Homologs in group_1851

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13450 FBDBKF_13450 82.3 Morganella morganii S1 znuC manganese/iron ABC transporter ATP-binding protein
EHELCC_08645 EHELCC_08645 82.3 Morganella morganii S2 znuC manganese/iron ABC transporter ATP-binding protein
NLDBIP_08970 NLDBIP_08970 82.3 Morganella morganii S4 znuC manganese/iron ABC transporter ATP-binding protein
LHKJJB_05295 LHKJJB_05295 82.3 Morganella morganii S3 znuC manganese/iron ABC transporter ATP-binding protein
HKOGLL_05620 HKOGLL_05620 82.3 Morganella morganii S5 znuC manganese/iron ABC transporter ATP-binding protein
F4V73_RS03315 F4V73_RS03315 80.6 Morganella psychrotolerans - manganese/iron ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_1851

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1851

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q56953 3.53e-168 471 77 0 288 3 yfeB Chelated iron transport system membrane protein YfeB Yersinia pestis
P44662 7.79e-141 402 66 0 278 3 HI_0361 Probable iron transport system ATP-binding protein HI_0361 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q55281 4.6e-105 309 62 0 235 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KD30 3.77e-65 207 42 3 244 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92AF9 2.09e-63 202 42 2 233 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O34338 1.09e-62 201 42 2 234 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
P96117 2.7e-62 201 41 2 235 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q8Y651 2.7e-61 197 40 2 233 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P48334 1.32e-56 185 42 2 233 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
P42360 6.57e-56 184 40 3 236 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
Q9PKX1 4.88e-55 182 38 2 232 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q9Z8J5 9.12e-55 181 39 2 232 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
O84071 1.12e-53 178 37 2 232 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q926D8 3.41e-42 149 37 3 225 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q9XDA6 1.18e-40 144 36 3 225 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q57243 1.03e-35 132 30 4 236 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34946 1.17e-35 131 36 4 207 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34510 8.45e-34 127 32 7 241 3 yfmF Fe(3+)-citrate import ATP-binding protein YfmF Bacillus subtilis (strain 168)
Q0VTB6 1.98e-32 123 34 4 236 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q9Z810 2.53e-32 122 37 3 213 3 CPn_0542 Probable metal transport system ATP-binding protein CPn_0542/CP_0210/CPj0542/CpB0563 Chlamydia pneumoniae
O69051 6.87e-32 122 34 8 248 3 ptxA Phosphite import ATP-binding protein PxtA Stutzerimonas stutzeri
Q92CK1 8.46e-32 122 33 4 233 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O52618 8.78e-32 123 32 4 216 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
Q57399 1.1e-31 121 29 3 237 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q39GT7 1.2e-31 122 31 5 225 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9WXX8 1.68e-31 120 33 4 221 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8GNH6 2.81e-31 122 32 4 215 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti
Q47087 5e-31 120 34 5 214 3 cbrD Achromobactin transport ATP-binding protein CbrD Dickeya dadantii (strain 3937)
Q8KFD6 6.99e-31 120 32 6 248 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P15031 1.99e-30 118 32 5 240 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
P0A2U7 2.16e-30 117 32 4 213 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 2.16e-30 117 32 4 213 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q89AJ0 2.21e-30 117 29 5 236 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8NQH4 4.47e-30 117 32 7 246 3 phnC Phosphonates import ATP-binding protein PhnC Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1M7W6 4.92e-30 118 32 4 213 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8Y7R4 5.57e-30 117 31 5 238 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P23703 6.89e-30 118 31 5 224 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q720M2 7.78e-30 117 31 5 238 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q3IWB5 1.53e-29 115 34 5 218 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P49938 3.86e-29 115 32 7 239 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
Q1BWI2 4.22e-29 115 32 4 202 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1CJG3 4.71e-29 114 34 8 235 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 4.71e-29 114 34 8 235 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 4.71e-29 114 34 8 235 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 5.63e-29 114 34 8 235 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
P07821 6.22e-29 114 30 7 243 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
Q2FRT7 7.15e-29 117 32 5 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q748K0 8.14e-29 114 33 5 229 3 GSU3001 Putative ABC transporter ATP-binding protein GSU3001 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6D4A8 9.58e-29 113 32 7 234 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P08720 1.06e-28 114 32 4 213 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P72335 1.12e-28 114 30 4 213 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q0SWH9 1.12e-28 114 31 7 252 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q2RZ08 1.23e-28 114 31 7 263 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
