Homologs in group_2010

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14815 FBDBKF_14815 84.7 Morganella morganii S1 lysP Amino acid permease
EHELCC_15620 EHELCC_15620 84.7 Morganella morganii S2 lysP Amino acid permease
NLDBIP_16150 NLDBIP_16150 84.7 Morganella morganii S4 lysP Amino acid permease
LHKJJB_15690 LHKJJB_15690 84.7 Morganella morganii S3 lysP Amino acid permease
HKOGLL_14810 HKOGLL_14810 84.7 Morganella morganii S5 lysP Amino acid permease
F4V73_RS07615 F4V73_RS07615 83.6 Morganella psychrotolerans - amino acid permease

Distribution of the homologs in the orthogroup group_2010

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2010

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P25737 0.0 840 83 2 495 1 lysP Lysine-specific permease LysP Escherichia coli (strain K12)
A2RNZ6 9.27e-180 516 51 5 492 1 lysP Lysine-specific permease LysP Lactococcus lactis subsp. cremoris (strain MG1363)
A2RI97 7.29e-170 490 50 3 476 3 hisP Histidine permease HisP Lactococcus lactis subsp. cremoris (strain MG1363)
P39636 5.85e-127 380 41 6 484 2 rocC Amino-acid permease RocC Bacillus subtilis (strain 168)
P39137 8.79e-121 365 41 3 464 2 rocE Amino-acid permease RocE Bacillus subtilis (strain 168)
O31462 6.21e-120 362 41 4 473 3 ybgF Uncharacterized amino acid permease YbgF Bacillus subtilis (strain 168)
P42087 5.68e-119 360 39 5 487 3 hutM Putative histidine permease Bacillus subtilis (strain 168)
A0A1D8PK89 5.25e-109 338 40 1 463 2 GAP2 General amino-acid permease GAP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q47689 9.9e-108 331 38 6 480 3 mmuP Probable S-methylmethionine permease Escherichia coli (strain K12)
O60170 7.38e-107 332 36 6 501 2 meu22 Probable amino-acid permease meu22 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P04817 7.15e-105 328 37 4 476 1 CAN1 Arginine permease CAN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9C0V0 4.07e-103 320 37 6 487 3 SPCPB1C11.02 Probable amino-acid permease PB1C11.02 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P46349 2.83e-102 317 42 3 396 1 gabP Gamma-aminobutyric acid permease Bacillus subtilis (strain 168)
Q5AG77 2.4e-101 318 37 7 496 2 GAP1 Amino-acid permease GAP1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A1D8PN88 3.31e-99 313 37 3 422 2 HIP1 Amino-acid permease GAP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P34054 3.1e-98 310 35 5 484 2 inda1 Amino-acid permease inda1 Hypocrea atroviridis
Q6FNY1 1.07e-97 309 35 4 476 3 CAN1 Arginine permease CAN1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P53388 1.55e-97 309 35 5 483 1 DIP5 Dicarboxylic amino acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32487 6.77e-97 308 35 5 477 1 LYP1 Lysine-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P19145 9.05e-97 307 38 5 475 1 GAP1 General amino-acid permease GAP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9URZ4 2.78e-92 295 35 8 478 1 cat1 Cationic amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A1D8PMB1 5.19e-92 295 34 6 494 2 GAP5 Amino-acid permease GAP5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9P768 3.1e-91 292 32 6 493 3 SPAP7G5.06 Uncharacterized amino-acid permease P7G5.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P43059 1.25e-90 290 35 8 478 3 CAN1 Lysine/arginine permease Candida albicans (strain WO-1)
