Homologs in group_1500

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09680 FBDBKF_09680 62.7 Morganella morganii S1 modF molybdate ABC transporter ATP-binding protein ModF
EHELCC_04480 EHELCC_04480 62.7 Morganella morganii S2 modF molybdate ABC transporter ATP-binding protein ModF
NLDBIP_04480 NLDBIP_04480 62.7 Morganella morganii S4 modF molybdate ABC transporter ATP-binding protein ModF
LHKJJB_14150 LHKJJB_14150 62.7 Morganella morganii S3 modF molybdate ABC transporter ATP-binding protein ModF
HKOGLL_12385 HKOGLL_12385 62.7 Morganella morganii S5 modF molybdate ABC transporter ATP-binding protein ModF
F4V73_RS00660 F4V73_RS00660 60.9 Morganella psychrotolerans modF molybdate ABC transporter ATP-binding protein ModF

Distribution of the homologs in the orthogroup group_1500

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1500

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P31060 0.0 654 64 1 484 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
Q9UT95 1.32e-47 174 26 12 466 3 SPAC323.04 Uncharacterized ABC transporter ATP-binding protein C323.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UT95 5.78e-13 74 24 3 205 3 SPAC323.04 Uncharacterized ABC transporter ATP-binding protein C323.04 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q12298 9.03e-35 140 26 12 416 1 YDR061W Uncharacterized ABC transporter ATP-binding protein YDR061W Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q02151 1.89e-28 116 31 4 224 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
Q02151 2.18e-16 82 30 5 222 3 ymeB Uncharacterized ABC transporter ATP-binding protein YmeB Lactococcus lactis subsp. lactis (strain IL1403)
O31723 4.38e-27 113 31 5 216 2 ylmA Uncharacterized ABC transporter ATP-binding protein YlmA Bacillus subtilis (strain 168)
O31723 5.9e-13 72 26 4 221 2 ylmA Uncharacterized ABC transporter ATP-binding protein YlmA Bacillus subtilis (strain 168)
Q8DQY5 4.92e-25 111 25 14 487 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 5.07e-11 68 26 6 236 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 1.05e-09 64 24 6 237 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DY60 7.26e-25 111 26 16 483 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 1.31e-06 54 26 7 224 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 5.36e-06 52 23 8 232 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E3S6 7.32e-25 111 26 16 482 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8E3S6 3.82e-06 53 23 8 232 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q97SA3 2.34e-24 109 25 17 485 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 7.05e-09 61 24 6 237 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 8.32e-09 61 25 7 236 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P72477 8.25e-23 100 29 6 227 3 abcX Putative ABC transporter ATP-binding protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P72477 5.47e-11 66 28 7 222 3 abcX Putative ABC transporter ATP-binding protein Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8XK20 1.24e-22 104 25 15 486 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 1.47e-10 67 25 4 226 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.16e-10 66 24 6 228 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8D3Z9 4.07e-22 103 25 16 494 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 3.16e-08 59 23 4 216 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 9.74e-08 58 24 6 216 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q9XDA6 1.44e-21 97 32 11 229 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 3.82e-06 52 23 6 202 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q926D8 2.48e-21 96 32 11 229 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 3.65e-06 52 23 5 176 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q87G35 4.37e-21 100 24 17 497 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 6.21e-09 62 23 4 216 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 8.36e-06 52 23 7 212 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MFH3 1.04e-20 99 24 16 494 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 1.19e-07 57 27 6 223 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 1.19e-06 54 24 7 216 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q8RD43 1.28e-20 98 24 16 494 3 rbsA Ribose import ATP-binding protein RbsA Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q88ZZ2 3.65e-20 97 24 18 513 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 7.21e-14 77 26 5 230 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 1.57e-08 60 26 8 226 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O34338 4.98e-20 92 29 3 203 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
O34338 0.000229 46 24 1 103 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q93D97 6.52e-20 96 24 16 481 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 2.57e-10 66 27 5 198 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 2.31e-08 60 24 8 236 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5HCL3 2.08e-19 94 24 20 499 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q5HCL3 5.13e-08 58 24 7 242 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q5HCL3 2.67e-07 57 24 7 240 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q99QV7 2.26e-19 94 24 20 499 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99QV7 5.31e-08 58 24 7 242 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99QV7 1.93e-07 57 25 7 240 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 2.26e-19 94 24 20 499 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q7A342 5.31e-08 58 24 7 242 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q7A342 1.93e-07 57 25 7 240 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q6YRJ4 3.44e-19 94 22 16 518 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 3.44e-10 65 24 4 211 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 2.55e-09 63 24 3 206 