7 1.94e-05 50 28 7 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9MUN1 1.98e-05 50 28 6 174 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q7NWX3 2e-05 50 29 9 231 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 6.95e-05 48 31 9 194 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q6HP89 2.01e-05 50 28 7 182 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q7CJG3 2.03e-05 51 26 9 204 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis
Q1C5W7 2.03e-05 51 26 9 204 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CJW8 2.03e-05 51 26 9 204 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q881U6 2.05e-05 49 31 8 174 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q32EX7 2.07e-05 49 27 8 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q9C8T1 2.09e-05 49 30 7 167 2 ABCI1 ABC transporter I family member 1 Arabidopsis thaliana
Q8NR42 2.1e-05 49 30 7 193 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q81ZF5 2.1e-05 50 28 7 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q7N545 2.11e-05 49 28 8 202 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q12C33 2.15e-05 50 30 6 163 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q63GR8 2.28e-05 50 28 7 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
A0R6H7 2.3e-05 50 24 7 242 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1K323 2.32e-05 50 28 6 195 3 macB Macrolide export ATP-binding/permease protein MacB Azoarcus sp. (strain BH72)
Q7UC29 2.32e-05 50 27 8 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7UC29 3.13e-05 50 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q8R7Y4 2.33e-05 49 27 5 155 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q31VE6 2.34e-05 49 29 8 205 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q3KE48 2.35e-05 50 31 10 197 3 Pfl01_2215 Probable export ATP-binding/permease protein Pfl01_2215 Pseudomonas fluorescens (strain Pf0-1)
Q1RK34 2.38e-05 49 23 4 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Rickettsia bellii (strain RML369-C)
Q8X4L6 2.38e-05 49 29 8 205 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q6AMR9 2.41e-05 49 22 7 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q5E3S7 2.42e-05 48 26 7 182 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6D606 2.43e-05 48 28 9 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q83KD5 2.48e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella flexneri
Q5L222 2.51e-05 50 25 8 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5X2Z8 2.65e-05 49 24 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila (strain Paris)
Q66CI3 2.68e-05 50 23 9 251 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 2.68e-05 50 23 9 251 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 2.68e-05 50 23 9 251 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 2.68e-05 50 23 9 251 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q8EEV5 2.73e-05 49 28 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q82TL6 2.74e-05 50 28 5 162 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8VNL9 2.75e-05 49 27 9 169 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q5ZT78 2.8e-05 48 24 6 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q3Z2L6 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.92e-05 49 28 7 200 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 3.32e-05 49 29 8 182 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.92e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 3.32e-05 49 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q8XE58 2.94e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Escherichia coli O157:H7
Q1CGD7 3.02e-05 50 28 6 185 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q66CL2 3.02e-05 50 28 6 185 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q7CHI2 3.02e-05 50 28 6 185 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis
Q1CA99 3.02e-05 50 28 6 185 3 macB1 Macrolide export ATP-binding/permease protein MacB 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q31Z24 3.05e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella boydii serotype 4 (strain Sb227)
P33931 3.05e-05 48 30 8 191 1 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Escherichia coli (strain K12)
Q0TFP1 3.05e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8K449 3.05e-05 50 27 5 168 1 Abca9 ATP-binding cassette sub-family A member 9 Mus musculus
Q8XZP8 3.08e-05 50 30 9 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q82HA2 3.09e-05 49 26 10 221 3 SAV_3608 Putative ABC transporter ATP-binding protein SAV_3608 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q21PQ7 3.09e-05 49 31 8 169 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1AS06 3.1e-05 50 27 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
O34677 3.12e-05 49 26 6 191 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q1B8V9 3.12e-05 50 28 6 168 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 3.12e-05 50 28 6 168 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q32HA3 3.17e-05 49 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 5.9e-05 48 29 8 182 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
P40860 3.33e-05 49 28 7 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40860 0.000167 47 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C3LLU1 3.35e-05 49 30 7 186 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 3.35e-05 49 30 7 186 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3IL62 3.4e-05 48 28 8 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas translucida (strain TAC 125)
