Homologs in group_1060

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05510 FBDBKF_05510 100.0 Morganella morganii S1 uup ATPase components of ABC transporters with duplicated ATPase domains
EHELCC_12080 EHELCC_12080 100.0 Morganella morganii S2 uup ATPase components of ABC transporters with duplicated ATPase domains
NLDBIP_12420 NLDBIP_12420 100.0 Morganella morganii S4 uup ATPase components of ABC transporters with duplicated ATPase domains
LHKJJB_12280 LHKJJB_12280 100.0 Morganella morganii S3 uup ATPase components of ABC transporters with duplicated ATPase domains
F4V73_RS03795 F4V73_RS03795 79.7 Morganella psychrotolerans - ATP-binding cassette domain-containing protein
PMI_RS05370 PMI_RS05370 53.3 Proteus mirabilis HI4320 - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_1060

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1060

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O05519 1.07e-52 192 30 17 552 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 3.49e-21 100 33 9 236 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
P63389 7.83e-41 159 29 14 524 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 1.8e-15 82 31 6 201 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 1.73e-10 67 28 8 268 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 7.83e-41 159 29 14 524 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 1.8e-15 82 31 6 201 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 1.73e-10 67 28 8 268 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 1.24e-40 158 29 14 524 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 1.85e-15 82 31 6 201 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 4.36e-10 65 28 8 268 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O34512 5.33e-38 149 27 16 534 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
P39115 1.29e-37 149 27 19 533 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P9WQK3 1.46e-37 149 30 17 516 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 4.41e-09 62 28 8 239 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 1.46e-37 149 30 17 516 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 4.41e-09 62 28 8 239 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9LV93 3.3e-36 146 26 19 552 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 4.49e-16 85 27 7 228 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
A0A0H2VFI8 6.41e-36 144 29 17 520 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 2.3e-13 76 28 7 246 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 6.8e-36 144 29 17 520 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.6e-13 76 28 7 246 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 6.8e-36 144 29 17 520 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.6e-13 76 28 7 246 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 6.8e-36 144 29 17 520 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.6e-13 76 28 7 246 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
O06476 3.65e-35 142 28 20 546 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q9FIB4 4.92e-35 142 27 19 551 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 5.47e-15 81 26 6 228 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
P25256 6.08e-35 141 29 20 562 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P43672 1.06e-34 141 29 18 531 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 1.85e-08 60 31 9 209 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 4.18e-08 59 28 4 198 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P45127 1.57e-34 140 28 18 520 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q66H39 2.53e-34 140 26 14 541 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 3.02e-08 60 29 8 209 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 2.33e-06 54 39 3 76 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q9NUQ8 1.7e-33 138 27 14 529 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 2.56e-08 60 27 7 209 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 2.79e-06 53 39 3 76 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q8K268 1.8e-33 138 27 16 548 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 2.37e-08 60 28 7 209 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q5R9Z5 8.92e-33 136 26 13 541 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 2.13e-06 54 39 3 76 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q8H0V6 1.03e-31 133 29 12 376 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 6.09e-06 52 26 8 222 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 1.19e-05 52 41 2 73 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8T6B4 1.61e-30 130 28 19 539 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 1.86e-07 57 27 8 214 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 8.23e-05 49 29 7 172 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
O31716 1.67e-30 128 24 14 542 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 1.43e-10 67 25 7 235 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 1.25e-09 64 28 7 215 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
P0A9U3 2.94e-30 127 26 19 567 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U3 6.98e-13 74 26 6 227 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 2.94e-30 127 26 19 567 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U4 6.98e-13 74 26 6 227 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 2.94e-30 127 26 19 567 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P0A9U5 6.98e-13 74 26 6 227 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
Q9M1H3 4.24e-30 128 28 19 518 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 5.56e-06 52 42 2 73 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 2.82e-05 50 24 6 202 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
O42943 8.88e-29 124 26 19 532 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 4.85e-09 62 29 7 203 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 1.08e-05 52 25 8 210 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0DX93 1.07e-28 122 25 13 497 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
Q8K9I3 5.11e-28 121 24 15 529 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57445 1.04e-27 120 27 16 502 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P40024 1.22e-27 120 26 17 508 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 6.99e-07 55 26 9 289 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 8.12e-06 52 26 7 200 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 1.48e-27 120 28 14 384 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 3.7e-10 66 24 8 313 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 3.44e-07 57 27 6 180 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O59672 1.71e-27 120 28 10 379 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 1.27e-08 61 28 6 202 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 6.86e-07 55 23 7 325 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9FJH6 2.32e-27 119 26 18 523 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.86e-05 51 40 3 74 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q8T6B7 3.33e-27 119 26 12 378 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 9.08e-07 55 25 5 203 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 4.6e-06 53 25 5 208 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q57242 5.69e-27 118 29 23 544 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 4.85e-10 65 32 8 206 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23212 2.46e-26 115 25 20 507 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 8.21e-12 71 33 6 160 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