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6LTB1 4.54e-19 90 30 6 228 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 3.74e-05 48 27 4 160 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q8NUH8 5.07e-19 93 24 20 499 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q8NUH8 9.29e-08 58 24 7 242 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q8NUH8 5.45e-07 55 25 6 218 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 5.07e-19 93 24 20 499 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q6G5Z1 9.29e-08 58 24 7 242 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q6G5Z1 5.45e-07 55 25 6 218 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q832R5 6.42e-19 93 26 17 486 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 1.46e-09 63 23 5 232 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 1.76e-09 63 24 6 260 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8TQ05 7.72e-19 93 24 23 539 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 2.52e-05 50 25 5 212 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P96117 9.22e-19 89 29 3 204 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P96117 5.07e-13 72 23 6 239 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q8ES39 1.26e-18 92 25 24 517 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9WXX0 1.66e-18 91 21 15 500 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q6D2F6 3.47e-18 89 29 8 217 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E6M2 1.43e-17 85 32 4 199 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 7.45e-08 57 28 7 197 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
P33916 1.45e-17 89 23 19 517 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
Q2SVP3 1.96e-17 86 29 8 229 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVP3 1.89e-05 50 22 5 241 3 nodI Nod factor export ATP-binding protein I Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8Y651 3.15e-17 84 28 4 193 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y651 5.06e-07 54 24 8 233 3 mntB Manganese transport system ATP-binding protein MntB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q737I0 3.2e-17 88 24 17 502 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 9.66e-08 58 23 2 211 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3JSQ0 3.57e-17 85 29 8 229 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q3JSQ0 1.38e-05 50 23 5 231 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain 1710b)
Q62K72 3.57e-17 85 29 8 229 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q62K72 1.38e-05 50 23 5 231 3 nodI Nod factor export ATP-binding protein I Burkholderia mallei (strain ATCC 23344)
Q63TX3 3.67e-17 85 29 8 229 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q63TX3 1.38e-05 50 23 5 231 3 nodI Nod factor export ATP-binding protein I Burkholderia pseudomallei (strain K96243)
Q81PZ8 4.61e-17 87 23 14 508 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 9.8e-11 67 23 2 211 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 3.2e-06 53 23 5 218 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q5WBL0 4.81e-17 84 31 8 219 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 0.000237 46 23 4 215 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
O86751 5.64e-17 85 31 9 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q6LQ00 6.22e-17 87 25 18 492 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 8.11e-06 52 23 6 226 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q6LQ00 2.86e-05 50 25 9 221 3 PBPRA2240 Putative ABC transporter ATP-binding protein PBPRA2240 Photobacterium profundum (strain SS9)
Q9KD30 8.01e-17 83 28 6 206 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9KD30 9.25e-09 59 23 5 211 3 mntB Manganese transport system ATP-binding protein MntB Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0B1U4 8.1e-17 86 22 16 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B1U4 0.000237 47 21 10 262 3 xylG Xylose import ATP-binding protein XylG Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q32K28 8.31e-17 83 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q32K28 1.94e-09 61 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q82JY6 8.61e-17 85 30 7 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82JY6 5.39e-05 48 26 5 203 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q89AJ0 8.69e-17 83 27 3 193 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 0.000341 45 40 1 57 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O34362 9.75e-17 86 23 20 484 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 2.98e-08 59 26 5 213 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 0.000163 47 22 4 209 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
Q92AF9 9.91e-17 82 27 4 193 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92AF9 2.06e-06 52 24 8 233 3 mntB Manganese transport system ATP-binding protein MntB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q04G50 1.03e-16 85 30 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04G50 8.81e-06 51 25 6 185 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q83MG3 2.16e-16 81 28 4 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q83MG3 8.21e-10 62 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q57243 2.17e-16 82 31 4 198 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57243 0.000448 45 26 7 222 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P77509 2.27e-16 85 22 16 489 3 yphE Uncharacterized ABC transporter ATP-binding protein YphE Escherichia coli (strain K12)
Q3Z5U5 2.29e-16 81 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q3Z5U5 3.1e-09 60 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q830W6 2.59e-16 84 28 5 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 0.000312 46 23 4 171 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q8A1M1 2.8e-16 81 30 8 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A1M1 3.06e-05 48 26 4 178 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q87RE5 2.9e-16 82 31 5 193 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 6.75e-09 60 25 3 179 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0T8D1 2.91e-16 81 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q0T8D1 6.81e-10 62 30 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