Q8UF79 1.43e-28 114 32 6 235 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7N545 1.45e-28 113 32 6 234 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q81V82 1.6e-28 113 29 5 236 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q0TUN8 1.7e-28 113 31 7 252 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A1JRI2 1.95e-28 112 33 8 235 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q1LKJ2 2.29e-28 114 30 5 224 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q2NHA1 2.9e-28 112 29 4 234 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q3IM24 2.92e-28 112 32 4 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q0BZD8 3.66e-28 112 33 9 242 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q1J255 3.96e-28 112 33 8 260 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q6FFL0 5.96e-28 111 29 3 244 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3AKM8 7.01e-28 111 31 6 222 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q21PQ7 8.52e-28 111 31 6 236 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
P50332 1.44e-27 112 30 4 215 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
Q8Z5W6 1.5e-27 110 31 7 247 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
O34362 1.55e-27 115 29 7 252 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 1.33e-16 83 27 6 222 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q5PIA5 1.75e-27 110 32 8 247 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.75e-27 110 32 8 247 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q58488 1.81e-27 110 30 4 221 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O27739 1.88e-27 111 30 3 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9RZU5 2.6e-27 110 32 10 264 3 hmuV Hemin import ATP-binding protein HmuV Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q8ZNV7 3.11e-27 109 32 8 247 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8UCM5 3.59e-27 109 31 6 236 3 hmuV Hemin import ATP-binding protein HmuV Agrobacterium fabrum (strain C58 / ATCC 33970)
O57872 4.37e-27 109 34 5 227 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q9HT73 5.12e-27 109 32 5 246 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 5.12e-27 109 32 5 246 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q2GJA5 5.34e-27 108 31 5 234 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q8TTN2 5.74e-27 112 33 5 221 3 MA_0394 Putative ABC transporter ATP-binding protein MA_0394 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8FUU5 6.02e-27 109 32 6 234 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q10V16 6.1e-27 108 29 5 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Trichodesmium erythraeum (strain IMS101)
Q2JPW6 6.17e-27 108 33 8 247 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q57554 6.88e-27 108 27 5 237 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6LTB1 1.02e-26 108 33 5 232 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
A0KPH6 1.03e-26 108 31 3 223 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q97JB8 1.11e-26 108 30 4 247 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q88RL1 1.18e-26 108 32 7 244 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5UW69 1.25e-26 108 30 4 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q4ZZS2 1.29e-26 108 32 5 234 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
P55476 1.41e-26 109 30 5 223 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q28VN1 1.45e-26 107 32 5 234 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q92P76 1.5e-26 108 32 5 236 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q8Z0H0 1.52e-26 109 34 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8XNY7 1.56e-26 108 30 7 252 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q81LM1 1.93e-26 107 30 4 215 1 fpuC Petrobactin import ATP-binding protein FpuC Bacillus anthracis
Q84EY8 2.19e-26 107 30 8 246 3 hmuV Hemin import ATP-binding protein HmuV Enterobacter cloacae
O32188 2.21e-26 107 29 5 237 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q3Z2L6 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.27e-26 107 30 5 246 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.27e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q5E6M2 2.5e-26 107 32 4 234 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
P23878 2.56e-26 107 28 5 236 1 fepC Ferric enterobactin transport ATP-binding protein FepC Escherichia coli (strain K12)
Q32HA3 2.6e-26 107 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8KLG1 2.84e-26 108 30 5 222 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2SB47 2.9e-26 107 32 6 231 3 hmuV Hemin import ATP-binding protein HmuV Hahella chejuensis (strain KCTC 2396)
Q20ZP0 3.56e-26 107 32 7 264 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisB18)
Q13ZJ1 4.04e-26 107 30 5 226 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q5LUR8 4.08e-26 106 31 6 244 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P26050 4.19e-26 107 30 5 220 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6WB63 4.28e-26 107 30 4 234 3 phnC Phosphonates import ATP-binding protein PhnC Alcaligenes faecalis
Q576K0 5.59e-26 107 32 6 234 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 5.59e-26 107 32 6 234 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q3JSQ0 5.62e-26 107 30 4 202 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 5.62e-26 107 30 4 202 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q6G475 5.81e-26 106 32 7 238 3 hmuV Hemin import ATP-binding protein HmuV Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q63TX3 5.86e-26 107 30 4 202 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q31J97 6e-26 106 30 8 247 3 hmuV Hemin import ATP-binding protein HmuV Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9V2E4 6.06e-26 106 31 6 246 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q9HQ18 6.74e-26 108 34 5 219 1 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G4 6.74e-26 108 34 5 219 3 btuD Cobalamin import ATP-binding protein BtuD Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
O31427 7.05e-26 105 34 5 211 1 skfE SkfA peptide export ATP-binding protein SkfE Bacillus subtilis (strain 168)