Q03PF2 3.5e-05 49 28 6 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q3Z006 3.5e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella sonnei (strain Ss046)
Q1R9L8 3.5e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Escherichia coli (strain UTI89 / UPEC)
Q5WNX0 3.56e-05 49 26 7 175 2 bcrA Bacitracin transport ATP-binding protein BcrA Enterococcus faecalis
P06795 3.58e-05 50 26 4 180 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
Q0A9E2 3.59e-05 48 30 7 200 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 0.00013 47 31 7 167 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A0A348AXX9 3.61e-05 50 24 8 230 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q8FJ95 3.65e-05 48 29 7 172 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KUI0 3.68e-05 49 31 7 160 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KUI0 0.000352 46 28 8 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q12R52 3.69e-05 48 33 5 152 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q66A01 3.7e-05 48 32 8 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 3.7e-05 48 32 8 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
P9WQM1 3.79e-05 49 27 8 218 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.79e-05 49 27 8 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.79e-05 49 27 8 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0LCH8 3.89e-05 48 28 7 186 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q63TW1 3.92e-05 49 30 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q8FFR2 3.95e-05 48 30 8 191 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9FLX5 3.98e-05 50 24 9 267 2 ABCG8 ABC transporter G family member 8 Arabidopsis thaliana
Q8Z4V6 4.04e-05 49 28 7 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8Z4V6 0.000202 47 29 8 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q39T41 4.12e-05 48 30 10 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1B8U4 4.17e-05 48 33 7 184 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q9HY19 4.28e-05 49 28 8 200 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7NTU0 4.32e-05 48 25 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q02R79 4.32e-05 49 28 8 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
A1WXT0 4.41e-05 48 28 10 190 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 8.33e-05 48 26 7 198 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
O34510 4.43e-05 48 30 8 181 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
Q92VJ2 4.48e-05 49 26 9 228 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q57QD7 4.65e-05 48 27 8 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q0I3C2 4.69e-05 48 27 7 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q13DS7 4.73e-05 48 28 5 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q5QU46 4.82e-05 48 25 6 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q8PZN0 4.83e-05 49 25 9 214 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PZN0 0.001 45 26 7 180 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q2YAD6 4.84e-05 49 28 5 163 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P75957 4.86e-05 48 27 8 203 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q9JUX4 4.94e-05 49 29 9 186 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JUX4 0.000427 46 35 4 85 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q87EF0 4.95e-05 49 26 7 216 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
P61482 5e-05 48 28 7 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 5e-05 48 28 7 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 5e-05 48 28 7 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A1B9H9 5.02e-05 48 31 6 165 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q9PPV1 5.07e-05 48 22 9 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q8PY26 5.11e-05 48 29 4 154 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9CP24 5.12e-05 48 34 7 169 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q5NQX0 5.18e-05 48 31 7 179 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1RB86 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain UTI89 / UPEC)
Q8FH28 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THB9 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABP5 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O1:K1 / APEC
B7MV91 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O81 (strain ED1a)
B7MAS0 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US48 5.21e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q08201 5.23e-05 50 24 7 248 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
P06611 5.3e-05 48 32 9 183 1 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12)
B1XG16 5.3e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / DH10B)
C4ZYH1 5.3e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / MC4100 / BW2952)
Q32AQ1 5.38e-05 48 29 8 205 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
P53706 5.39e-05 50 27 11 208 3 HST6 Alpha-factor-transporting ATPase Candida albicans (strain WO-1)
Q8RLB6 5.5e-05 48 31 6 164 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
Q0VQP5 5.6e-05 49 27 5 196 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q20ZS6 5.63e-05 48 26 5 187 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopseudomonas palustris (strain BisB18)