A0A1D8PPI5 1.33e-90 290 35 8 478 2 CAN1 Lysine/arginine permease CAN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9P5N4 1.78e-90 290 36 4 426 3 SPBC359.01 Uncharacterized amino-acid permease C359.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38971 5e-90 289 35 4 486 1 ALP1 Basic amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P15380 1.34e-88 286 33 6 492 2 PUT4 Proline-specific permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9P5N2 2.24e-88 285 37 3 407 3 aat1 Amino acid transporter 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9URZ3 3.02e-88 283 34 6 472 3 put4 Probable proline-specific permease put4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59831 3.02e-88 283 33 5 491 3 SPCC965.11c Uncharacterized amino-acid permease C965.11c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59WU0 9.12e-88 283 36 8 480 2 CAN2 Probable lysine/arginine permease CAN2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P27837 1.32e-87 279 36 9 475 1 yifK Probable transport protein YifK Escherichia coli (strain K12)
P38967 7.15e-87 281 36 7 447 1 TAT2 Tryptophan permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B5BP45 8.93e-87 280 37 5 429 3 SPBC460.01c Uncharacterized amino-acid permease C460.01c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O34618 4.35e-86 275 36 5 409 3 ytnA Uncharacterized amino acid permease YtnA Bacillus subtilis (strain 168)
P0A189 4.77e-86 275 36 9 467 3 yifK Probable transport protein YifK Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A190 4.77e-86 275 36 9 467 3 yifK Probable transport protein YifK Salmonella typhi
P24207 4.99e-86 275 39 8 425 1 pheP Phenylalanine-specific permease Escherichia coli (strain K12)
P06775 8.24e-86 278 32 5 486 1 HIP1 Histidine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O74543 1.16e-84 273 31 5 481 3 SPCC777.04 Uncharacterized amino-acid permease C777.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A1D8PPG4 1.29e-84 275 35 8 476 2 CAN3 Probable lysine/arginine permease CAN3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q876K6 2.29e-84 276 31 6 488 3 AGP1 General amino acid permease AGP1 Saccharomyces uvarum (strain ATCC 76518 / CBS 7001 / CLIB 283 / NBRC 10550 / MCYC 623 / NCYC 2669 / NRRL Y-11845)
Q9HDV2 3.77e-83 271 34 6 489 3 SPBPB2B2.01 Uncharacterized amino-acid permease PB2B2.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q59WB3 5.45e-83 271 35 6 490 2 GAP4 S-adenosylmethionine permease GAP4 Candida albicans (strain SC5314 / ATCC MYA-2876)
A6ZTG5 3.69e-82 270 31 6 488 3 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain YJM789)
P25376 2.41e-81 268 31 6 488 1 AGP1 General amino acid permease AGP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40901 3.15e-81 266 33 5 480 2 isp5 Sexual differentiation process putative amino-acid permease isp5 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54425 4.48e-80 259 34 8 468 3 ybxG Probable threonine/serine transporter YbxG Bacillus subtilis (strain 168)
Q8FL49 1.19e-79 258 36 3 394 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P18696 1.58e-79 261 34 7 482 2 prnB Proline-specific permease Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P59737 3.19e-79 257 36 3 394 3 aroP Aromatic amino acid transport protein AroP Shigella flexneri