O31711 2.94e-16 81 29 9 217 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q326G9 3.23e-16 81 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q326G9 4.42e-10 63 30 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q6HI76 4.56e-16 84 23 15 511 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 1.12e-10 67 23 2 211 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 7.13e-06 52 23 5 218 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8RGC8 4.61e-16 83 28 7 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RGC8 0.000331 46 26 6 184 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3M5J9 5.02e-16 81 33 7 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 3.68e-05 48 25 4 169 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9HYL7 5.46e-16 81 29 10 241 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QM1 6.6e-16 81 29 10 241 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8G838 7.29e-16 84 23 16 491 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8G838 1.73e-10 67 28 11 226 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q668Q3 8.81e-16 82 30 8 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJS9 9.23e-16 82 30 8 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZCM2 9.23e-16 82 30 8 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis
Q1C607 9.23e-16 82 30 8 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8A883 9.32e-16 83 33 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A883 2.8e-06 53 26 5 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P21410 1e-15 82 31 9 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Serratia marcescens
Q03ZQ0 1.04e-15 82 30 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 3.14e-06 52 25 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P63354 1.04e-15 82 28 5 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.04e-15 82 28 5 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6D0F3 1.38e-15 79 32 6 203 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D0F3 7.78e-07 53 25 7 211 3 thiQ Thiamine import ATP-binding protein ThiQ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q64SQ6 1.41e-15 82 32 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q64SQ6 5.52e-06 52 25 4 169 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 1.42e-15 82 32 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5LBT4 5.76e-06 52 25 4 169 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P94440 1.52e-15 80 27 6 212 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 3.76e-07 55 22 4 208 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q160M2 1.6e-15 81 28 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160M2 2.87e-05 50 25 7 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
O52618 1.65e-15 81 29 8 231 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
O52618 7.8e-07 54 22 4 210 3 nodI Nod factor export ATP-binding protein I Rhizobium meliloti (strain 1021)
A0PY57 1.74e-15 81 26 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
A0PY57 3.07e-05 49 24 4 171 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q0TLS2 1.99e-15 79 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TLS2 3.85e-08 57 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FAV1 2e-15 79 28 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RGD0 2.11e-15 79 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q1RGD0 6.73e-08 57 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q31TP8 2.15e-15 79 28 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Shigella boydii serotype 4 (strain Sb227)
Q1R3F6 2.24e-15 79 28 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain UTI89 / UPEC)
Q8FL82 2.53e-15 78 28 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FL82 3.68e-08 57 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA06 2.6e-15 78 27 4 218 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q8XA06 2.88e-09 60 29 7 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q1QE80 2.69e-15 81 29 6 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QE80 2.2e-07 56 26 5 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q57554 2.99e-15 79 30 6 227 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q66AT7 3.02e-15 79 29 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 9.7e-07 53 26 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2SPI3 3.09e-15 79 29 4 205 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 1.14e-07 56 27 3 166 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q1BG93 3.1e-15 81 21 14 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
Q1BG93 8.63e-05 48 22 6 203 3 xylG Xylose import ATP-binding protein XylG Burkholderia orbicola (strain AU 1054)
A0KE53 3.1e-15 81 21 14 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
A0KE53 8.63e-05 48 22 6 203 3 xylG Xylose import ATP-binding protein XylG Burkholderia cenocepacia (strain HI2424)
Q1CJG3 3.14e-15 79 29 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.02e-06 53 26 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 3.14e-15 79 29 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.02e-06 53 26 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 3.14e-15 79 29 3 194 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.02e-06 53 26 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8ELR4 3.31e-15 80 29 5 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q3Z2Z3 3.43e-15 80 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q3Z2Z3 6.84e-05 48 24 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 3.43e-15 80 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q31ZK0 6.84e-05 48 24 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q73P93 3.83e-15 81 23 21 502 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q2RGX2 3.98e-15 81 23 15 492 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RGX2 4.31e-08 59 23 3 224 3 xylG Xylose import ATP-binding protein XylG Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q1BWI2 4e-15 79 29 9 229 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q1BWI2 1.61e-05 50 22 5 235 3 nodI Nod factor export ATP-binding protein I Burkholderia orbicola (strain AU 1054)