Q9UG63 1.58e-23 107 26 17 539 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 8.01e-08 58 30 8 198 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 0.000703 46 30 2 104 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q99LE6 1.79e-23 107 26 17 539 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 2.28e-07 57 27 6 197 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 0.000736 46 30 2 104 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q2KJA2 4.54e-23 106 25 15 531 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 4.21e-07 56 37 3 99 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q6P542 6.72e-21 100 28 12 387 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 1.67e-08 61 39 2 78 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 0.000161 48 28 2 89 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6MG08 1.43e-20 99 28 12 388 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 1.82e-08 60 39 2 78 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 0.000276 47 28 2 89 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q9USH9 2.98e-20 98 26 10 386 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 0.000101 48 23 4 199 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 0.000469 46 29 11 200 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q767L0 3.45e-20 98 28 12 388 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 1.76e-08 60 40 2 77 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 0.000345 47 28 2 89 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q7YR37 3.48e-20 98 28 12 387 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 2.2e-08 60 40 2 77 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 0.000267 47 28 2 89 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q8NE71 4.18e-20 97 28 12 387 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 2.36e-08 60 40 2 77 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 0.000292 47 28 2 89 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8SRV5 1.32e-19 95 27 14 382 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 2.24e-09 63 30 5 159 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q45978 1.33e-19 95 29 18 513 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P44808 2.4e-19 95 38 4 168 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 2.07e-17 89 31 7 256 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 2.58e-12 73 28 6 240 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 3.88e-09 62 28 6 203 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P12622 2.8e-19 91 28 6 284 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 6.27e-05 48 47 1 68 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P45167 2.83e-14 78 29 13 347 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08972 2.71e-12 73 31 5 199 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.87e-06 54 28 9 226 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 2.97e-05 50 37 1 66 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5NQX0 3.64e-12 69 37 6 160 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q5NQX0 3.42e-05 48 30 4 169 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
O94489 6.61e-12 72 31 7 170 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.06e-08 62 28 6 200 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 7.06e-06 52 42 1 63 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1JPQ1 7.1e-12 69 38 10 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q98DT6 7.73e-12 69 34 7 199 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O93796 2.23e-11 70 27 4 201 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.45e-06 54 36 2 77 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 5.64e-06 53 43 1 69 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q0RT43 2.47e-11 67 36 6 162 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P29551 6.23e-11 68 29 10 227 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 8.44e-11 68 33 7 172 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 8.66e-06 52 39 1 64 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q9KQE3 6.9e-11 65 31 7 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
D0MYB4 9.43e-11 68 31 10 232 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 2.03e-07 57 31 6 160 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 6.8e-05 49 38 1 62 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
Q7MMN0 1.02e-10 65 32 6 165 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 2.9e-09 61 31 10 209 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 1.02e-10 65 32 6 165 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 2.9e-09 61 31 10 209 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q2JGF5 1.11e-10 66 34 6 163 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q75EV6 1.35e-10 67 29 6 198 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.61e-06 53 36 2 77 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 9.69e-06 52 28 4 153 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q87RE5 1.41e-10 65 33 6 163 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P25997 1.51e-10 67 29 5 195 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.46e-06 53 36 2 77 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 4.52e-06 53 28 4 158 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
B5BA33 1.56e-10 65 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain AKU_12601)
Q5PH81 1.56e-10 65 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5WCI1 1.6e-10 65 35 7 165 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
P63351 1.9e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63352 1.9e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella typhi
B4TGI0 1.9e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella heidelberg (strain SL476)
B5FJ99 1.9e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella dublin (strain CT_02021853)
Q57PU4 1.9e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella choleraesuis (strain SC-B67)
Q981Y8 1.95e-10 64 35 7 178 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B5QVV9 1.98e-10 64 35 6 182 3 btuD Vitamin B12 import ATP-binding protein BtuD Salmonella enteritidis PT4 (strain P125109)