Q8DIA0 7.32e-26 107 32 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8K9M6 7.57e-26 105 30 6 251 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q83KR7 8.25e-26 105 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 8.25e-26 105 30 5 246 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q48PV0 8.45e-26 105 32 4 223 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SVP3 8.48e-26 107 30 4 202 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q88DY1 8.89e-26 105 31 6 230 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q2W4W1 9.28e-26 105 33 5 227 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9Z3I3 9.28e-26 107 31 5 219 3 nodI Nod factor export ATP-binding protein I Bradyrhizobium sp. (strain SNU001)
Q12R52 9.56e-26 105 29 6 226 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q6RCE0 1.1e-25 105 28 11 281 3 phnC Phosphonates import ATP-binding protein PhnC Stutzerimonas stutzeri
Q7M8M4 1.17e-25 105 31 7 248 3 phnC Phosphonates import ATP-binding protein PhnC Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q16BC5 1.18e-25 105 32 4 216 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q92VJ2 1.22e-25 107 31 8 264 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q4KKK4 1.43e-25 105 31 5 237 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1GMA8 1.49e-25 105 29 6 247 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Ruegeria sp. (strain TM1040)
Q8YDJ8 1.84e-25 105 31 6 234 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A2RI02 1.85e-25 105 32 2 199 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactococcus lactis subsp. cremoris (strain MG1363)
Q7N3S7 2.02e-25 105 28 9 269 3 hmuV Hemin import ATP-binding protein HmuV Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q50801 2.45e-25 105 32 4 211 3 MTBMA_c05830 Putative ABC transporter ATP-binding protein MTBMA_c05830 Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
P74548 2.46e-25 106 31 4 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q87UN0 2.48e-25 104 31 4 223 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q73P71 2.73e-25 104 27 4 229 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q92N13 3.02e-25 104 30 6 240 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium meliloti (strain 1021)
Q2IYS5 3.37e-25 104 31 3 216 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain HaA2)
Q74DN5 3.46e-25 103 30 5 224 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7NIW1 3.59e-25 105 33 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q160Y9 3.61e-25 103 31 4 232 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0AU85 4.65e-25 105 30 3 229 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1MEG2 4.98e-25 104 30 7 239 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9CK97 5.45e-25 105 31 3 231 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q160G4 5.69e-25 103 32 7 250 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8PZN0 6.41e-25 106 30 6 273 3 MM_0462 Putative ABC transporter ATP-binding protein MM_0462 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P57403 6.66e-25 103 31 4 228 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q98K23 7.01e-25 105 31 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q13LD8 7.06e-25 105 29 3 232 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q8UIW7 7.07e-25 103 30 4 220 3 phnC Phosphonates import ATP-binding protein PhnC Agrobacterium fabrum (strain C58 / ATCC 33970)
P9WQM1 8.68e-25 105 34 5 213 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 8.68e-25 105 34 5 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 8.68e-25 105 34 5 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q65VG9 9e-25 105 31 2 218 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q72AQ6 9.03e-25 103 29 6 249 3 phnC Phosphonates import ATP-binding protein PhnC Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q2SPI3 9.17e-25 103 30 6 236 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q9RKQ4 9.63e-25 103 30 5 228 3 hmuV Hemin import ATP-binding protein HmuV Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6GIH9 9.68e-25 104 30 5 259 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q1GL85 1.03e-24 102 31 4 234 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q89C51 1.08e-24 103 28 5 233 3 phnC Phosphonates import ATP-binding protein PhnC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q032H3 1.11e-24 103 31 2 214 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactococcus lactis subsp. cremoris (strain SK11)
Q2K6Q4 1.2e-24 103 30 4 224 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q38WL5 1.23e-24 104 31 3 222 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q3KKA1 1.34e-24 102 31 4 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q9MUN1 1.53e-24 104 32 5 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
P63354 2.24e-24 103 31 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 2.24e-24 103 31 4 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P46903 2.28e-24 101 28 5 225 1 natA ABC transporter ATP-binding protein NatA Bacillus subtilis (strain 168)
Q1WSB9 2.41e-24 102 31 6 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q73XU8 2.46e-24 103 34 6 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q74L61 2.78e-24 102 31 4 198 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8NXH5 2.81e-24 103 31 2 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 2.81e-24 103 31 2 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 2.81e-24 103 31 2 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 2.81e-24 103 31 2 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 2.81e-24 103 31 2 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