Q21PQ7 4.18e-15 78 29 4 192 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21PQ7 2.6e-09 61 25 3 191 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5LI72 4.2e-15 77 31 9 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q4W575 4.54e-15 80 28 5 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 1.96e-06 53 27 7 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 4.54e-15 80 28 5 216 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 1.96e-06 53 27 7 195 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
O34979 4.58e-15 77 28 7 210 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
O34979 5.78e-07 53 24 7 216 3 yvrO Uncharacterized ABC transporter ATP-binding protein YvrO Bacillus subtilis (strain 168)
Q64Z80 4.66e-15 77 31 9 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q5FA19 4.93e-15 79 28 6 215 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 4.4e-06 52 26 5 186 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7MMN0 5.45e-15 78 31 5 199 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 4.24e-06 52 26 4 164 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 5.45e-15 78 31 5 199 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 4.24e-06 52 26 4 164 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
P16677 5.74e-15 78 28 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli (strain K12)
Q4FMG5 6.86e-15 78 27 4 191 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q32EY4 6.99e-15 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q32EY4 7.21e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
P31548 8.08e-15 77 27 4 218 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
P31548 2.28e-09 61 29 7 213 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q50966 8.32e-15 79 27 4 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q0T5R2 9.19e-15 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q0T5R2 5.16e-05 49 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
P69877 1.07e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69877 6.21e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.07e-14 79 28 5 227 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69874 6.21e-05 48 26 5 182 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.07e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69875 6.21e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.07e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIU8 6.21e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.07e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
P69876 6.21e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q38VW6 1.17e-14 79 26 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q38VW6 0.000105 48 23 4 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q8U6M1 1.26e-14 78 32 8 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q83P97 1.27e-14 77 27 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri
Q0SXV5 1.27e-14 77 27 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Shigella flexneri serotype 5b (strain 8401)
A1B9K8 1.29e-14 77 29 6 204 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 2.99e-07 55 28 4 175 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q4KC87 1.3e-14 78 29 8 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KC87 0.001 45 23 7 207 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q39GT7 1.32e-14 77 28 8 228 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39GT7 1.33e-05 50 25 7 225 3 nodI Nod factor export ATP-binding protein I Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8UH62 1.37e-14 78 27 6 217 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1RD28 1.4e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
Q1RD28 6.05e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.4e-14 79 28 5 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
A1AA20 6.05e-05 48 26 5 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q9HT73 1.4e-14 77 30 5 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 4.59e-08 57 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.4e-14 77 30 5 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 4.59e-08 57 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q891M1 1.42e-14 79 22 11 356 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 2.08e-06 53 26 7 199 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q891M1 9.56e-06 51 24 6 207 3 rbsA Ribose import ATP-binding protein RbsA Clostridium tetani (strain Massachusetts / E88)
Q3YUN6 1.56e-14 77 27 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Shigella sonnei (strain Ss046)
Q92DL6 1.59e-14 78 27 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O69063 1.62e-14 78 30 6 230 3 htxD Hypophosphite import ATP-binding protein HtxD Stutzerimonas stutzeri
Q8RD07 1.84e-14 76 29 5 166 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 4.53e-08 57 31 6 174 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5WC31 1.9e-14 79 24 15 464 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 2.12e-08 60 23 8 225 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q5WC31 2.74e-07 56 22 7 216 3 rbsA Ribose import ATP-binding protein RbsA Shouchella clausii (strain KSM-K16)
