Homologs in group_1495

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09650 FBDBKF_09650 89.1 Morganella morganii S1 modB molybdate ABC transporter permease subunit
EHELCC_04450 EHELCC_04450 89.1 Morganella morganii S2 modB molybdate ABC transporter permease subunit
NLDBIP_04450 NLDBIP_04450 89.1 Morganella morganii S4 modB molybdate ABC transporter permease subunit
LHKJJB_14180 LHKJJB_14180 89.1 Morganella morganii S3 modB molybdate ABC transporter permease subunit
HKOGLL_12355 HKOGLL_12355 89.1 Morganella morganii S5 modB molybdate ABC transporter permease subunit
F4V73_RS00690 F4V73_RS00690 89.6 Morganella psychrotolerans modB molybdate ABC transporter permease subunit

Distribution of the homologs in the orthogroup group_1495

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1495

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AF01 4.91e-110 318 76 0 227 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 4.91e-110 318 76 0 227 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P45322 8.16e-100 292 68 0 222 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P16701 4.09e-37 134 37 1 209 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
P41032 1.58e-36 132 36 1 219 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O32209 5.91e-36 129 39 0 197 3 yvgM Putative molybdenum transport system permease protein YvgM Bacillus subtilis (strain 168)
P37731 6.29e-35 127 37 2 189 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
A2CI71 2.67e-34 127 34 2 203 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
Q9TKU8 5.37e-34 126 34 3 223 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
Q2EEX6 5.96e-34 125 35 2 203 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q9MUL9 2.9e-33 124 34 2 201 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
O30143 2.23e-31 119 38 1 161 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P26246 3.45e-31 119 33 2 202 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
P74547 4.43e-31 118 36 2 174 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P56343 4.93e-31 118 34 1 181 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P0AEB0 7.42e-30 115 35 3 221 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 7.42e-30 115 35 3 221 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P27370 1.66e-29 114 39 1 175 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9TJR4 3.44e-29 112 29 2 212 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
Q32RF7 5.39e-29 113 32 2 195 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
Q08382 6.6e-29 111 35 2 182 3 modB Molybdenum transport system permease protein ModB Rhodobacter capsulatus
P18795 1.42e-28 112 35 2 190 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
Q8RVC7 3.19e-28 113 34 3 220 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
Q6QJE2 7.49e-27 108 38 1 175 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
Q58763 1.18e-26 106 32 7 228 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9V2C1 9.23e-26 103 35 2 179 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
Q85AI0 1.4e-25 104 34 2 193 2 cysT Probable sulfate transport system permease protein cysT Anthoceros angustus
O57893 8.95e-25 101 33 6 220 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
D4GQ17 9.63e-25 101 36 4 196 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P27367 1.03e-24 101 35 2 187 2 cysT Sulfate transport system permease protein CysT Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5JEB3 1.99e-24 100 32 5 222 3 wtpB Molybdate/tungstate transport system permease protein WtpB Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P9WG13 1.6e-23 98 44 1 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG12 1.6e-23 98 44 1 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A625 1.6e-23 98 44 1 177 3 modB Molybdenum transport system permease protein ModB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q01895 1.72e-23 98 32 2 200 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8U4K4 1.99e-22 95 28 4 218 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q5PFQ6 1.74e-15 77 29 4 209 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P96064 2.07e-15 76 29 4 209 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57SD7 4.9e-15 75 29 4 209 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
Q8Z8W9 1.36e-14 74 28 4 209 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhi
Q44123 4.29e-14 74 27 5 209 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
Q44123 2.74e-05 48 23 3 178 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
P0AFK5 5.82e-14 72 29 3 185 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 5.82e-14 72 29 3 185 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
Q57341 1.31e-13 72 28 5 208 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57341 2.19e-05 48 25 3 177 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q83RR7 4.39e-13 70 27 6 229 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P0CL49 7.81e-13 69 28 3 185 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 7.81e-13 69 28 3 185 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 7.81e-13 69 28 3 185 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P0AFK6 4.21e-12 67 28 6 226 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 4.21e-12 67 28 6 226 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 4.21e-12 67 28 6 226 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
P0AFL1 6.77e-12 66 33 7 193 1 potI Putrescine transport system permease protein PotI Escherichia coli (strain K12)