A0LCH8 2.88e-24 102 32 4 225 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P27675 2.89e-24 101 29 5 229 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q6G098 3.03e-24 102 30 7 246 3 hmuV Hemin import ATP-binding protein HmuV Bartonella quintana (strain Toulouse)
Q5YZY9 3.06e-24 103 32 5 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q9CIS8 3.32e-24 102 32 2 199 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactococcus lactis subsp. lactis (strain IL1403)
Q8D653 3.33e-24 103 33 3 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q8XXY9 3.82e-24 102 29 6 227 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2YWP2 3.96e-24 103 30 5 259 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5YVL8 4.08e-24 102 33 6 217 3 hmuV Hemin import ATP-binding protein HmuV Nocardia farcinica (strain IFM 10152)
Q832Y6 4.2e-24 103 28 6 294 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q7A6M2 4.21e-24 103 31 2 217 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 4.21e-24 103 31 2 217 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FNX9 4.44e-24 101 33 6 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q045Z7 4.52e-24 102 31 4 193 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q1R155 4.6e-24 100 28 6 269 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1GJU0 4.78e-24 101 30 6 233 3 hmuV Hemin import ATP-binding protein HmuV Ruegeria sp. (strain TM1040)
A1B9K8 4.8e-24 101 30 3 238 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q07PZ0 4.9e-24 101 31 3 216 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q92XW1 5.02e-24 102 32 3 202 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q4ZU82 5.34e-24 101 29 6 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. syringae (strain B728a)
Q48HL2 5.46e-24 101 29 6 230 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8U4L3 5.7e-24 100 33 4 213 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5JEB0 5.71e-24 102 30 6 234 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q882S0 5.74e-24 101 28 6 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8UH62 6.71e-24 102 32 3 198 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YK28 6.99e-24 100 28 8 264 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1R0Z6 7.12e-24 100 30 4 230 3 phnC Phosphonates import ATP-binding protein PhnC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q07LY2 7.29e-24 100 27 5 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisA53)
Q5WDP1 8.77e-24 102 30 2 217 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q8XZP8 9.14e-24 102 34 4 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q07LU3 9.72e-24 100 27 6 242 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
P94374 9.75e-24 101 29 7 214 2 yxlF Uncharacterized ABC transporter ATP-binding protein YxlF Bacillus subtilis (strain 168)
Q47MA5 9.75e-24 100 29 6 253 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q04FM1 1.27e-23 100 31 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P14788 1.27e-23 101 33 3 197 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O26236 1.39e-23 100 29 5 222 3 MTH_133 Putative ABC transporter ATP-binding protein MTH_133 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q88YN5 1.51e-23 99 27 3 211 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q28VL7 1.56e-23 99 33 6 207 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q1LJ08 1.66e-23 100 32 6 228 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9K8N1 1.85e-23 99 26 5 249 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3SQ65 2.22e-23 99 27 6 241 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q8TK65 2.23e-23 102 30 6 273 3 MA_3551 Putative ABC transporter ATP-binding protein MA_3551 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q13LC4 2.35e-23 100 27 11 304 3 phnC Phosphonates import ATP-binding protein PhnC Paraburkholderia xenovorans (strain LB400)
Q9ZKW3 2.37e-23 99 32 8 256 3 jhp_0821 Probable iron chelatin transport ATP-binding protein jhp_0821 Helicobacter pylori (strain J99 / ATCC 700824)
Q66FK0 2.52e-23 99 27 9 279 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 2.52e-23 99 27 9 279 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 2.52e-23 99 27 9 279 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 2.52e-23 99 27 9 279 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q7NX01 2.59e-23 101 33 4 213 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q4QMH4 3.16e-23 100 30 4 248 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q6LX68 3.18e-23 99 30 3 216 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8RQL7 3.25e-23 98 29 6 237 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8DWR4 3.27e-23 99 31 4 232 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L3 3.27e-23 99 31 4 232 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF5 3.27e-23 99 31 4 232 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q6D664 3.41e-23 98 32 5 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q73F66 3.52e-23 99 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q58283 3.7e-23 99 31 6 232 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q20Y31 3.88e-23 99 27 5 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain BisB18)
Q31I51 4e-23 98 27 5 254 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A0R8K9 4.14e-23 99 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus thuringiensis (strain Al Hakam)
P70970 4.39e-23 99 31 6 216 3 ecfAB Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus subtilis (strain 168)
O05732 4.54e-23 98 32 7 246 3 HP_0888 Probable iron chelatin transport ATP-binding protein HP_0888 Helicobacter pylori (strain ATCC 700392 / 26695)
