Homologs in group_1230

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06720 FBDBKF_06720 73.7 Morganella morganii S1 dps DNA starvation/stationary phase protection protein Dps
EHELCC_04250 EHELCC_04250 73.7 Morganella morganii S2 dps DNA starvation/stationary phase protection protein Dps
NLDBIP_04250 NLDBIP_04250 73.7 Morganella morganii S4 dps DNA starvation/stationary phase protection protein Dps
LHKJJB_10080 LHKJJB_10080 73.7 Morganella morganii S3 dps DNA starvation/stationary phase protection protein Dps
HKOGLL_08895 HKOGLL_08895 73.7 Morganella morganii S5 dps DNA starvation/stationary phase protection protein Dps
F4V73_RS00875 F4V73_RS00875 72.5 Morganella psychrotolerans dps DNA starvation/stationary phase protection protein Dps

Distribution of the homologs in the orthogroup group_1230

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1230

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A6T6Q6 1.72e-92 268 77 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYT2 1.72e-92 268 77 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae (strain 342)
B1JHA1 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669E1 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLZ3 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pestis (strain Pestoides F)
Q1CHU6 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6H6 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Angola)
Q7CJ65 4.28e-92 268 74 0 167 1 dps DNA protection during starvation protein Yersinia pestis
B2K7Y0 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6F4 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGU7 4.28e-92 268 74 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q84FI0 6.21e-92 267 77 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae
A8AIW9 1.9e-90 263 75 0 167 3 dps DNA protection during starvation protein Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q84AP0 2.17e-90 263 76 0 167 3 dps DNA protection during starvation protein Serratia marcescens
A1JU34 5.33e-90 262 74 0 168 3 dps DNA protection during starvation protein Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7CQV9 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF78 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella typhi
B4TQX5 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella schwarzengrund (strain CVM19633)
B5BBZ6 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain AKU_12601)
C0PX17 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi C (strain RKS4594)
A9MST4 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PG12 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T089 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella newport (strain SL254)
B4TC86 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella heidelberg (strain SL476)
B5R797 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXT6 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella enteritidis PT4 (strain P125109)
B5FP96 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella dublin (strain CT_02021853)
Q57RC9 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella choleraesuis (strain SC-B67)
B5F0B0 6.85e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella agona (strain SL483)
A9MIS0 7.98e-90 262 74 0 167 3 dps DNA protection during starvation protein Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8FJM0 2.29e-89 261 74 0 167 3 dps DNA protection during starvation protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q84FI1 2.39e-89 261 75 0 167 3 dps DNA protection during starvation protein Enterobacter cloacae
C6DEE2 6.85e-89 259 73 0 167 3 dps DNA protection during starvation protein Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GBU5 7.31e-89 259 74 0 167 3 dps DNA protection during starvation protein Serratia proteamaculans (strain 568)
Q3Z3X3 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Shigella sonnei (strain Ss046)
P0ABT4 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Shigella flexneri
Q32I91 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Shigella dysenteriae serotype 1 (strain Sd197)
Q323Y1 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Shigella boydii serotype 4 (strain Sb227)
B2TVB6 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6XZR0 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Kluyvera cryocrescens
B7LMB6 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1REB2 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain UTI89 / UPEC)
B1LMA4 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain SMS-3-5 / SECEC)
B6I7W9 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain SE11)
B7NAB2 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABT2 2.07e-88 258 73 0 167 1 dps DNA protection during starvation protein Escherichia coli (strain K12)
B1IXF6 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TJN6 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZY70 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O9:H4 (strain HS)
B1X7E2 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / DH10B)
C4ZXY4 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / MC4100 / BW2952)
B7M787 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O8 (strain IAI1)
B7MQR6 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O81 (strain ED1a)
B7NNP4 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSA4 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABT3 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O157:H7
B7LC95 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain 55989 / EAEC)
B7MGS0 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UM08 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJM7 2.07e-88 258 73 0 167 3 dps DNA protection during starvation protein Escherichia coli O139:H28 (strain E24377A / ETEC)
B2VBZ3 2.29e-88 258 73 0 167 3 dps DNA protection during starvation protein Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q84AP1 4.22e-88 258 73 0 167 3 dps DNA protection during starvation protein Citrobacter freundii
A7MEY6 8.43e-88 257 73 0 167 3 dps DNA protection during starvation protein Cronobacter sakazakii (strain ATCC BAA-894)
Q6Y1R6 1.74e-87 256 73 0 166 3 dps DNA protection during starvation protein Proteus hauseri
Q6D3H7 4.27e-87 255 71 0 167 3 dps DNA protection during starvation protein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4W8F0 4.76e-87 255 73 0 167 3 dps DNA protection during starvation protein Enterobacter sp. (strain 638)
Q2NUI3 4.81e-85 250 70 0 167 3 dps DNA protection during starvation protein Sodalis glossinidius (strain morsitans)
Q6FCX7 4.66e-62 192 57 1 166 3 dps DNA protection during starvation protein Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8UCK6 5.13e-56 176 55 1 154 1 dps DNA protection during starvation protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P0C558 7.02e-27 102 39 1 140 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis
A0R692 7.02e-27 102 39 1 140 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q47953 2.3e-19 83 36 2 141 1 ftpA Fine tangled pili major subunit Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KWH3 2.31e-16 75 27 3 169 1 dps DNA protection during starvation protein Streptococcus mutans
Q9RS64 2.93e-15 73 32 1 137 1 dps1 DNA protection during starvation protein 1 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P0CB53 4.82e-14 69 31 4 133 1 dps DNA protection during starvation protein Streptococcus suis
C5VZF1 4.82e-14 69 31 4 133 3 dps DNA protection during starvation protein Streptococcus suis (strain P1/7)
P80725 3.35e-12 63 28 3 152 1 dps DNA protection during starvation protein Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y8G1 6.99e-12 63 28 3 152 1 dps DNA protection during starvation protein Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P83695 1.11e-11 62 28 2 146 1 dps DNA protection during starvation protein Brevibacillus brevis
Q9RZN1 1.47e-11 63 26 1 142 1 dps2 DNA protection during starvation protein 2 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P0A3A7 1.17e-09 57 24 1 153 3 all0458 Uncharacterized low temperature-induced protein all0458 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0A3A8 1.17e-09 57 24 1 153 3 None Uncharacterized low temperature-induced protein all0458 homolog Anabaena variabilis
P80879 1.61e-09 56 23 2 138 1 dps General stress protein 20U Bacillus subtilis (strain 168)
P29714 7.05e-09 55 33 1 102 3 None Uncharacterized protein in bpoA2 5'region (Fragment) Kitasatospora aureofaciens
Q8RPQ1 1.68e-08 53 22 2 144 1 dps1 DNA protection during starvation protein 1 Bacillus anthracis
Q9ZMJ1 2.76e-07 50 27 3 147 3 dps DNA protection during starvation protein Helicobacter pylori (strain J99 / ATCC 700824)
P0C935 4.28e-07 50 27 3 124 2 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RMG0 7.88e-07 49 27 3 124 1 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
P43313 1.06e-06 48 25 2 145 1 dps DNA protection during starvation protein Helicobacter pylori (strain ATCC 700392 / 26695)
P37960 1.8e-06 48 23 2 117 1 mrgA Metalloregulation DNA-binding stress protein Bacillus subtilis (strain 168)
Q8RPQ2 3.28e-06 47 24 4 147 1 dps2 DNA protection during starvation protein 2 Bacillus anthracis
Q0P891 4.2e-05 44 26 4 126 1 dps DNA protection during starvation protein Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P45173 0.000136 43 23 2 120 1 HI_1349 Uncharacterized protein HI_1349 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P16665 0.000183 43 23 4 170 1 tpf1 Antigen TpF1 Treponema pallidum (strain Nichols)
P17915 0.000803 41 22 4 170 3 None Antigen TyF1 Treponema pallidum subsp. pertenue