P0AFL2 6.77e-12 66 33 7 193 3 potI Putrescine transport system permease protein PotI Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45169 3.94e-10 61 27 5 217 3 potC Spermidine/putrescine transport system permease protein PotC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P47290 1.57e-09 60 24 2 174 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P45170 2.21e-09 59 40 1 77 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31135 7.17e-09 58 31 3 161 1 potH Putrescine transport system permease protein PotH Escherichia coli (strain K12)
Q0P886 1.49e-08 57 24 4 209 1 tupB Tungstate uptake system permease protein TupB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
P75057 1.66e-08 57 26 4 179 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8Z8X0 4.26e-08 55 28 8 233 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhi
Q5PFQ5 4.32e-08 55 28 8 233 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SD8 4.75e-08 55 28 8 231 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella choleraesuis (strain SC-B67)
Q8ZRV1 7.28e-08 55 25 4 221 1 thiP Thiamine transport system permease protein ThiP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55602 2.53e-07 53 27 5 184 3 NGR_a02190 Probable ABC transporter permease protein y4oQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P31549 2.99e-07 53 26 4 221 1 thiP Thiamine transport system permease protein ThiP Escherichia coli (strain K12)
P71338 6.25e-07 53 30 2 95 3 fbpB2 Fe(3+)-transport system permease protein FbpB 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P71338 1.45e-05 48 28 2 139 3 fbpB2 Fe(3+)-transport system permease protein FbpB 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P96065 6.94e-07 52 28 8 233 2 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7MFC1 1.01e-06 52 25 4 221 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio vulnificus (strain YJ016)
Q8D3U7 1.01e-06 52 25 4 221 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio vulnificus (strain CMCP6)
Q9KL07 2.01e-06 51 25 4 221 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q57380 2.44e-06 48 29 0 89 5 HI_1475 Putative uncharacterized protein HI_1475 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P46340 2.72e-06 50 25 7 235 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
Q87GB8 2.79e-06 50 24 4 221 3 malG Maltose/maltodextrin transport system permease protein MalG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P77156 3.53e-06 50 40 0 60 1 ydcU Inner membrane ABC transporter permease protein YdcU Escherichia coli (strain K12)
Q8Z1U3 4.36e-06 50 25 3 212 3 malG Maltose/maltodextrin transport system permease protein MalG Salmonella typhi
P26468 4.44e-06 50 25 3 212 3 malG Maltose/maltodextrin transport system permease protein MalG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q93KD5 6.88e-06 48 28 4 179 1 tupB Tungstate uptake system permease protein TupB Peptoclostridium acidaminophilum
P68186 8.53e-06 49 24 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Shigella flexneri
P68183 8.53e-06 49 24 5 209 1 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli (strain K12)
P68184 8.53e-06 49 24 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P68185 8.53e-06 49 24 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Escherichia coli O157:H7
P9WG01 1.26e-05 48 26 2 150 1 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG00 1.26e-05 48 26 2 150 3 sugB Trehalose transport system permease protein SugB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P18814 3.16e-05 47 24 5 209 3 malG Maltose/maltodextrin transport system permease protein MalG Klebsiella aerogenes
O34706 4.94e-05 47 25 4 202 1 melD Melibiose/raffinose/stachyose import permease protein MelD Bacillus subtilis (strain 168)
P0AFS0 6.19e-05 46 31 7 220 3 ydcV Inner membrane ABC transporter permease protein YdcV Shigella flexneri
P0AFR9 6.19e-05 46 31 7 220 1 ydcV Inner membrane ABC transporter permease protein YdcV Escherichia coli (strain K12)
O58760 0.000112 45 25 3 163 3 PH1036 Probable ABC transporter permease protein PH1036 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q74RF8 0.000218 45 25 6 218 3 malG Maltose/maltodextrin transport system permease protein MalG Yersinia pestis
P55452 0.000361 44 25 3 150 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P17327 0.000614 43 39 0 53 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O32154 0.000649 43 26 4 172 3 yurM Probable ABC transporter permease protein YurM Bacillus subtilis (strain 168)
P9WG11 0.000698 43 29 1 92 2 pstA1 Phosphate transport system permease protein PstA 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7CS31 0.000731 43 27 1 95 1 smoH Sulfoquinovosyl glycerol transport system permease protein SmoH Agrobacterium fabrum (strain C58 / ATCC 33970)
P9WG10 0.000752 43 30 2 92 3 pstA1 Phosphate transport system permease protein PstA 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P58655 0.000785 43 27 4 154 3 pstA Phosphate transport system permease protein PstA Yersinia pestis
P14176 0.000846 43 37 0 53 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
O32168 0.000849 42 35 0 51 1 metP Methionine import system permease protein MetP Bacillus subtilis (strain 168)
P44985 0.001 43 28 2 130 3 thiP Thiamine transport system permease protein ThiP Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
E0SCY2 0.001 43 39 0 53 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02945
Feature type CDS
Gene modB
Product molybdate ABC transporter permease subunit
Location 649862 - 650554 (strand: 1)
Length 693 (nucleotides) / 230 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1495
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4149 Inorganic ion transport and metabolism (P) P ABC-type molybdate transport system, permease component ModB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02018 molybdate transport system permease protein ABC transporters -