Q6LQ00 4.62e-23 102 31 4 233 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 1.37e-08 59 26 9 257 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q81J15 4.68e-23 99 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8U3E0 4.69e-23 99 29 4 213 3 PF0528 Putative ABC transporter ATP-binding protein PF0528 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q03P57 5.6e-23 100 32 5 222 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8RFN2 5.64e-23 99 29 2 227 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2ISN3 5.76e-23 98 27 5 233 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Rhodopseudomonas palustris (strain HaA2)
Q4KC87 5.83e-23 100 34 7 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q49W48 6.01e-23 99 30 2 210 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P38046 6.06e-23 98 30 5 218 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q3A9G5 6.22e-23 99 31 6 231 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q6HPM9 6.43e-23 99 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ1 6.43e-23 99 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus anthracis
Q6HP89 6.6e-23 99 27 3 230 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 7.22e-23 99 27 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q63GR8 7.29e-23 99 27 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q1LQF6 7.42e-23 99 33 5 214 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5KVK2 7.68e-23 99 30 3 221 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q0I5E9 7.75e-23 99 32 1 198 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q7NN36 7.89e-23 98 30 7 234 3 hmuV Hemin import ATP-binding protein HmuV Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8FYU9 8.06e-23 97 30 9 248 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 8.06e-23 97 30 9 248 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q73EL7 8.15e-23 99 27 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q659V4 8.65e-23 97 26 5 230 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damselae subsp. damselae
Q57BC2 8.66e-23 97 30 9 248 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 8.66e-23 97 30 9 248 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q5E882 8.92e-23 97 30 6 227 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65P76 9.31e-23 98 30 6 228 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q97KD5 9.39e-23 99 31 2 216 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O34631 9.88e-23 100 29 6 225 3 yvrA Uncharacterized ABC transporter ATP-binding protein YvrA Bacillus subtilis (strain 168)
Q4JTG9 9.93e-23 99 33 1 195 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q8Y0X3 1e-22 99 33 2 203 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q39B28 1.01e-22 97 29 7 249 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3SGJ8 1.02e-22 97 29 6 233 3 phnC Phosphonates import ATP-binding protein PhnC Thiobacillus denitrificans (strain ATCC 25259)
P44785 1.07e-22 99 30 4 244 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q1BJA5 1.13e-22 97 30 9 245 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia orbicola (strain AU 1054)
A0B3E2 1.13e-22 97 30 9 245 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia cenocepacia (strain HI2424)
Q9A502 1.24e-22 99 31 3 219 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q93SH7 1.26e-22 97 26 5 236 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6N9W0 1.28e-22 99 34 1 195 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8REG7 1.32e-22 97 29 5 201 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q1CCR9 1.42e-22 97 32 6 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJD0 1.42e-22 97 32 6 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q1C2S1 1.42e-22 97 32 6 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
Q7VM95 1.44e-22 99 29 2 218 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q88WA5 1.46e-22 99 29 3 222 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q664P8 1.73e-22 97 32 6 212 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3J1N0 1.75e-22 99 30 2 212 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q0B6I6 1.98e-22 99 29 3 215 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2NTI7 2.28e-22 96 30 4 220 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q5WIL7 2.36e-22 96 28 6 264 3 phnC Phosphonates import ATP-binding protein PhnC Shouchella clausii (strain KSM-K16)
Q890D1 2.45e-22 96 31 5 206 2 larO Nickel import ATP-binding protein LarO Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q70GD4 2.54e-22 96 26 5 230 3 hmuV Hemin import ATP-binding protein HmuV Photobacterium damsela subsp. piscicida
Q132E8 2.73e-22 96 27 5 233 3 phnC Phosphonates import ATP-binding protein PhnC Rhodopseudomonas palustris (strain BisB5)
P9WQL3 2.98e-22 98 31 5 238 1 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQL2 2.98e-22 98 31 5 238 3 modC Molybdenum import ATP-binding protein ModC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9PJX9 3.05e-22 95 29 5 238 3 TC_0697 Probable metal transport system ATP-binding protein TC_0697 Chlamydia muridarum (strain MoPn / Nigg)
Q9CIQ6 3.33e-22 95 25 5 242 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. lactis (strain IL1403)
Q39AT4 3.37e-22 98 30 2 211 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q839D4 3.5e-22 97 31 5 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q81IN8 3.72e-22 97 28 2 212 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6D1C4 3.85e-22 97 32 1 197 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9AB70 3.91e-22 96 27 10 268 3 phnC Phosphonates import ATP-binding protein PhnC Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8ETV6 3.96e-22 96 29 5 241 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q7WEH6 3.97e-22 96 30 8 260 3 hmuV Hemin import ATP-binding protein HmuV Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6D201 3.99e-22 97 33 5 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1I4Q5 4.05e-22 95 32 5 204 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas entomophila (strain L48)