Q6D4A8 2.82e-10 64 33 7 164 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 6.8e-07 54 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E6M2 3.16e-10 64 33 6 163 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 1.93e-08 58 28 8 197 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0K9I2 3.37e-10 64 32 8 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q6D606 3.95e-10 63 32 7 167 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D606 3.56e-06 51 28 9 208 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9WXX8 3.99e-10 63 32 8 167 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 3.3e-06 52 25 7 196 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8PP41 4.01e-10 63 31 7 176 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q89AJ0 4.51e-10 63 31 6 165 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q6LTB1 4.77e-10 63 31 7 183 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 5.05e-08 57 32 7 178 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q8Z5W6 4.96e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 0.000134 47 27 7 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q46ZU5 5.05e-10 64 32 6 180 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q5PIA5 5.39e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 0.000133 47 27 7 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 5.39e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 0.000133 47 27 7 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
P53978 5.92e-10 65 29 6 195 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 9.51e-07 55 37 2 77 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.01e-05 52 27 4 158 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O05779 6.21e-10 63 29 10 218 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q4W575 6.44e-10 64 30 7 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 2.18e-06 53 31 8 186 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 6.44e-10 64 30 7 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 2.18e-06 53 31 8 186 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A5U7B7 7.18e-10 62 29 9 205 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q3Z2L6 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 7.26e-10 63 34 6 163 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 7.26e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q32HA3 7.96e-10 63 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZNV7 7.96e-10 63 34 6 163 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 0.000143 47 27 7 215 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5HBR8 8.89e-10 62 28 8 188 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 8.89e-10 62 28 8 188 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q83KR7 1.12e-09 62 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.12e-09 62 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q8NR42 1.2e-09 62 35 9 197 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A1JRI2 1.31e-09 62 34 6 163 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 2.08e-07 55 30 7 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q5FA19 1.6e-09 63 29 7 207 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 1.03e-06 54 33 7 184 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P16521 1.63e-09 64 37 1 90 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.21e-07 58 29 5 157 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 3.25e-06 53 37 2 77 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8U648 1.74e-09 62 32 7 173 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8TTN2 2.07e-09 63 28 8 214 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q28VN1 2.12e-09 61 35 8 164 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 0.000364 45 27 7 197 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q609Q1 2.24e-09 62 32 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 5.17e-05 49 35 3 119 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8GNH6 2.31e-09 62 28 6 190 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q3IWB5 2.4e-09 61 35 7 165 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 6.73e-05 48 28 6 195 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6FFZ1 2.7e-09 61 34 8 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1B8U4 3.4e-09 61 37 6 166 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q2G9A9 3.85e-09 59 33 6 163 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5E3S7 3.99e-09 60 29 7 188 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4L8L7 4.1e-09 60 25 5 188 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus haemolyticus (strain JCSC1435)
Q8RD43 4.25e-09 62 28 7 213 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1QCN2 4.32e-09 60 32 8 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A0KPH6 4.34e-09 60 32 7 173 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q21XJ9 4.76e-09 61 32 6 184 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q4FTM3 5.36e-09 60 32 8 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9KQB8 5.4e-09 60 32 8 185 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 1.92e-07 55 30 9 209 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1CJG3 5.78e-09 60 34 7 163 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 4.34e-07 54 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 5.78e-09 60 34 7 163 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 4.34e-07 54 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 5.78e-09 60 34 7 163 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 4.34e-07 54 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 6.05e-09 60 34 7 163 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 4.46e-07 54 29 7 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3M5J9 6.19e-09 60 32 8 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q1LNM0 7.78e-09 60 31 7 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q50966 8.46e-09 60 29 8 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q50966 9.55e-07 54 32 7 184 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q58429 9.65e-09 60 28 5 152 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5WBL0 1e-08 59 31 6 166 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 3.88e-08 57 26 5 200 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q82HA2 1.05e-08 59 30 6 186 3 SAV_3608 Putative ABC transporter ATP-binding protein SAV_3608 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9A9P4 1.08e-08 59 28 8 189 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q3YSK9 1.11e-08 59 28 7 172 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
O34946 1.11e-08 59 25 5 181 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 0.000351 45 21 7 218 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q12ES3 1.2e-08 58 30 10 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q2SPI3 1.23e-08 59 34 8 178 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
O34314 1.42e-08 59 32 6 165 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q4KES7 1.51e-08 61 33 9 187 3 PFL_2149 Probable export ATP-binding/permease protein PFL_2149 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4FQ27 1.52e-08 58 29 12 238 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 0.000558 45 29 7 171 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3BSL0 1.55e-08 58 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q21TG3 1.68e-08 58 31 8 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q4KG27 1.95e-08 58 32 7 174 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KG27 0.000116 47 30 7 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7N6Z2 1.95e-08 60 29 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 3.77e-06 52 24 8 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8PK53 2.03e-08 58 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas axonopodis pv. citri (strain 306)