Q5LVM5 5.68e-05 48 29 7 183 3 tauB Taurine import ATP-binding protein TauB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3JSR6 5.7e-05 48 30 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q3Z257 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella sonnei (strain Ss046)
Q7C1M3 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri
Q0T4R9 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri serotype 5b (strain 8401)
Q32FJ0 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella dysenteriae serotype 1 (strain Sd197)
B1LE21 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SMS-3-5 / SECEC)
B6I8R4 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SE11)
B7N547 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPL8 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q1 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O9:H4 (strain HS)
B7M1B8 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O8 (strain IAI1)
B7NTS2 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L6I2 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain 55989 / EAEC)
A7ZMH7 5.92e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q2SVN0 5.95e-05 48 29 6 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P33594 6.06e-05 48 29 8 205 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q62K56 6.11e-05 48 30 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
B2U358 6.14e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B5YPZ7 6.19e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5W0 6.19e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7
Q4ZT65 6.25e-05 49 25 7 206 3 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZT65 7.43e-05 49 31 9 192 3 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. syringae (strain B728a)
P21440 6.31e-05 49 24 7 248 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q92NU9 6.39e-05 49 26 8 196 3 macB Macrolide export ATP-binding/permease protein MacB Rhizobium meliloti (strain 1021)
Q1QDA8 6.4e-05 49 28 6 183 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9CN78 6.53e-05 48 25 8 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q4FU75 6.63e-05 49 28 6 183 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3YW48 6.63e-05 48 29 8 205 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q73R11 6.64e-05 49 27 8 198 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8NSN2 6.72e-05 48 24 11 266 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P56344 6.88e-05 48 30 7 170 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q5PB72 6.89e-05 48 25 12 250 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q6NBT1 6.9e-05 48 25 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q46Y89 6.94e-05 49 27 6 206 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q321G6 7.3e-05 48 32 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 4 (strain Sb227)
A5F1V0 7.34e-05 48 29 5 181 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03795
Feature type CDS
Gene -
Product ATP-binding cassette domain-containing protein
Location 803677 - 805242 (strand: -1)
Length 1566 (nucleotides) / 521 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1060
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Protein Sequence

MPVHCHFSHLSVIFNDTPLFENISGTLTHQVQGLTGNNGRGKSVLMSLLAQFRLPTTGTVSWHTPFHYVPQLTRLPGVTLADALGNSHIQAAFRRTENGTATADDYDFLSDKWDFPHRLQSLLESAQLGHFSPDTPSAQLSGGEQTRLALCCAFLQPDTFLLLDEPGNHLDSAGRRWLSEQLLQHPAGALVISHDRRLLDDMHRIFELTPSSLDEYGGNYSHFAEQKAFQLNALQSEEKQLQTNARKEKDELQRTLEKKAQRRRQGEQVRSSGSSSALLLDMKKNKSEKQQSAITQRHERVMGQLDDQRRAVNEQIQRITPQMLAFDYQDYQKRIRVNAHDLVLPFGSQQPVSLTISGGEHWHIAGRNGCGKSTLLKVLTHQSAAASGQHSLHGHWRYLDQHLALLNKSLPVVDALCEFDPSITAQTWRTHLGALRIRGDKGLITLSQLSGGEQLKVTLLALTLSAPLPDILLLDEPDNHLDLDSKLLLEGVLRSYKGALLLVSHDDAFVENCAVTHTLIL

Flanking regions ( +/- flanking 50bp)

TATTTAAATTGTGCATAATCGCCTGCCCTGAATATTTCAGGAGCTTACTTATGCCTGTTCATTGCCATTTTTCACACTTATCTGTCATTTTTAACGACACCCCGCTGTTTGAGAATATCAGCGGCACATTAACACATCAGGTTCAGGGACTGACCGGCAACAACGGCCGGGGGAAATCCGTGCTGATGTCTCTGCTCGCACAATTTCGCCTGCCGACAACCGGTACGGTCAGCTGGCATACACCTTTTCATTATGTTCCGCAACTGACACGACTGCCCGGTGTGACACTGGCTGATGCGTTAGGGAACAGCCATATTCAGGCGGCTTTCCGGCGTACCGAAAACGGCACCGCCACCGCTGATGACTATGATTTTCTGTCCGATAAATGGGATTTCCCTCATCGCCTCCAATCATTACTGGAAAGCGCGCAACTGGGTCATTTTTCGCCCGATACGCCGTCAGCACAACTCAGCGGCGGTGAGCAAACCCGGCTGGCGCTCTGTTGTGCTTTTTTGCAACCAGATACGTTTTTATTGCTCGATGAACCGGGAAACCATCTGGACAGTGCCGGTCGCCGCTGGTTGAGTGAGCAGCTTCTTCAGCATCCTGCCGGGGCATTGGTTATCAGCCATGACCGGCGGTTACTTGATGATATGCACCGTATTTTTGAACTGACCCCGTCGTCACTGGACGAATATGGCGGCAATTACAGTCACTTTGCTGAGCAAAAAGCCTTTCAGCTTAATGCGTTACAAAGTGAAGAAAAGCAGTTGCAAACCAATGCACGTAAAGAAAAAGACGAGTTACAGCGCACGCTGGAGAAAAAAGCACAGCGCCGCCGCCAGGGAGAACAAGTGCGTTCATCCGGTTCGTCTTCCGCACTTTTACTGGATATGAAAAAAAATAAGTCGGAAAAACAACAGTCTGCTATCACACAGCGCCATGAGCGGGTGATGGGGCAACTGGATGACCAGCGGCGTGCCGTAAATGAACAAATACAGCGGATAACACCGCAAATGCTGGCATTTGACTATCAGGATTATCAAAAACGGATCAGGGTGAATGCACATGACCTGGTTTTGCCGTTCGGCTCACAACAGCCGGTTTCACTGACGATTTCCGGCGGGGAGCACTGGCATATTGCAGGGCGCAACGGCTGCGGAAAGTCCACTTTGCTGAAAGTGCTGACTCATCAGTCAGCCGCCGCGTCCGGTCAACATTCGCTGCACGGTCACTGGCGCTATCTTGATCAGCACCTGGCTCTGCTGAATAAATCGCTGCCGGTTGTTGATGCATTATGCGAATTTGACCCGTCCATTACAGCACAAACCTGGCGCACCCATCTGGGCGCATTACGCATACGGGGGGATAAGGGGCTGATTACCCTCTCACAACTGAGTGGCGGCGAACAACTGAAAGTCACATTGCTGGCATTAACACTCTCTGCGCCACTGCCGGATATTTTATTGCTGGATGAACCTGATAACCATCTGGATCTGGATTCAAAATTACTGCTTGAAGGTGTATTACGCAGTTACAAGGGCGCATTATTATTAGTCAGTCATGATGATGCGTTTGTAGAAAACTGTGCTGTGACTCATACCCTGATATTATAACAAATACAGCAATATACGGCGGCACTGCCGCCGTATCATATCATTTATAG