Protein Sequence

MLSEYEWQAILLSLKVSTIAVIISLPFGILMAWLLVRVRFPGKSLLDSIIHLPLVLPPVVVGYLLLISMGRRGFIGEWLYNWFGFSFTFSWRGAALASAVVAFPLMVRAIRLALEAVDQRMEQAARTLGASPLRVFFTITLPLSMPGIIAGIVLAFARSLGEFGATITFVSNIPGETRTIPLAMYTLIETPGAEMDAARLCVIAIILALVSLMASEWLTRWGRKRLGGVC

Flanking regions ( +/- flanking 50bp)

ATATTTAAGAAATACGGCTTTAGCCCACTTTAGGAATTATACTTTTGGAGATGTTAAGTGAATACGAATGGCAAGCGATTCTTTTAAGCCTTAAGGTATCGACAATTGCAGTAATAATTAGTCTTCCTTTTGGTATATTGATGGCTTGGCTATTAGTTAGGGTTCGTTTTCCCGGTAAATCATTGCTTGATAGCATTATTCATTTACCTTTAGTTTTACCTCCCGTTGTTGTTGGTTATCTATTATTAATTAGCATGGGGAGACGCGGATTTATTGGTGAATGGCTATATAATTGGTTTGGATTTAGTTTTACCTTCAGTTGGCGAGGGGCGGCACTTGCCTCAGCTGTTGTGGCATTTCCACTGATGGTAAGAGCAATTAGACTAGCACTAGAAGCTGTCGACCAACGTATGGAACAAGCGGCAAGAACATTAGGCGCATCACCATTACGTGTCTTTTTTACTATAACGTTACCATTATCTATGCCCGGCATTATTGCGGGGATCGTATTGGCCTTTGCTCGCTCATTAGGTGAATTTGGCGCCACAATCACTTTCGTCTCCAATATTCCAGGGGAAACCAGAACGATCCCTTTGGCTATGTATACGTTAATTGAAACACCGGGGGCAGAAATGGATGCCGCCCGTTTATGTGTCATTGCAATTATTTTGGCGCTCGTCTCTTTAATGGCTTCAGAGTGGCTAACTCGTTGGGGGCGTAAAAGATTGGGGGGCGTATGCTAGAGATGAATTTTAAACAGACACTGGGCTCTTTGTGTCTGGAAGTGAATACT