Q66A01 2.19e-08 58 36 8 168 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDX6 2.19e-08 58 36 8 168 3 btuD Vitamin B12 import ATP-binding protein BtuD Yersinia pestis
Q0BUR6 2.26e-08 58 35 7 176 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9HYG4 2.39e-08 58 32 9 188 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5H0W2 2.43e-08 58 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3U8 2.43e-08 58 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8U8D6 2.48e-08 58 34 6 165 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2LVL0 2.51e-08 60 23 6 267 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q1M7A6 2.59e-08 58 32 5 179 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q30V33 2.64e-08 59 29 8 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q13ZK7 2.81e-08 59 35 8 180 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q6FFL0 2.96e-08 58 30 9 204 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q28QL7 3.05e-08 59 31 8 192 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q98DW6 3.1e-08 58 33 7 178 3 tauB Taurine import ATP-binding protein TauB Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O14134 3.29e-08 60 31 8 206 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 3.84e-08 60 30 7 175 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.13e-07 56 34 3 100 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0A2U7 3.31e-08 57 25 6 182 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 3.31e-08 57 25 6 182 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4KKK4 3.35e-08 58 32 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 2.85e-06 52 28 8 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0BFQ0 3.71e-08 58 32 9 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q21PQ7 4.06e-08 58 32 8 171 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P44656 4.74e-08 57 30 8 208 3 HI_0354 Uncharacterized ABC transporter ATP-binding protein HI_0354 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1IGY7 5.05e-08 57 31 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 0.00011 47 27 8 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1Q889 5.18e-08 57 29 10 227 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 0.000323 46 29 7 171 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6NDA6 5.21e-08 56 28 8 195 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8P8M1 5.44e-08 57 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVG2 5.44e-08 57 32 8 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xanthomonas campestris pv. campestris (strain 8004)
Q5XCA4 5.5e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q0RKH4 6.45e-08 57 33 6 175 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q9HYF9 6.54e-08 57 32 7 181 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QT6 6.54e-08 57 32 7 181 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q890D1 6.76e-08 57 30 8 189 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1GS38 6.81e-08 56 31 6 164 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q7N3Q4 6.82e-08 57 28 8 212 3 btuD Vitamin B12 import ATP-binding protein BtuD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q47T99 7.04e-08 58 30 6 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
C3LLU1 7.53e-08 57 30 6 192 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain M66-2)
Q9KSL1 7.53e-08 57 30 6 192 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0CZ35 7.56e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 7.56e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 7.56e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0BV49 7.57e-08 57 31 7 202 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q1J6Q6 7.63e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 7.63e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 7.63e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 7.63e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7CN92 7.9e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 7.9e-08 58 30 8 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q4FMG5 8.1e-08 57 30 7 172 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q7UPK3 8.21e-08 57 25 9 237 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7UPK3 5.29e-06 51 26 6 186 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9X1Z1 8.46e-08 57 24 10 238 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X1Z1 7.18e-05 48 28 9 219 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O52618 8.55e-08 57 27 6 190 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q895C4 8.91e-08 57 27 8 190 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q88RL1 9.02e-08 57 31 7 165 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 2.78e-05 49 27 8 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P0A9U0 9.23e-08 56 28 4 187 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9U0 2.51e-05 49 26 7 214 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Shigella flexneri
P0A9T8 9.23e-08 56 28 4 187 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T8 2.51e-05 49 26 7 214 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli (strain K12)
P0A9T9 9.23e-08 56 28 4 187 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
P0A9T9 2.51e-05 49 26 7 214 3 ybbA Uncharacterized ABC transporter ATP-binding protein YbbA Escherichia coli O157:H7
Q3KKA1 9.55e-08 57 32 7 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.87e-07 56 30 8 198 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q6Q876 9.9e-08 58 27 6 218 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q555Z5 1.05e-07 58 31 8 170 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q555Z5 0.000797 46 29 6 179 3 abcA4 ABC transporter A family member 4 Dictyostelium discoideum
Q9PPV1 1.08e-07 57 26 10 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q74DN5 1.14e-07 56 30 9 208 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6CYU2 1.16e-07 56 33 5 170 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P50332 1.16e-07 57 29 5 181 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 0.000221 47 29 8 184 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q7N545 1.17e-07 56 33 6 163 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 1.31e-07 56 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D201 1.2e-07 57 25 5 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1RB86 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain UTI89 / UPEC)
Q8FH28 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THB9 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABP5 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O1:K1 / APEC
B7MV91 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O81 (strain ED1a)
B7MAS0 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O45:K1 (strain S88 / ExPEC)
B7US48 1.24e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q89UD2 1.29e-07 57 31 9 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3KE48 1.33e-07 58 34 9 189 3 Pfl01_2215 Probable export ATP-binding/permease protein Pfl01_2215 Pseudomonas fluorescens (strain Pf0-1)
Q02QT1 1.36e-07 56 32 9 188 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q63TY1 1.37e-07 57 31 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q8CRI7 1.39e-07 56 25 6 186 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM28 1.39e-07 56 25 6 186 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q87MK8 1.4e-07 55 28 5 186 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6N6K5 1.41e-07 56 32 7 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3Z257 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella sonnei (strain Ss046)