Q7MMN0 4.1e-22 96 30 6 243 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 4.1e-22 96 30 6 243 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q2JLH7 4.65e-22 96 28 6 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q8TIW9 4.86e-22 96 28 7 259 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q11ID5 5.05e-22 95 33 8 225 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q8EB59 5.05e-22 95 29 6 214 3 hmuV Hemin import ATP-binding protein HmuV Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8U4K3 5.43e-22 97 29 6 234 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q1BR30 5.53e-22 97 30 2 211 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 5.53e-22 97 30 2 211 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q1IGY7 5.55e-22 95 27 5 258 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q8CUY0 5.93e-22 95 26 5 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q13VD7 6.5e-22 97 31 4 207 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q032D0 6.7e-22 95 25 5 242 3 phnC Phosphonates import ATP-binding protein PhnC Lactococcus lactis subsp. cremoris (strain SK11)
Q5L222 7.12e-22 97 32 8 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q9K876 7.62e-22 97 31 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q3YUN6 8.46e-22 95 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q2J3T0 8.81e-22 95 26 6 237 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
A3CVD3 9.02e-22 95 31 6 233 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q63H61 9.93e-22 95 31 4 217 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus cereus (strain ZK / E33L)
O68877 1.02e-21 94 28 7 247 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02FW7 1.02e-21 94 28 7 247 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas aeruginosa (strain UCBPP-PA14)
Q7W025 1.03e-21 95 29 8 260 3 hmuV Hemin import ATP-binding protein HmuV Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9I1C8 1.04e-21 97 28 1 202 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O30144 1.04e-21 94 33 5 209 1 wtpC Molybdate/tungstate import ATP-binding protein WtpC Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q1R597 1.04e-21 94 28 6 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q8FCJ1 1.06e-21 94 28 6 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 1.06e-21 94 28 6 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O70014 1.08e-21 94 28 6 225 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q881C1 1.15e-21 96 29 5 232 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HQQ9 1.15e-21 96 30 2 210 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P44513 1.22e-21 96 32 6 220 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6N7Y6 1.23e-21 95 28 4 218 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0T9T7 1.3e-21 94 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q28QF9 1.33e-21 94 31 8 252 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q2K551 1.39e-21 94 32 7 239 3 hmuV Hemin import ATP-binding protein HmuV Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8X5N2 1.4e-21 94 28 6 225 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q87RE5 1.41e-21 94 32 5 219 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5WBL0 1.44e-21 94 30 4 202 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5PDU4 1.5e-21 94 31 6 218 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q32AY3 1.5e-21 94 28 6 225 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q1QVQ7 1.52e-21 96 29 2 214 3 metN Methionine import ATP-binding protein MetN Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q8CTB2 1.54e-21 95 30 2 210 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8Z5N5 1.54e-21 94 31 6 218 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhi
Q6MIP7 1.57e-21 94 30 7 241 3 phnC Phosphonates import ATP-binding protein PhnC Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q8L1U3 1.61e-21 94 27 8 247 1 hmuV Hemin import ATP-binding protein HmuV Bordetella avium
Q2KUC0 1.61e-21 94 27 8 247 3 hmuV Hemin import ATP-binding protein HmuV Bordetella avium (strain 197N)
Q02QM1 1.64e-21 94 27 9 243 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8XDV7 1.66e-21 94 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q32EX7 1.68e-21 94 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
P16677 1.7e-21 94 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q7VMV4 1.75e-21 93 32 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q83CV2 1.77e-21 93 30 6 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q63R24 1.83e-21 95 27 9 254 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia pseudomallei (strain K96243)
Q3JNY2 1.83e-21 95 27 9 254 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia pseudomallei (strain 1710b)
Q1IGN4 1.84e-21 96 29 3 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q329I3 1.9e-21 94 26 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q1R3F6 1.94e-21 94 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
P56344 2.07e-21 93 32 6 213 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
O54187 2.07e-21 94 31 5 232 3 SCO5958 Putative ABC transporter ATP-binding protein SCO5958 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q62H59 2.13e-21 95 27 9 254 3 phnC Phosphonates import ATP-binding protein PhnC Burkholderia mallei (strain ATCC 23344)
Q9HYL7 2.14e-21 94 27 9 243 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02ME3 2.14e-21 95 28 1 202 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HMZ4 2.18e-21 93 30 4 211 3 VNG_2317G Putative ABC transporter ATP-binding protein VNG_2317G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9F9B0 2.2e-21 94 31 9 241 1 frcA Fructose import ATP-binding protein FrcA Rhizobium meliloti
Q83HT1 2.21e-21 94 34 8 211 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain TW08/27)
Q7N8M2 2.24e-21 95 32 1 196 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q82WT5 2.34e-21 95 33 7 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