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03110
Feature type CDS
Gene dps
Product DNA starvation/stationary phase protection protein Dps
Location 686606 - 687112 (strand: -1)
Length 507 (nucleotides) / 168 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1230
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00210 Ferritin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0783 Inorganic ion transport and metabolism (P)
Defense mechanisms (V)
PV DNA-binding ferritin-like protein (oxidative damage protectant)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04047 starvation-inducible DNA-binding protein - -

Protein Sequence

MSTAKLVKSTPSALLYTRNNVDDSVKLHTIELLQQMVTQFIDLSLITKQAHWNMRGRNFIAVHEMVDGFRDTINEHTDEFAERLVQLGGTVLGTPQTVSKKTPLKAYPLDIHDVQDHLKALADRYAVVANDIRKAIDEVEDEDTADMFTAASRDLDKFLWFIEANIEN

Flanking regions ( +/- flanking 50bp)

ATTAACAGAAATTAAGATATTGAGTTATTAATTATTTAGGGAGAACGATTATGAGTACTGCTAAATTAGTCAAATCCACACCTTCAGCCCTGCTTTATACCCGTAATAATGTTGATGACAGTGTTAAACTGCATACTATCGAACTACTGCAGCAAATGGTGACTCAGTTTATCGATTTGTCTCTCATTACCAAACAAGCACACTGGAATATGCGCGGTAGAAACTTTATTGCCGTACACGAAATGGTAGATGGTTTCCGTGATACCATCAATGAACATACTGATGAGTTTGCTGAGCGTTTAGTACAATTAGGTGGCACAGTCCTTGGTACACCACAAACTGTCAGTAAAAAAACACCTTTAAAAGCCTATCCACTCGATATTCATGATGTGCAAGATCACCTTAAAGCATTGGCTGATCGCTATGCGGTAGTCGCTAATGATATTCGTAAAGCGATTGATGAAGTTGAAGATGAAGATACTGCTGATATGTTTACCGCAGCATCCCGTGATCTAGATAAATTCTTATGGTTTATTGAAGCAAATATTGAAAACTAATTGCTTACTTAATCACATGCTTCTTACTGAAAAGGGCTACCAATATAGGT