Q7C1M3 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri
Q0T4R9 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella flexneri serotype 5b (strain 8401)
Q32FJ0 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella dysenteriae serotype 1 (strain Sd197)
B1LE21 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SMS-3-5 / SECEC)
B6I8R4 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain SE11)
B7N547 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IPL8 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0Q1 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O9:H4 (strain HS)
B7M1B8 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O8 (strain IAI1)
B7NTS2 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L6I2 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain 55989 / EAEC)
A7ZMH7 1.42e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O139:H28 (strain E24377A / ETEC)
Q07LQ4 1.44e-07 56 33 5 169 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q48FT0 1.44e-07 56 31 7 183 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1IKM7 1.45e-07 55 29 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Koribacter versatilis (strain Ellin345)
Q62K82 1.47e-07 57 31 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
B5YPZ7 1.51e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X5W0 1.51e-07 56 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli O157:H7
Q1CHI9 1.53e-07 55 32 7 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZD58 1.53e-07 55 32 7 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis
Q1C647 1.53e-07 55 32 7 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pestis bv. Antiqua (strain Antiqua)
Q88R93 1.55e-07 56 32 8 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 0.000258 46 31 8 171 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q57538 1.6e-07 57 26 3 176 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57538 5.11e-05 49 26 10 218 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q668T8 1.64e-07 55 32 7 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8KZQ6 1.76e-07 56 32 9 188 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q8KZQ6 4.09e-05 48 32 8 171 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
P40860 1.82e-07 57 32 7 185 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40860 4.39e-06 52 29 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q321G6 1.91e-07 55 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 4 (strain Sb227)
Q44613 1.93e-07 55 23 5 187 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B2U358 1.96e-07 55 34 10 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z4V6 2e-07 56 32 7 185 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q8Z4V6 5.51e-06 52 29 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
Q87BH8 2.01e-07 55 34 5 158 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q39GT7 2.07e-07 56 30 6 174 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q57213 2.13e-07 55 31 6 170 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57213 5.14e-05 47 35 2 84 3 HI_1474 Uncharacterized ABC transporter ATP-binding protein HI_1474 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5F1V0 2.25e-07 55 30 6 192 3 btuD Vitamin B12 import ATP-binding protein BtuD Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0A9U2 2.27e-07 57 23 16 498 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U2 0.000167 48 29 6 172 3 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Shigella flexneri
P0A9U1 2.27e-07 57 23 16 498 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
P0A9U1 0.000167 48 29 6 172 1 ybhF Probable multidrug ABC transporter ATP-binding protein YbhF Escherichia coli (strain K12)
Q0VTB6 2.37e-07 55 32 8 173 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 0.000696 45 30 7 174 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P06611 2.47e-07 55 33 9 183 1 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12)
B1XG16 2.47e-07 55 33 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / DH10B)
C4ZYH1 2.47e-07 55 33 9 183 3 btuD Vitamin B12 import ATP-binding protein BtuD Escherichia coli (strain K12 / MC4100 / BW2952)
A1U776 2.48e-07 55 29 7 194 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1CDR0 2.63e-07 55 33 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 2.63e-07 55 33 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 2.63e-07 55 33 7 175 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q0I4A9 2.67e-07 55 36 6 162 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q0I4A9 0.000625 45 28 9 198 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q1BWI2 2.76e-07 55 31 6 171 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q4K441 2.97e-07 55 32 9 183 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7W9U5 3.08e-07 56 31 8 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W9U5 0.001 45 34 1 90 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WGW1 3.08e-07 56 31 8 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WGW1 0.000899 45 34 1 90 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VZE5 3.11e-07 56 31 8 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VZE5 0.001 45 34 1 90 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2KBP5 3.24e-07 54 29 7 174 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2KBP5 3.31e-05 48 22 6 224 1 bioM Biotin transport ATP-binding protein BioM Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9LZB8 3.35e-07 56 27 7 221 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
Q0SK28 3.43e-07 55 34 7 171 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q665B6 3.56e-07 55 32 7 168 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q00564 3.67e-07 56 27 4 200 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
Q8H1R4 3.93e-07 55 26 7 191 1 ABCI10 ABC transporter I family member 10 Arabidopsis thaliana
Q9HT73 4.05e-07 55 31 6 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 4.7e-05 48 24 6 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 4.05e-07 55 31 6 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 4.7e-05 48 24 6 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8TK65 4.21e-07 56 27 8 191 3 MA_3551 Putative ABC transporter ATP-binding protein MA_3551 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q55740 4.23e-07 55 33 7 197 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0A9E2 4.3e-07 55 30 8 185 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q31FG2 4.33e-07 56 24 11 274 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q2RPB4 4.44e-07 56 28 10 220 3 macB Macrolide export ATP-binding/permease protein MacB Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q21CA3 4.61e-07 55 26 7 199 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q47087 4.69e-07 55 29 8 199 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q9I6T2 4.84e-07 55 30 8 183 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8T6J2 4.88e-07 56 27 6 193 3 abcA5 ABC transporter A family member 5 Dictyostelium discoideum