Q98K23 2.05e-14 77 29 5 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6HLQ9 2.08e-14 77 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81GC1 2.14e-14 77 30 6 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 0.000145 47 27 5 177 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0RYP7 2.15e-14 77 30 8 205 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q8CPN0 2.19e-14 78 25 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q2K8C8 2.2e-14 77 29 9 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8X5I6 2.2e-14 76 29 4 211 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q8X5I6 1.22e-06 53 29 6 190 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q92XW1 2.23e-14 77 27 5 212 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q63E84 2.34e-14 77 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.34e-14 77 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.34e-14 77 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q13ZJ1 2.34e-14 77 28 6 214 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q13ZJ1 1.28e-05 50 30 0 96 3 nodI Nod factor export ATP-binding protein I Paraburkholderia xenovorans (strain LB400)
Q98DT6 2.4e-14 76 32 9 216 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0T9T7 2.64e-14 76 27 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q13LX0 2.69e-14 78 21 14 503 3 rbsA Ribose import ATP-binding protein RbsA Paraburkholderia xenovorans (strain LB400)
Q81TH8 2.82e-14 77 28 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q8Z7H7 2.87e-14 77 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q8Z7H7 0.000202 47 25 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
A0KPH6 2.88e-14 76 27 3 201 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 3.19e-08 58 28 6 187 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q578K3 2.89e-14 77 30 7 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 2.89e-14 77 30 7 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q5HQ70 2.99e-14 77 25 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HQ70 0.000857 45 23 6 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8XDV7 3.1e-14 76 27 8 225 3 phnC Phosphonates import ATP-binding protein PhnC Escherichia coli O157:H7
Q2SSS4 3.18e-14 77 27 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 2.21e-07 56 25 5 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q0I3Y9 3.27e-14 77 29 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q0I3Y9 1.7e-05 50 26 6 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q31I51 3.27e-14 75 28 5 205 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.03e-06 53 27 4 168 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5E586 3.33e-14 77 27 5 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5PMK1 3.41e-14 77 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PMK1 0.000175 47 25 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q55281 3.46e-14 75 29 6 185 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55281 7.41e-07 53 24 5 220 3 mntA Manganese transport system ATP-binding protein MntA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P40790 3.5e-14 77 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P40790 0.000191 47 25 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 3.5e-14 77 29 5 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q57QC8 0.000191 47 25 4 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q6N999 3.52e-14 75 29 11 235 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0S0Z3 3.56e-14 77 31 12 209 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q0S0Z3 1e-05 51 22 7 218 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q32HA3 3.58e-14 75 30 4 201 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 1.48e-06 53 25 4 162 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
P72335 3.63e-14 76 27 8 213 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
P72335 1.1e-06 53 22 4 243 3 nodI Nod factor export ATP-binding protein I Rhizobium sp. (strain N33)
Q7N545 3.71e-14 75 30 4 199 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 8.08e-06 50 37 0 66 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q73R11 4.22e-14 78 24 15 486 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q5WXF0 4.35e-14 77 30 6 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q5WXF0 5.94e-05 48 25 6 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q6MU19 4.75e-14 77 26 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 3.45e-07 55 25 5 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6RCE0 5.1e-14 75 26 9 230 3 phnC Phosphonates import ATP-binding protein PhnC Stutzerimonas stutzeri
Q5ZWE4 5.32e-14 77 30 6 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 8.81e-06 51 25 5 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q98HF7 5.46e-14 77 29 8 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98HF7 7.99e-07 54 24 5 181 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1WVI7 5.58e-14 76 27 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q1WVI7 0.000709 45 24 4 171 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q722B1 5.7e-14 76 26 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
P50332 5.72e-14 76 29 8 242 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
P50332 6.5e-07 55 25 4 208 3 nodI Nod factor export ATP-binding protein I Neorhizobium galegae
A0AGP9 5.81e-14 76 26 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3Z542 6.27e-14 75 28 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q3Z542 1.42e-06 53 29 6 190 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 6.27e-14 75 28 4 211 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q47538 1.42e-06 53 29 6 190 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q8FVV5 6.9e-14 76 30 7 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q32IZ6 7.15e-14 75 28 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q32IZ6 2.31e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q8XZQ4 8.07e-14 75 29 6 232 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P0A9S9 8.16e-14 74 28 6 197 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S9 8.2e-05 47 22 5 210 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Shigella flexneri
