Homologs in group_1230

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_04250 EHELCC_04250 100.0 Morganella morganii S2 dps DNA starvation/stationary phase protection protein Dps
NLDBIP_04250 NLDBIP_04250 100.0 Morganella morganii S4 dps DNA starvation/stationary phase protection protein Dps
LHKJJB_10080 LHKJJB_10080 100.0 Morganella morganii S3 dps DNA starvation/stationary phase protection protein Dps
HKOGLL_08895 HKOGLL_08895 100.0 Morganella morganii S5 dps DNA starvation/stationary phase protection protein Dps
F4V73_RS00875 F4V73_RS00875 90.4 Morganella psychrotolerans dps DNA starvation/stationary phase protection protein Dps
PMI_RS03110 PMI_RS03110 73.7 Proteus mirabilis HI4320 dps DNA starvation/stationary phase protection protein Dps

Distribution of the homologs in the orthogroup group_1230

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1230

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JHA1 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q669E1 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLZ3 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pestis (strain Pestoides F)
Q1CHU6 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Nepal516)
A9R6H6 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Angola)
Q7CJ65 4.48e-91 265 73 0 167 1 dps DNA protection during starvation protein Yersinia pestis
B2K7Y0 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C6F4 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pestis bv. Antiqua (strain Antiqua)
A7FGU7 4.48e-91 265 73 0 167 3 dps DNA protection during starvation protein Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4W8F0 5.29e-91 265 74 0 167 3 dps DNA protection during starvation protein Enterobacter sp. (strain 638)
A8AIW9 3.93e-90 263 73 0 167 3 dps DNA protection during starvation protein Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q84FI1 5.17e-90 262 73 0 167 3 dps DNA protection during starvation protein Enterobacter cloacae
A6T6Q6 7.76e-90 262 74 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XYT2 7.76e-90 262 74 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae (strain 342)
Q7CQV9 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF78 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella typhi
B4TQX5 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella schwarzengrund (strain CVM19633)
B5BBZ6 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain AKU_12601)
C0PX17 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi C (strain RKS4594)
A9MST4 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PG12 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T089 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella newport (strain SL254)
B4TC86 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella heidelberg (strain SL476)
B5R797 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QXT6 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella enteritidis PT4 (strain P125109)
B5FP96 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella dublin (strain CT_02021853)
Q57RC9 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella choleraesuis (strain SC-B67)
B5F0B0 1.67e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella agona (strain SL483)
A9MIS0 2.22e-88 258 71 0 167 3 dps DNA protection during starvation protein Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q84FI0 2.8e-88 258 72 0 167 3 dps DNA protection during starvation protein Klebsiella pneumoniae
A7MEY6 1.2e-87 256 71 0 167 3 dps DNA protection during starvation protein Cronobacter sakazakii (strain ATCC BAA-894)
Q84AP0 4.68e-87 255 71 0 167 3 dps DNA protection during starvation protein Serratia marcescens
Q3Z3X3 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Shigella sonnei (strain Ss046)
P0ABT4 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Shigella flexneri
Q32I91 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Shigella dysenteriae serotype 1 (strain Sd197)
Q323Y1 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Shigella boydii serotype 4 (strain Sb227)
B2TVB6 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6XZR0 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Kluyvera cryocrescens
B7LMB6 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1REB2 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain UTI89 / UPEC)
B1LMA4 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain SMS-3-5 / SECEC)
B6I7W9 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain SE11)
B7NAB2 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ABT2 1.92e-86 253 70 0 167 1 dps DNA protection during starvation protein Escherichia coli (strain K12)
B1IXF6 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TJN6 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7ZY70 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O9:H4 (strain HS)
B1X7E2 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / DH10B)
C4ZXY4 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain K12 / MC4100 / BW2952)
B7M787 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O8 (strain IAI1)
B7MQR6 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O81 (strain ED1a)
B7NNP4 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YSA4 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABT3 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O157:H7
B7LC95 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli (strain 55989 / EAEC)
B7MGS0 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UM08 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJM7 1.92e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8FJM0 2.61e-86 253 70 0 167 3 dps DNA protection during starvation protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6Y1R6 1.37e-85 251 70 0 166 3 dps DNA protection during starvation protein Proteus hauseri
A1JU34 3.29e-85 250 68 0 167 3 dps DNA protection during starvation protein Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GBU5 7.4e-85 249 70 0 167 3 dps DNA protection during starvation protein Serratia proteamaculans (strain 568)
Q84AP1 1.78e-84 248 68 0 167 3 dps DNA protection during starvation protein Citrobacter freundii
B2VBZ3 1.18e-83 246 68 0 167 3 dps DNA protection during starvation protein Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C6DEE2 4.22e-83 245 68 0 167 3 dps DNA protection during starvation protein Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NUI3 1e-82 244 67 0 167 3 dps DNA protection during starvation protein Sodalis glossinidius (strain morsitans)
Q6D3H7 1.13e-82 244 68 0 167 3 dps DNA protection during starvation protein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6FCX7 1.59e-62 193 59 1 166 3 dps DNA protection during starvation protein Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8UCK6 8.45e-56 176 55 1 154 1 dps DNA protection during starvation protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P0C558 7.99e-22 89 34 1 154 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis
A0R692 7.99e-22 89 34 1 154 1 dps DNA protection during starvation protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q47953 1.02e-17 79 36 1 128 1 ftpA Fine tangled pili major subunit Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9KWH3 4.58e-14 69 28 2 138 1 dps DNA protection during starvation protein Streptococcus mutans
P83695 2.95e-13 66 28 3 139 1 dps DNA protection during starvation protein Brevibacillus brevis
Q9RZN1 3.43e-12 65 29 3 162 1 dps2 DNA protection during starvation protein 2 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P80725 3.95e-12 63 26 2 141 1 dps DNA protection during starvation protein Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y8G1 6.34e-12 63 26 2 141 1 dps DNA protection during starvation protein Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0CB53 9.1e-12 63 25 2 122 1 dps DNA protection during starvation protein Streptococcus suis
C5VZF1 9.1e-12 63 25 2 122 3 dps DNA protection during starvation protein Streptococcus suis (strain P1/7)
P0A3A7 1.48e-11 62 24 1 151 3 all0458 Uncharacterized low temperature-induced protein all0458 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P0A3A8 1.48e-11 62 24 1 151 3 None Uncharacterized low temperature-induced protein all0458 homolog Anabaena variabilis
P80879 2.56e-11 61 22 3 144 1 dps General stress protein 20U Bacillus subtilis (strain 168)
Q8RPQ1 4.58e-10 58 24 2 142 1 dps1 DNA protection during starvation protein 1 Bacillus anthracis
P29714 6.76e-10 57 28 0 119 3 None Uncharacterized protein in bpoA2 5'region (Fragment) Kitasatospora aureofaciens
Q8RPQ2 1.07e-08 54 23 3 145 1 dps2 DNA protection during starvation protein 2 Bacillus anthracis
Q9RS64 1.89e-08 54 29 3 144 1 dps1 DNA protection during starvation protein 1 Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q0P891 2.14e-07 51 22 1 120 1 dps DNA protection during starvation protein Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P37960 7.01e-07 49 21 2 137 1 mrgA Metalloregulation DNA-binding stress protein Bacillus subtilis (strain 168)
Q9ZMJ1 3e-06 47 28 5 147 3 dps DNA protection during starvation protein Helicobacter pylori (strain J99 / ATCC 700824)
P43313 7.95e-06 46 25 3 143 1 dps DNA protection during starvation protein Helicobacter pylori (strain ATCC 700392 / 26695)
P0C935 1.02e-05 46 27 3 118 2 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RMG0 2.21e-05 45 27 3 118 1 dps DNA protection during starvation protein Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_06720
Feature type CDS
Gene dps
Product DNA starvation/stationary phase protection protein Dps
Location 7185 - 7688 (strand: -1)
Length 504 (nucleotides) / 167 (amino acids)
In genomic island -