O29527 2.35e-21 94 32 3 195 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7W359 2.4e-21 94 29 8 260 3 hmuV Hemin import ATP-binding protein HmuV Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q134N9 2.46e-21 95 32 2 211 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q8FAV1 2.47e-21 94 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6GEL3 2.61e-21 94 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q4K5Z7 2.72e-21 93 31 6 219 3 hmuV Hemin import ATP-binding protein HmuV Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5FM62 2.77e-21 94 30 5 203 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q17VE0 2.81e-21 95 29 3 234 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q9RKC6 2.81e-21 94 29 7 261 3 SCO3161 Putative ABC transporter ATP-binding protein SCO3161 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q4FQ27 2.91e-21 93 28 5 238 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q46YX6 3.08e-21 94 29 4 213 3 nodI Nod factor export ATP-binding protein I Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1Q889 3.1e-21 93 30 8 239 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q48J29 3.16e-21 95 30 5 222 3 modC Molybdenum import ATP-binding protein ModC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q217B2 3.17e-21 94 27 6 231 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
P45073 3.33e-21 93 25 4 239 1 lptB Lipopolysaccharide export system ATP-binding protein LptB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9KQB8 3.36e-21 93 34 6 214 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q3KJS6 3.42e-21 95 27 2 211 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q24QI5 3.46e-21 95 29 5 232 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q0B697 3.47e-21 94 28 7 246 3 hmuV Hemin import ATP-binding protein HmuV Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8YUV1 3.55e-21 93 29 7 256 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q93SS1 3.57e-21 93 27 10 261 3 hmuV Hemin import ATP-binding protein HmuV Plesiomonas shigelloides
Q05596 3.63e-21 93 32 7 218 1 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1MMZ3 3.71e-21 94 30 6 220 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q31ZH4 3.99e-21 92 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q97N51 4e-21 94 30 6 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q1B677 4.1e-21 94 31 2 211 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q8TYV9 4.18e-21 93 28 7 249 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A1WXT0 4.4e-21 93 28 4 214 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q2NRN5 4.42e-21 94 30 1 198 3 metN Methionine import ATP-binding protein MetN Sodalis glossinidius (strain morsitans)
Q046T0 4.44e-21 93 28 5 237 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q3ABN1 4.56e-21 93 30 3 219 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P94420 4.56e-21 93 26 8 240 1 yclP Petrobactin import ATP-binding protein YclP Bacillus subtilis (strain 168)
Q166X0 4.64e-21 93 28 8 237 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6NBX6 5.15e-21 93 26 5 233 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P75957 5.43e-21 92 32 6 210 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q119J0 5.77e-21 92 28 7 245 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Trichodesmium erythraeum (strain IMS101)
Q8R7Y5 5.91e-21 93 30 7 222 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8CMU4 6.02e-21 92 29 4 213 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKQ8 6.02e-21 92 29 4 213 3 phnC Phosphonates import ATP-binding protein PhnC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q4ZZR8 6.67e-21 94 30 3 206 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q71X09 6.68e-21 94 31 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
O69063 6.77e-21 94 27 6 236 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q74LQ3 6.77e-21 92 28 5 235 3 phnC Phosphonates import ATP-binding protein PhnC Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q4QP85 6.83e-21 94 31 6 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q31TP8 6.93e-21 92 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q92V71 7.14e-21 93 29 6 222 3 phnC Phosphonates import ATP-binding protein PhnC Rhizobium meliloti (strain 1021)
P61482 7.39e-21 92 33 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 7.39e-21 92 33 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 7.39e-21 92 33 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q63S19 7.52e-21 94 31 2 203 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 7.52e-21 94 31 2 203 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 7.52e-21 94 31 2 203 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q6D645 7.54e-21 92 30 10 254 3 hmuV Hemin import ATP-binding protein HmuV Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z300 7.77e-21 92 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 7.77e-21 92 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 7.77e-21 92 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 7.77e-21 92 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q7MFH3 7.83e-21 95 30 7 236 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 6.73e-11 66 27 8 249 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8UBY6 8.07e-21 92 28 5 215 3 thiQ Thiamine import ATP-binding protein ThiQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6D2F6 8.18e-21 94 32 8 230 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A3DJK5 8.33e-21 92 30 10 259 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q74IV9 8.39e-21 94 29 6 247 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q83GE8 8.51e-21 92 34 8 211 3 pstB Phosphate import ATP-binding protein PstB Tropheryma whipplei (strain Twist)