Q4ZQE3 4.97e-07 55 29 8 204 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q39GW5 5.13e-07 55 32 5 167 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6CZ34 5.27e-07 55 29 6 179 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9PAP0 5.29e-07 54 33 6 169 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Xylella fastidiosa (strain 9a5c)
Q1BWL4 5.31e-07 55 32 5 167 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 5.31e-07 55 32 5 167 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q89ER4 5.37e-07 54 30 5 170 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8DZJ0 5.39e-07 55 26 6 178 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 5.39e-07 55 26 6 178 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 5.39e-07 55 26 6 178 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q87UN0 5.5e-07 54 30 6 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 3.74e-06 52 28 8 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1IGL4 5.57e-07 54 32 9 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q1IGL4 0.00058 45 32 9 171 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q668K6 5.69e-07 55 30 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 1.51e-06 53 27 9 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q885N4 5.72e-07 54 32 8 177 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8D0W8 5.84e-07 55 30 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8D0W8 1.95e-06 53 27 9 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8FFB3 5.94e-07 55 33 7 184 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FFB3 9.75e-07 54 30 6 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBJ8 5.99e-07 55 33 7 184 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q8XBJ8 8.92e-07 54 29 6 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
A1URR2 6.01e-07 55 29 6 175 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
P16676 6.04e-07 55 33 7 184 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
P16676 8.54e-07 54 29 6 181 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q9G4F5 6.08e-07 55 29 7 187 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8PZN0 6.25e-07 55 26 8 191 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8XZQ4 6.37e-07 54 32 7 176 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A3PRY1 6.38e-07 55 30 7 186 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q7NIW1 6.48e-07 55 32 7 183 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9JUX4 6.64e-07 55 29 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JUX4 0.000167 47 33 3 103 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P78966 6.69e-07 56 29 5 174 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 0.000416 47 24 5 203 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q55463 6.87e-07 54 26 7 182 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8UC12 7.04e-07 53 29 6 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7UC29 7.09e-07 55 32 7 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7UC29 9.33e-07 54 30 6 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q7N3S7 7.1e-07 54 31 5 184 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P55476 7.12e-07 55 29 7 196 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P55476 7.92e-07 54 28 12 291 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9I3N7 7.2e-07 53 31 8 175 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10091 7.81e-07 55 33 7 166 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
Q93DX8 7.85e-07 54 30 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
O32188 8.04e-07 54 29 7 181 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q46ZM0 8.06e-07 55 28 6 180 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1RDS4 8.1e-07 53 31 7 173 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 8.1e-07 53 31 7 173 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q62GB4 8.46e-07 54 31 8 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q63Q62 8.54e-07 54 31 8 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
P45051 8.63e-07 54 25 7 195 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6D2F6 8.76e-07 54 25 9 260 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8XZP8 8.9e-07 54 31 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7UX73 9.02e-07 53 28 7 203 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9JZW0 9.06e-07 54 29 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JZW0 0.000158 47 33 3 103 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9Z651 9.25e-07 53 30 6 173 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Tatumella citrea
Q9Z651 0.000225 46 24 6 207 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Tatumella citrea
Q4ZZS2 9.53e-07 53 30 6 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 1.04e-05 50 28 8 199 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q8FJ95 9.73e-07 53 32 8 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8F6Z1 1.04e-06 54 29 8 191 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8F6Z1 0.000359 46 33 2 102 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 1.04e-06 54 29 8 191 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q72PE5 0.000359 46 33 2 102 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q2SU77 1.08e-06 54 31 8 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JMW7 1.09e-06 54 31 8 163 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
P44692 1.1e-06 53 31 8 191 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3IX40 1.1e-06 54 30 8 187 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q31I51 1.15e-06 53 30 7 173 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.21e-05 50 25 7 193 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q48PV0 1.22e-06 53 30 6 163 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 7.25e-06 51 27 10 229 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1RGL1 1.24e-06 53 27 6 166 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 0.000733 44 27 9 177 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q9VSS1 1.27e-06 54 27 7 185 1 pix Protein Pixie Drosophila melanogaster
Q8ZR89 1.32e-06 53 27 6 189 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8D385 1.32e-06 53 28 7 169 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q6AMR9 1.45e-06 52 23 7 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8PHQ3 1.51e-06 53 34 6 170 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q5PCG9 1.51e-06 53 27 6 189 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6MD10 1.51e-06 52 25 5 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q8FVT0 1.56e-06 53 26 7 185 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q2YKZ7 1.56e-06 53 26 7 185 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.56e-06 53 26 7 185 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8Z8R5 1.57e-06 53 28 5 189 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q4ZT65 1.58e-06 54 33 8 184 3 syfD Probable syringafactin export ATP-binding/permease protein SyfD Pseudomonas syringae pv. syringae (strain B728a)
Q81LM1 1.61e-06 53 31 10 182 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q8RLB6 1.7e-06 52 33 7 166 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Delftia acidovorans