Contig

Accession contig_7
Length 171383 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1230
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00210 Ferritin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0783 Inorganic ion transport and metabolism (P)
Defense mechanisms (V)
PV DNA-binding ferritin-like protein (oxidative damage protectant)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04047 starvation-inducible DNA-binding protein - -

Protein Sequence

MSTAKLVKTTASHLVYTRNDVTDDIKQETIDELNHQVLQFIDLSLMTKQAHWNLRGRNFIAVHEMLDGFRDSLNTHLDTFAERAVQLGGVALGTSQAISKASALPAYPTDIHTVQDHLKALADRYAIVANDIRRAVSRVEDENTADMFTAASRDLDQYLWFIEANIE

Flanking regions ( +/- flanking 50bp)

TAACCCCATCGAAACAAAGATGTTTAACGGAATAAATAAGGGGAACAATAATGAGCACCGCGAAATTAGTGAAAACCACAGCTTCTCACTTAGTGTACACCCGTAACGATGTCACTGATGATATTAAGCAGGAAACCATTGATGAACTGAATCATCAGGTTCTGCAGTTTATCGACCTGTCGCTGATGACCAAACAGGCGCACTGGAATCTGCGCGGCCGTAATTTCATTGCTGTACATGAAATGCTGGATGGCTTCCGCGACAGTCTGAACACCCACCTGGATACCTTTGCCGAACGCGCTGTTCAGCTCGGCGGTGTGGCACTCGGTACTTCACAGGCGATCAGTAAAGCCTCTGCTTTACCGGCTTATCCGACCGATATCCACACTGTGCAGGATCACCTGAAAGCACTGGCCGACCGTTATGCGATTGTTGCCAACGATATCCGCCGTGCCGTCAGCCGCGTTGAGGATGAAAATACCGCAGATATGTTTACTGCCGCCTCCCGCGACCTCGACCAGTACCTGTGGTTCATTGAAGCCAATATCGAATAATAGTCAGAAATACGGCACCGCAGCCGGCGGGTTACGGTGCTGAAATAAAC