Q8D385 8.71e-21 91 30 5 216 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8DWR3 8.83e-21 92 32 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 8.83e-21 92 32 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 8.83e-21 92 32 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q2K8C8 9.14e-21 94 31 6 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q88AS5 9.6e-21 93 30 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q83RS0 9.74e-21 91 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q7NAQ6 9.77e-21 92 25 6 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q8X8E3 1.02e-20 91 32 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q4KKK8 1.03e-20 93 29 3 211 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q57QD7 1.04e-20 91 33 6 207 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q48QM3 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RH10 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J450 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC9 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JJD0 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J983 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7CMM8 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B6 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q99XI2 1.05e-20 92 28 6 238 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M1
Q0ASQ1 1.06e-20 92 29 8 246 3 phnC Phosphonates import ATP-binding protein PhnC Maricaulis maris (strain MCS10)
Q7A470 1.06e-20 92 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 1.06e-20 92 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P45247 1.07e-20 91 31 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 1.07e-20 91 31 6 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q81J16 1.1e-20 92 30 8 243 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5PB72 1.1e-20 92 30 6 230 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q83P97 1.15e-20 92 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q0SXV5 1.15e-20 92 25 7 256 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
P0CZ27 1.17e-20 92 28 4 237 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ26 1.17e-20 92 28 4 237 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8Y8T6 1.19e-20 94 30 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9KLQ5 1.28e-20 93 29 6 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q81IZ6 1.28e-20 93 29 2 211 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8D3Z9 1.34e-20 95 30 7 236 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 1.81e-10 64 27 8 249 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q9I6L0 1.37e-20 93 30 4 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HDY6 1.39e-20 92 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 1.39e-20 92 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 1.39e-20 92 30 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
O84421 1.42e-20 91 30 3 212 3 CT_416 Probable metal transport system ATP-binding protein CT_416 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q03PY5 1.47e-20 92 32 8 230 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8XK20 1.52e-20 94 29 7 247 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 5.48e-06 51 36 3 94 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8TIX0 1.55e-20 92 30 6 236 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8DMY0 1.56e-20 92 29 6 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04HV8 1.56e-20 92 29 6 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9EYM2 1.6e-20 90 33 4 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8FV85 1.63e-20 93 30 2 212 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 1.63e-20 93 30 2 212 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 1.63e-20 93 30 2 212 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 1.63e-20 93 30 2 212 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04985
Feature type CDS
Gene -
Product manganese/iron ABC transporter ATP-binding protein
Location 1091185 - 1092072 (strand: -1)
Length 888 (nucleotides) / 295 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1851
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1121 Inorganic ion transport and metabolism (P) P ABC-type Mn2+/Zn2+ transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11607 manganese/iron transport system ATP-binding protein ABC transporters -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG012580 iron/manganese ABC transporter ATP-binding protein SitB VF1116 Nutritional/Metabolic factor

Protein Sequence

MNDKKINPTLTVDNATVTYNNGHTAIYDASFSITGGTICALVGINGSGKSTLFKTIMGLVKPSKGTVTLNNQPIQQALKQNMIAYVPQTEEVDWNFPVLVSDVVMMGRYGKMGFFRIPSKQDHEVVEACLERVGLSGLGHRQIGELSGGQKKRVFLARAMAQEGTVLLLDEPFTGVDVKTENAIIELLRNLRKEGHLVLVSTHNLGSVPEFCDHVILINRTVLDSGPTETTFTQKNLEHAFGGVLRHISLSGPDLHDDDDPRSLTVITDDERAAVFYGHHEQHTPAHQSKRKQGD

Flanking regions ( +/- flanking 50bp)

ATTGATCTACTTAATATTACTGTCGATACCATTGCGAAAGGATTTGGACAATGAATGATAAAAAAATAAATCCTACTCTTACTGTTGATAATGCAACGGTAACCTATAACAACGGTCACACTGCTATTTATGATGCAAGTTTCTCTATCACTGGTGGCACAATTTGTGCCCTAGTGGGCATCAACGGTAGTGGTAAATCCACACTTTTTAAAACCATTATGGGATTAGTCAAACCTTCAAAAGGTACCGTAACATTAAATAATCAACCTATTCAGCAAGCACTTAAACAAAATATGATTGCTTATGTGCCACAAACAGAGGAAGTTGACTGGAACTTTCCTGTACTGGTTTCTGATGTGGTGATGATGGGACGTTATGGAAAAATGGGTTTTTTTCGTATTCCATCGAAACAAGATCATGAAGTGGTTGAAGCTTGTTTAGAGCGTGTCGGTTTATCAGGCCTTGGACATCGCCAAATTGGTGAGCTATCTGGTGGGCAGAAAAAACGGGTATTCTTAGCACGAGCAATGGCACAAGAAGGCACCGTACTGTTATTAGATGAACCTTTTACTGGCGTGGACGTAAAAACAGAAAATGCCATTATTGAATTATTACGTAACTTGCGTAAAGAAGGTCACCTAGTATTAGTATCAACTCATAACTTAGGTAGTGTACCCGAGTTTTGTGATCACGTTATTTTAATTAATAGAACAGTGCTTGATAGCGGGCCAACAGAAACCACCTTTACCCAAAAGAATTTAGAGCATGCTTTTGGTGGCGTATTGCGTCATATCAGCTTATCAGGCCCTGATCTTCACGACGACGACGATCCACGTTCACTTACCGTTATTACTGATGATGAACGCGCTGCCGTTTTCTATGGTCACCATGAACAACATACTCCCGCTCATCAAAGTAAGCGTAAACAAGGAGATTAGCCATGCTAGAATTACTCCTACAACCTTTTGAGTATAACTATATGGTAAAG