A0A1D8PNP3 3.63e-79 260 34 6 424 2 GAP6 Amino-acid permease GAP6 Candida albicans (strain SC5314 / ATCC MYA-2876)
P15993 4.84e-79 257 36 3 394 1 aroP Aromatic amino acid transport protein AroP Escherichia coli (strain K12)
P0CK99 7.41e-79 256 35 6 428 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1W822 7.41e-79 256 35 6 428 3 aroP Aromatic amino acid transport protein AroP Salmonella typhimurium (strain SL1344)
P0A188 7.41e-79 256 35 6 428 3 None Aromatic amino acid transport protein AroP Salmonella typhi
Q8X968 1.76e-78 255 36 3 394 3 aroP Aromatic amino acid transport protein AroP Escherichia coli O157:H7
P0AAE0 3.33e-75 247 33 9 454 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli (strain K12)
P0AAE1 3.33e-75 247 33 9 454 3 cycA D-serine/D-alanine/glycine transporter Escherichia coli O157:H7
P48813 5.79e-74 249 28 8 512 1 GNP1 High-affinity glutamine permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q92367 1.13e-72 244 35 4 398 3 aap1 Amino-acid permease 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25527 1.22e-72 240 34 5 403 1 gabP Gamma-aminobutyric acid permease Escherichia coli (strain K12)
P96704 8.35e-72 238 34 7 442 3 ydgF Uncharacterized transporter YdgF Bacillus subtilis (strain 168)
Q12372 8.68e-72 241 32 8 477 1 MMP1 S-methylmethionine permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38084 1.69e-71 241 28 7 507 1 BAP2 Leu/Val/Ile amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A0H2VDI7 2.23e-70 234 33 10 448 1 cycA D-serine/D-alanine/glycine transporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q46065 6.1e-70 233 36 5 383 1 aroP Aromatic amino acid transport protein AroP Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P37460 8.84e-70 233 37 6 391 3 proY Proline-specific permease ProY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77610 1.28e-69 233 35 8 423 3 ansP L-asparagine permease Escherichia coli (strain K12)
Q9I703 1.64e-69 232 38 6 406 2 bauD Probable GABA permease Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P43548 4.39e-69 233 29 3 477 1 AGP3 General amino acid permease AGP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38085 8.36e-69 234 29 7 488 1 TAT1 Valine/tyrosine/tryptophan amino-acid permease 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40812 2.67e-68 230 36 7 423 3 ansP L-asparagine permease Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P41815 7.16e-68 231 27 6 488 1 BAP3 Valine amino-acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P9WQM7 2.15e-67 227 32 7 458 1 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM6 2.15e-67 227 32 7 458 3 ansP2 L-asparagine permease 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W1 2.15e-67 227 32 7 458 3 ansP2 L-asparagine permease 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q08986 1.88e-66 227 32 11 512 1 SAM3 S-adenosylmethionine permease SAM3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0AAE2 1.12e-65 222 37 6 391 1 proY Proline-specific permease ProY Escherichia coli (strain K12)