Q7NRX5 1.72e-06 53 28 9 220 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0TJC1 1.72e-06 53 32 8 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8UA73 1.72e-06 53 30 7 185 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1MAL7 1.72e-06 52 27 7 179 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q13DS7 1.79e-06 52 30 5 180 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q13DS7 0.000482 45 30 7 152 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhodopseudomonas palustris (strain BisB5)
Q2IXX0 1.87e-06 54 31 10 195 3 macB Macrolide export ATP-binding/permease protein MacB Rhodopseudomonas palustris (strain HaA2)
Q0K998 1.92e-06 53 28 6 180 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5YYR7 1.93e-06 52 35 4 161 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Nocardia farcinica (strain IFM 10152)
Q2W4W1 1.98e-06 53 31 6 166 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W4W1 0.000126 47 29 6 172 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8DWR3 1.98e-06 53 26 6 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 1.98e-06 53 26 6 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 1.98e-06 53 26 6 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A1B9H9 2.01e-06 52 32 5 164 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
A1B9H9 0.000437 45 28 7 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
P54933 2.14e-06 53 28 7 191 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
A8AHA1 2.14e-06 52 33 5 176 3 btuD Vitamin B12 import ATP-binding protein BtuD Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P33951 2.15e-06 53 33 10 200 3 syrD ATP-binding protein SyrD Pseudomonas syringae pv. syringae
Q8KLG1 2.18e-06 53 29 7 182 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6NDQ0 2.19e-06 53 25 5 185 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P37624 2.36e-06 54 27 8 211 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q2J3T0 2.46e-06 52 32 11 203 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q6F9A8 2.48e-06 53 29 7 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F9A8 0.000158 47 27 2 144 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1WXT0 2.49e-06 52 30 7 155 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 6.6e-05 48 26 7 198 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q81J16 2.55e-06 52 33 8 159 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88EX5 2.56e-06 52 30 7 175 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q21JQ9 2.66e-06 52 23 7 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q83J77 2.7e-06 52 30 9 195 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q32I01 2.73e-06 52 30 7 178 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q32I01 0.000105 47 29 4 148 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
Q0S6U9 2.82e-06 52 32 7 171 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Rhodococcus jostii (strain RHA1)
O15439 2.85e-06 53 30 5 155 1 ABCC4 ATP-binding cassette sub-family C member 4 Homo sapiens
P07821 2.87e-06 52 33 7 160 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
Q63TX3 2.9e-06 52 28 6 183 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q87R20 2.94e-06 52 28 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3JSQ0 2.95e-06 52 28 6 183 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 2.95e-06 52 28 6 183 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q97UY8 3.15e-06 53 25 8 227 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q1GJU0 3.19e-06 52 34 8 182 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
Q92G36 3.28e-06 52 26 6 164 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q92L55 3.32e-06 51 28 5 169 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Rhizobium meliloti (strain 1021)
Q2SRI1 3.37e-06 53 27 9 201 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q82CD3 3.39e-06 52 30 4 161 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q73R11 3.61e-06 53 27 8 190 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q2SVN0 3.64e-06 52 31 6 172 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVN0 0.000686 45 28 6 180 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
O34977 3.74e-06 52 26 6 181 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
Q9TKX3 3.79e-06 52 26 9 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 1.46e-05 50 32 8 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q2VZJ1 3.81e-06 51 34 8 182 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q39EV3 3.82e-06 52 28 6 189 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1D382 3.9e-06 51 25 9 244 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Myxococcus xanthus (strain DK1622)
Q4UJW5 3.91e-06 51 26 6 164 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P0A9S0 3.93e-06 51 32 4 146 3 ftsE Cell division ATP-binding protein FtsE Shigella flexneri
P0A9R7 3.93e-06 51 32 4 146 1 ftsE Cell division ATP-binding protein FtsE Escherichia coli (strain K12)
P0A9R8 3.93e-06 51 32 4 146 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9R9 3.93e-06 51 32 4 146 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O157:H7
Q87Z03 3.95e-06 51 29 5 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P61222 4.09e-06 53 25 6 185 1 Abce1 ATP-binding cassette sub-family E member 1 Mus musculus
P61221 4.09e-06 53 25 6 185 1 ABCE1 ATP-binding cassette sub-family E member 1 Homo sapiens
Q57399 4.1e-06 52 29 5 159 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6GE75 4.1e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MRSA252)
Q7A3X3 4.26e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain N315)
Q99RR8 4.26e-06 51 35 1 73 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Mu50 / ATCC 700699)
P95487 4.27e-06 51 30 7 175 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas putida (strain GB-1)
Q2YZ26 4.3e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NV47 4.42e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MW2)
Q6G6W1 4.42e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain MSSA476)
A6QJK1 4.42e-06 51 35 1 73 2 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain Newman)
Q5HDJ6 4.42e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain COL)
Q2FVR1 4.42e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED7 4.42e-06 51 35 1 73 3 hrtA Putative hemin import ATP-binding protein HrtA Staphylococcus aureus (strain USA300)
Q81IN8 4.5e-06 52 28 6 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5WKG4 4.51e-06 51 33 9 170 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
O31339 4.55e-06 52 29 7 188 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9UT95 4.71e-06 52 26 8 216 3 SPAC323.04 Uncharacterized ABC transporter ATP-binding protein C323.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q93SH7 4.79e-06 52 32 5 179 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9LID6 4.88e-06 53 24 6 189 2 ABCE1 ABC transporter E family member 1 Arabidopsis thaliana
Q57S53 4.9e-06 52 27 6 184 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q5MK06 5.03e-06 53 28 8 190 1 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae
A0R6H8 5.04e-06 53 32 6 174 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q48GL0 5.09e-06 51 29 5 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48GL0 0.000444 45 31 6 172 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q50294 5.14e-06 52 26 8 182 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q1LKR4 5.24e-06 50 29 7 201 3 ccmA1 Cytochrome c biogenesis ATP-binding export protein CcmA 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5LUR8 5.34e-06 51 33 7 162 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6HP89 5.42e-06 52 27 7 202 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8GQ92 5.43e-06 50 29 7 201 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas aeruginosa
Q5F6V6 5.44e-06 52 28 8 190 3 macB Macrolide export ATP-binding/permease protein MacB Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q31GF5 5.49e-06 51 25 6 205 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A0LCH8 5.51e-06 51 30 6 174 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 0.000278 46 27 6 176 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q04EY5 5.64e-06 51 27 7 181 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q81ZF5 5.67e-06 52 27 7 202 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q13I12 5.79e-06 51 30 6 182 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Paraburkholderia xenovorans (strain LB400)
P74548 5.79e-06 52 29 7 184 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0C0E2 5.96e-06 51 27 6 181 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 5.96e-06 51 27 6 181 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q9K876 5.99e-06 52 27 6 181 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 0.000529 46 30 2 100 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q63GR8 6.03e-06 52 27 7 202 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q63TW1 6.06e-06 52 31 6 172 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q8XZX8 6.14e-06 52 28 5 175 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5F4X8 6.71e-06 52 26 8 222 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1CI46 6.81e-06 50 32 8 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 6.81e-06 50 32 8 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 6.81e-06 50 32 8 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q63MM6 6.92e-06 52 26 6 193 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia pseudomallei (strain K96243)
Q3JGG7 6.92e-06 52 26 6 193 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia pseudomallei (strain 1710b)
Q3JSR6 6.97e-06 52 31 6 172 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q62K56 6.97e-06 52 31 6 172 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q8XXY9 6.99e-06 51 29 7 174 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 0.00013 47 25 5 175 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3KFY6 7.15e-06 50 30 7 172 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain Pf0-1)
Q3KFY6 4.34e-05 48 31 9 185 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas fluorescens (strain Pf0-1)
Q81V82 7.21e-06 51 28 7 180 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
O34631 7.22e-06 52 34 7 181 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
Q2J2E9 7.24e-06 52 24 5 185 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
A0LM36 7.3e-06 52 27 7 193 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
P77622 7.33e-06 51 29 7 171 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q73EL7 7.33e-06 51 28 6 182 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
P38046 7.52e-06 51 28 6 182 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q81GU1 7.6e-06 52 29 7 188 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GU1 0.001 45 34 2 83 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P26362 7.74e-06 52 25 4 171 1 CFTR Cystic fibrosis transmembrane conductance regulator Squalus acanthias
Q5PB72 7.9e-06 50 26 8 180 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q2NU23 7.94e-06 50 31 8 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 5.6e-05 48 28 9 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q73L25 8.06e-06 50 24 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q1MEG2 8.1e-06 51 30 8 164 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8ZPK4 8.11e-06 52 24 6 186 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q881U6 8.72e-06 50 31 6 161 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0VR80 9.22e-06 50 30 6 170 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q5HDY6 9.37e-06 50 24 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 9.37e-06 50 24 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 9.37e-06 50 24 7 202 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
A0KMJ3 9.49e-06 52 32 10 196 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VN12 9.52e-06 50 28 8 201 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q68Y13 9.75e-06 50 25 8 187 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10895
Feature type CDS
Gene uup
Product ATPase components of ABC transporters with duplicated ATPase domains
Location 68100 - 69668 (strand: -1)
Length 1569 (nucleotides) / 522 (amino acids)
In genomic island -

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1060
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Protein Sequence

MSVQCHFSHLSVTFNDIPLFDNISGTLTRQVQGLTGHNGRGKSVLMSLLAQQRQPASGTISWQVPFYYVPQLTRLSGITLADALGTAEILTALRRTEDGTATAEDYDFLADKWDMPRQQQSLLESAQLAHLPADTLCTSLSGGEQTRLALCRAFLQPCAFLLLDEPGNHLDAAGRRWLGEQLRNHPAGALVISHERRLLDTMQRIFELTPSALEEYGGNYTHYAEQKAFQLSALQSEEKQLQSQLNREKTELQRTLEKKAQRRRQGEKVRSSGSSSALLLDMKKNKAEKQQSKITGRHDRVMTQLDSQRREVNEKIQHITPQMLAFNYTGEQKRVRINTRDLILPSGTQEPLSLTISGGEHWHIAGRNGCGKSTLLKVLAGLLTAKSGEYSLHGRLRYLDQHLALLNKALPVTEALCEFDPAIPAQTWRTHLGALRIRGDKGLIPLSQLSGGEQLKVTLLALTLSEPLPDILLLDEPDNHLDLDSRLLLENVLRSYKGALLLVSHDEAFTENCAITHILTLA

Flanking regions ( +/- flanking 50bp)

CTTTTTTATCCGGCATATCCGCCTGCCCCTGTTTATTCAGGAGCTTTTGTATGTCCGTACAATGCCATTTTTCTCACTTATCAGTGACATTTAACGATATTCCGCTGTTTGACAACATCAGCGGCACATTAACCCGTCAGGTTCAGGGGTTGACCGGTCATAACGGGCGCGGTAAATCCGTGCTGATGTCGCTGCTCGCGCAGCAGCGGCAACCGGCCTCCGGTACGATCAGCTGGCAGGTGCCGTTTTATTATGTGCCGCAGCTGACCCGCCTTTCCGGTATCACACTGGCGGATGCTCTCGGAACCGCAGAAATTCTGACCGCACTGCGCCGCACAGAGGACGGCACCGCCACCGCAGAGGATTATGATTTTCTGGCGGATAAATGGGATATGCCACGACAACAACAATCCCTGCTGGAAAGTGCGCAGCTGGCGCATCTCCCGGCGGACACCCTCTGCACAAGTCTGAGCGGCGGTGAGCAAACCCGGCTGGCACTCTGCCGTGCCTTTTTACAGCCGTGTGCCTTCCTGTTACTGGACGAACCCGGAAACCATCTGGATGCCGCCGGACGCCGCTGGCTCGGTGAGCAACTGCGGAATCATCCGGCCGGTGCACTGGTGATCAGCCACGAGCGCCGCTTGCTCGACACCATGCAGCGGATTTTTGAACTCACTCCATCGGCTCTGGAAGAGTACGGCGGCAATTACACCCATTATGCCGAGCAGAAAGCCTTTCAGCTCAGCGCATTACAGAGTGAGGAGAAGCAGTTACAGTCACAGCTGAACAGAGAAAAAACGGAGTTACAGCGCACACTGGAAAAGAAAGCACAGCGCCGCCGTCAGGGCGAGAAAGTCCGTTCATCCGGCTCCTCCTCTGCCCTGCTGCTGGATATGAAAAAGAACAAAGCGGAGAAGCAGCAATCAAAAATAACCGGCCGTCATGACCGTGTTATGACTCAGCTTGACAGCCAGCGCCGGGAAGTAAATGAGAAAATACAGCATATCACCCCGCAGATGCTGGCCTTTAATTATACAGGAGAGCAAAAACGGGTGCGGATCAATACCCGTGATCTGATTTTGCCGTCCGGCACACAAGAGCCTCTGTCACTGACCATTTCCGGTGGTGAACACTGGCATATTGCCGGGCGCAACGGCTGCGGAAAATCCACATTACTGAAAGTACTGGCGGGCCTGCTCACGGCAAAATCCGGGGAGTACTCCCTGCACGGCCGTCTGCGATATCTGGATCAGCACCTGGCGCTGCTGAATAAAGCCCTGCCGGTCACAGAAGCACTGTGCGAGTTTGATCCGGCCATTCCGGCACAAACCTGGCGCACCCATCTGGGTGCATTGCGGATCCGGGGTGATAAGGGGTTAATTCCGCTGTCACAGTTAAGCGGCGGTGAACAACTGAAAGTCACATTGCTGGCATTAACATTATCCGAACCTTTGCCGGATATTTTATTGCTGGATGAGCCGGATAACCACCTGGATCTCGATTCCCGGTTATTACTGGAAAATGTACTGCGCAGTTATAAAGGGGCATTATTACTGGTCAGTCATGATGAGGCATTTACTGAAAATTGTGCCATTACCCATATACTGACCTTAGCCTGAAAAAAGAATACGGCGGTAATTCCGCCGTATTGCTACAGTTTACAGATATT