P0A9S7 8.16e-14 74 28 6 197 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S7 8.2e-05 47 22 5 210 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli (strain K12)
P0A9S8 8.16e-14 74 28 6 197 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
P0A9S8 8.2e-05 47 22 5 210 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Escherichia coli O157:H7
Q03AH0 8.57e-14 76 28 5 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03AH0 0.000148 47 27 9 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q3KBH4 8.58e-14 76 29 8 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q3KBH4 1.58e-05 50 23 10 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q74I62 8.64e-14 77 23 17 517 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 7.37e-10 65 24 6 234 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 8.15e-07 55 25 5 215 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q14Q07 9.62e-14 75 28 6 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 7.19e-05 48 28 6 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q1LKJ2 9.67e-14 75 30 7 203 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LKJ2 2.38e-06 52 23 4 240 3 nodI Nod factor export ATP-binding protein I Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8KFD6 9.79e-14 75 29 8 224 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KFD6 9.79e-08 57 25 6 215 3 CT0391 Putative ABC transporter ATP-binding protein CT0391 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
O84071 1.02e-13 74 26 3 198 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
O84071 1.6e-08 58 24 8 234 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q5X627 1.02e-13 75 30 6 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 1.92e-05 50 23 5 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q325N3 1.03e-13 74 28 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q325N3 2e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q07756 1.06e-13 75 30 8 209 3 nodI Nod factor export ATP-binding protein I Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q88YN5 1.08e-13 74 27 8 229 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88YN5 0.000172 47 25 4 202 3 phnC Phosphonates import ATP-binding protein PhnC Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q18AM3 1.11e-13 75 29 4 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q18AM3 0.000229 47 25 6 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q83MA0 1.2e-13 74 28 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q83MA0 2.09e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q73F67 1.21e-13 74 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5LT05 1.22e-13 75 29 6 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O34946 1.29e-13 73 26 4 206 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 5.86e-06 51 32 1 76 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q2SW38 1.34e-13 76 21 15 493 3 xylG Xylose import ATP-binding protein XylG Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P42360 1.36e-13 73 27 3 195 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
P42360 2.61e-06 52 22 4 230 1 scaC Manganese import ATP-binding protein ScaC Streptococcus gordonii
P37624 1.39e-13 77 26 16 360 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
P37624 7.36e-10 65 29 6 210 1 rbbA Ribosome-associated ATPase Escherichia coli (strain K12)
Q0S0X2 1.39e-13 74 28 4 211 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 8.3e-05 47 25 5 209 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q8CUY0 1.4e-13 73 27 7 217 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4QK57 1.48e-13 75 27 7 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4QK57 2.65e-05 50 23 5 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q660M8 1.48e-13 75 28 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q65UE1 1.54e-13 75 27 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UE1 1.53e-06 53 26 6 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1M7W6 1.57e-13 74 28 7 226 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1M7W6 1.37e-06 53 23 6 215 3 nodI Nod factor export ATP-binding protein I Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3KCC5 1.63e-13 75 27 10 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q3KCC5 3.34e-07 55 22 5 208 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
A1TXH7 1.64e-13 75 29 7 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 0.000643 45 24 5 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8UA86 1.74e-13 76 23 14 490 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UA86 8.85e-05 48 26 0 93 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4KKK4 1.79e-13 73 29 6 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 4.6e-07 54 25 4 171 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8XIZ5 1.79e-13 75 28 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.79e-13 75 28 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SBZ1 1.85e-13 75 30 9 206 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q0SBZ1 1.09e-05 51 22 7 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q8UBB7 1.97e-13 75 26 6 214 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