P0AAE3 1.12e-65 222 37 6 391 3 proY Proline-specific permease ProY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAE4 1.12e-65 222 37 6 391 3 proY Proline-specific permease ProY Escherichia coli O157:H7
O06005 4.71e-64 218 33 8 448 3 aapA Amino-acid permease AapA Bacillus subtilis (strain 168)
O32257 5.52e-63 214 34 4 425 2 yvbW Uncharacterized amino acid permease YvbW Bacillus subtilis (strain 168)
P38090 2.27e-61 214 29 10 505 1 AGP2 General amino acid permease AGP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9X7P0 2.67e-60 208 34 8 425 3 ansP L-asparagine permease Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P9WQM9 2.69e-58 203 32 6 425 1 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM8 2.69e-58 203 32 6 425 3 ansP1 L-asparagine permease 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7VEQ4 2.61e-57 201 33 6 408 3 ansP1 L-asparagine permease 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A2RI87 1.97e-55 195 33 6 357 1 serP1 Serine permease SerP1 Lactococcus lactis subsp. cremoris (strain MG1363)
A2RI86 3.82e-48 175 30 10 442 1 serP2 DL-alanine permease SerP2 Lactococcus lactis subsp. cremoris (strain MG1363)
Q03770 5.43e-47 177 26 12 556 1 SSY1 SPS-sensor component SSY1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2RMP5 8.47e-44 163 31 9 367 3 fywP Aromatic amino acid permease FywP Lactococcus lactis subsp. cremoris (strain MG1363)
P94383 5.19e-29 122 26 6 399 3 ycgH Uncharacterized transporter YcgH Bacillus subtilis (strain 168)
A2RHI9 3.9e-24 108 26 17 487 1 bcaP Branched-chain amino acid permease BcaP Lactococcus lactis subsp. cremoris (strain MG1363)
P45495 3.4e-23 99 37 1 161 3 None Uncharacterized transporter in pepV 3'region (Fragment) Lactobacillus delbrueckii subsp. lactis
Q797A7 1.03e-19 95 25 17 451 3 mtrA Methylthioribose transporter Bacillus subtilis (strain 168)
O07576 5.14e-17 87 25 15 499 1 bcaP Branched-chain amino acid permease BcaP Bacillus subtilis (strain 168)
P76037 5.57e-17 86 24 13 411 1 puuP Putrescine importer PuuP Escherichia coli (strain K12)
Q8W4K3 3.89e-16 84 23 9 382 1 CAT4 Cationic amino acid transporter 4, vacuolar Arabidopsis thaliana
Q8GYB4 7.68e-15 80 23 10 368 2 CAT3 Cationic amino acid transporter 3, mitochondrial Arabidopsis thaliana
Q9C5D6 2.13e-14 79 24 13 383 2 CAT9 Cationic amino acid transporter 9, chloroplastic Arabidopsis thaliana
Q9ASS7 3.25e-14 79 22 12 381 1 CAT2 Cationic amino acid transporter 2, vacuolar Arabidopsis thaliana
Q45577 1.31e-13 76 26 16 375 1 aimA Glutamate/serine transporter AimA Bacillus subtilis (strain 168)
O07002 4.17e-13 75 26 15 430 1 yveA Aspartate-proton symporter Bacillus subtilis (strain 168)
O43246 1.18e-09 64 23 10 343 1 SLC7A4 Cationic amino acid transporter 4 Homo sapiens
P0AA47 1.68e-09 63 24 10 334 1 plaP Low-affinity putrescine importer PlaP Escherichia coli (strain K12)
P0AA48 1.68e-09 63 24 10 334 3 plaP Low-affinity putrescine importer PlaP Escherichia coli O157:H7
Q8BLQ7 2.95e-08 60 23 14 374 1 Slc7a4 Cationic amino acid transporter 4 Mus musculus
Q58026 4.27e-08 58 24 22 487 1 MJ0609 Uncharacterized protein MJ0609 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8VIE6 7e-08 58 22 13 345 1 Slc7a12 Solute carrier family 7 member 12 Mus musculus
B5D5N9 9.29e-08 58 22 11 388 1 Slc7a2 Cationic amino acid transporter 2 Rattus norvegicus
B0UYF2 1.05e-07 58 21 9 351 3 slc7a14a Probable cationic amino acid transporter Danio rerio
O53092 1.28e-07 57 23 16 371 3 arcD Arginine/ornithine antiporter Latilactobacillus sakei
O34560 1.66e-07 57 24 14 354 3 yecA Uncharacterized amino acid permease YecA Bacillus subtilis (strain 168)
P18581 3.16e-07 56 22 11 388 1 Slc7a2 Cationic amino acid transporter 2 Mus musculus
P45539 3.9e-07 56 27 6 237 2 frlA Probable fructoselysine/psicoselysine transporter FrlA Escherichia coli (strain K12)
Q8X845 4.25e-07 55 27 6 237 3 frlA Probable fructoselysine/psicoselysine transporter FrlA Escherichia coli O157:H7
A8I499 5.05e-07 56 23 10 382 2 SLC7A2 Cationic amino acid transporter 2 Sus scrofa
P30823 7.41e-07 55 23 12 371 2 Slc7a1 High affinity cationic amino acid transporter 1 Rattus norvegicus
A2RNI5 7.67e-07 55 24 11 368 1 arcD1 Arginine/ornithine antiporter ArcD1 Lactococcus lactis subsp. cremoris (strain MG1363)
Q6DCE8 1.09e-06 55 23 12 389 2 slc7a2 Cationic amino acid transporter 2 Xenopus laevis
B3TP03 1.28e-06 54 21 11 408 2 SLC7A2 Cationic amino acid transporter 2 Gallus gallus
P30825 1.35e-06 54 21 9 393 1 SLC7A1 High affinity cationic amino acid transporter 1 Homo sapiens
Q92536 1.57e-06 54 24 15 356 1 SLC7A6 Y+L amino acid transporter 2 Homo sapiens
Q5L5E6 1.61e-06 54 24 14 377 3 aaxC Arginine/agmatine antiporter Chlamydia abortus (strain DSM 27085 / S26/3)
Q5PR34 1.74e-06 54 22 7 373 2 slc7a2 Cationic amino acid transporter 2 Danio rerio
Q9SHH0 2.15e-06 53 21 11 408 2 CAT8 Cationic amino acid transporter 8, vacuolar Arabidopsis thaliana
Q9LZ20 2.61e-06 53 24 14 381 2 CAT6 Cationic amino acid transporter 6, chloroplastic Arabidopsis thaliana
Q9UT18 6.27e-06 52 25 6 194 1 thi9 Thiamine transporter thi9 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P47467 1.48e-05 51 23 12 367 4 MG225 Uncharacterized protein MG225 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q09143 1.65e-05 51 21 9 370 1 Slc7a1 High affinity cationic amino acid transporter 1 Mus musculus
P52569 2.39e-05 50 22 13 389 1 SLC7A2 Cationic amino acid transporter 2 Homo sapiens
D3ZMM8 2.56e-05 50 23 16 357 1 Slc7a6 Y+L amino acid transporter 2 Rattus norvegicus
Q8BGK6 3.32e-05 50 23 16 357 1 Slc7a6 Y+L amino acid transporter 2 Mus musculus
O34739 4.85e-05 49 23 11 342 1 steT Serine/threonine exchanger SteT Bacillus subtilis (strain 168)
Q84MA5 4.91e-05 49 21 13 433 1 CAT1 Cationic amino acid transporter 1 Arabidopsis thaliana
Q9Z6M8 5.04e-05 49 24 15 407 1 aaxC Arginine/agmatine antiporter Chlamydia pneumoniae
P0AAE8 8.71e-05 48 23 11 291 1 cadB Cadaverine/lysine antiporter Escherichia coli (strain K12)
P0AAE9 8.71e-05 48 23 11 291 3 cadB Cadaverine/lysine antiporter Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAF0 8.71e-05 48 23 11 291 3 cadB Cadaverine/lysine antiporter Escherichia coli O157:H7
Q9N1Q4 0.000138 48 24 13 386 1 SLC7A8 Large neutral amino acids transporter small subunit 2 Oryctolagus cuniculus
Q822F2 0.000142 48 24 17 448 3 aaxC Arginine/agmatine antiporter Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9WTR6 0.000364 46 21 21 470 1 Slc7a11 Cystine/glutamate transporter Mus musculus
Q8WY07 0.000406 46 22 15 414 1 SLC7A3 Cationic amino acid transporter 3 Homo sapiens
Q5RAE3 0.000439 46 23 14 386 2 SLC7A8 Large neutral amino acids transporter small subunit 2 Pongo abelii
Q9UHI5 0.000439 46 23 14 386 1 SLC7A8 Large neutral amino acids transporter small subunit 2 Homo sapiens
Q9QXW9 0.000543 46 23 14 386 1 Slc7a8 Large neutral amino acids transporter small subunit 2 Mus musculus
Q8TCU3 0.000783 45 22 10 329 2 SLC7A13 Solute carrier family 7 member 13 Homo sapiens
Q9WVR6 0.000885 45 23 14 386 1 Slc7a8 Large neutral amino acids transporter small subunit 2 Rattus norvegicus
Q8TBB6 0.001 45 20 8 348 1 SLC7A14 Solute carrier family 7 member 14 Homo sapiens

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS04130
Feature type CDS
Gene -
Product amino acid permease
Location 922643 - 924130 (strand: 1)
Length 1488 (nucleotides) / 495 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2010
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00324 Amino acid permease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0833 Amino acid transport and metabolism (E) E Amino acid permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11733 lysine-specific permease - -

Protein Sequence

MSEQQTDTAKSGAVRTLRRELKARHLAMIAIGGSIGTGLFVASGATVAQAGPGGALLSYALIGLMVYFLMTSLGELAAFMPVSGSFSTYGSKYVDEGFGFALGWNYWYNWAVTIAVDLVAAQLVMLYWFPDVDGWIWSALFLAVIFLLNYISVKGFGEAEYWFSLIKVSTVIIFIAVGIAMITGIMKGAENAGWHNWEIGDAPFAGGFAAMIGVAMIVGFSFQGTELIGIAAGESKDPAKNIPKAVRKVFWRILLFYILAILIISLIIPYTDPNLLRNDVGDISVSPFTLVFKNAGLLSAAAIMNAVILTAVLSAGNSGMYASTRMLFTLAREGKAPKFFGKLSKNGVPRNALYATTVVAGLCFLSSMYGNQTVYLWLLNTSGMTGFIAWLGIAISHYRFRRGYVAQGRDLNELPYRSGFFPVGPIFAFILCLIITLGQNYQAFLEDTIDWYGVVATYIGIPLFLLIWFTYKIVKKTRFIRYSEMQFPEHIENKK

Flanking regions ( +/- flanking 50bp)

AGATTTGTTACAATTGATGCTAGGAATATGAATATAACCGTGGAATGATAATGTCAGAACAACAAACAGATACCGCAAAATCGGGTGCGGTACGCACTTTGCGTCGAGAATTAAAGGCGCGACATTTAGCGATGATCGCTATTGGTGGTTCAATTGGTACAGGGCTTTTTGTCGCATCAGGTGCAACTGTTGCTCAAGCAGGGCCAGGGGGCGCATTGCTCTCTTACGCATTAATAGGACTTATGGTCTATTTCCTTATGACCAGCCTTGGAGAGTTAGCGGCATTTATGCCTGTTTCCGGATCTTTTTCAACCTATGGCTCTAAATATGTTGATGAAGGATTTGGTTTCGCACTAGGCTGGAACTACTGGTACAACTGGGCTGTGACGATTGCAGTTGACTTAGTCGCCGCGCAGCTCGTGATGCTGTATTGGTTCCCTGATGTGGATGGTTGGATTTGGAGTGCGTTATTTTTAGCCGTTATTTTCTTGCTTAACTATATTTCTGTAAAGGGATTTGGTGAAGCTGAATATTGGTTTTCATTAATTAAAGTATCGACCGTGATTATTTTTATTGCGGTGGGTATTGCGATGATCACCGGTATTATGAAAGGTGCTGAAAATGCAGGTTGGCACAACTGGGAAATCGGCGATGCGCCTTTTGCTGGTGGTTTTGCCGCTATGATAGGGGTAGCGATGATTGTTGGGTTCTCTTTCCAAGGAACTGAACTTATCGGTATCGCAGCGGGGGAGTCGAAAGATCCTGCGAAAAATATTCCTAAAGCAGTACGTAAAGTTTTTTGGCGTATTTTACTGTTTTATATCCTAGCTATCTTAATTATCAGTTTAATCATTCCTTATACCGATCCTAACTTGCTACGTAATGATGTGGGTGACATCAGTGTGAGTCCGTTTACACTGGTATTTAAAAATGCAGGGTTACTTTCAGCTGCCGCTATCATGAACGCAGTTATTTTAACGGCGGTGCTTTCGGCAGGGAACTCCGGTATGTATGCATCTACGCGTATGTTATTTACCTTAGCAAGAGAAGGTAAAGCGCCGAAATTTTTTGGTAAATTATCCAAAAACGGTGTTCCACGTAATGCACTTTATGCAACAACAGTGGTTGCGGGTTTATGCTTTTTAAGCTCAATGTATGGTAACCAAACGGTTTATTTATGGTTATTAAATACATCAGGTATGACAGGATTTATTGCTTGGTTAGGTATTGCAATCAGTCATTACCGTTTTCGTCGGGGTTATGTAGCACAAGGTCGTGATCTGAATGAATTGCCATATCGTTCAGGCTTCTTCCCTGTAGGACCTATTTTTGCCTTTATTCTCTGTTTAATTATTACATTAGGTCAAAACTATCAGGCATTTTTAGAAGATACTATTGACTGGTATGGTGTTGTGGCAACCTATATTGGGATCCCATTATTCCTGCTGATTTGGTTTACCTATAAAATAGTGAAGAAAACACGTTTTATTCGCTACAGTGAAATGCAGTTTCCTGAGCATATTGAAAACAAAAAATAGTTAGTTTTATCACTAAATAGAGAGCCGGCTAATTTGTGAACTTTATCACA