O51587 2e-13 75 28 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9KS33 2.02e-13 75 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P37774 2.05e-13 73 27 9 233 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 2.28e-06 52 20 3 234 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q88KY4 2.09e-13 73 31 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88KY4 7.97e-07 53 27 4 184 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3MAR5 2.1e-13 75 29 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3MAR5 7.84e-08 58 26 5 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DMY0 2.15e-13 73 27 6 229 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DMY0 3.19e-07 55 25 5 195 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04HV8 2.15e-13 73 27 6 229 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04HV8 3.19e-07 55 25 5 195 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q9CP06 2.15e-13 75 28 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 9.63e-05 48 26 5 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q92WJ0 2.22e-13 74 30 7 206 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q0SML1 2.3e-13 74 28 5 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q6DB87 2.36e-13 75 23 17 477 3 rbsA Ribose import ATP-binding protein RbsA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q92VJ2 2.37e-13 75 26 5 208 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q30V33 2.45e-13 75 28 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q30V33 6.2e-07 55 25 6 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8FKF5 2.57e-13 73 28 6 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FKF5 3.05e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A193 2.57e-13 73 26 8 215 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A193 2.09e-05 49 22 5 210 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A194 2.57e-13 73 26 8 215 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
P0A194 2.09e-05 49 22 5 210 3 livG High-affinity branched-chain amino acid transport ATP-binding protein LivG Salmonella typhi
Q1GL85 2.58e-13 73 29 4 199 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 2.11e-08 58 27 3 197 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q8G847 2.61e-13 75 20 12 462 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 5.44e-12 71 27 8 228 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q8G847 2.24e-07 57 25 4 235 1 fruK Fructose import ATP-binding protein FruK Bifidobacterium longum (strain NCC 2705)
Q73P71 2.66e-13 73 26 7 218 3 phnC Phosphonates import ATP-binding protein PhnC Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q48PV0 2.77e-13 73 28 4 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 6.96e-06 51 25 5 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q57399 2.85e-13 73 27 3 186 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0SRL2 2.96e-13 74 27 6 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6LPK2 2.99e-13 72 28 6 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photobacterium profundum (strain SS9)
Q97N51 3.13e-13 73 27 6 229 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97N51 4.89e-07 54 26 5 192 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q57TF5 3.14e-13 72 25 4 216 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q57TF5 8.14e-11 65 30 6 209 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q81J16 3.38e-13 73 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q92G36 3.51e-13 72 27 4 205 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q92G36 0.000482 45 21 4 183 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q882S0 3.64e-13 73 27 10 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q882S0 0.00051 45 22 6 204 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1WXT0 3.69e-13 72 28 9 204 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 2.26e-06 52 38 0 70 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q07LQ4 3.72e-13 73 27 6 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q4L5B3 3.76e-13 74 26 8 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q8Z9I6 3.91e-13 72 25 4 216 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q8Z9I6 5.4e-10 63 30 6 209 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhi
Q5PDF8 4.06e-13 72 25 4 216 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PDF8 3.86e-10 63 30 6 209 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6HPN0 4.11e-13 73 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 4.11e-13 73 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 4.11e-13 73 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q8YM92 4.17e-13 74 28 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YM92 5.12e-08 58 27 5 184 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1RFH8 4.35e-13 72 28 6 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q1RFH8 2.42e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 4.35e-13 72 28 6 212 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TKS1 2.42e-06 52 29 6 190 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q72FW5 4.35e-13 74 27 6 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q63H62 4.39e-13 73 28 7 194 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q5F8K2 4.46e-13 72 28 10 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P45171 4.47e-13 74 27 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45171 7.9e-06 51 24 5 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55476 4.5e-13 73 29 8 212 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5E882 4.51e-13 72 26 3 213 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E882 2.38e-09 61 30 5 182 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8X5N2 4.54e-13 72 29 9 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q8X5N2 7.35e-11 66 29 6 196 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O157:H7
Q82B58 4.78e-13 75 29 6 208 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q11ID5 4.87e-13 72 30 7 190 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q11ID5 1.81e-05 50 22 5 223 3 hmuV Hemin import ATP-binding protein HmuV Chelativorans sp. (strain BNC1)
Q6G098 4.89e-13 72 28 7 223 3 hmuV Hemin import ATP-binding protein HmuV Bartonella quintana (strain Toulouse)
Q1J3P2 5.07e-13 74 21 11 476 3 rbsA Ribose import ATP-binding protein RbsA Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q9WXX8 5.25e-13 72 27 6 190 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 2.12e-07 55 24 4 198 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88ZJ6 5.3e-13 73 27 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P10346 5.35e-13 72 30 6 209 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q3KKA1 5.4e-13 72 29 5 201 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.24e-07 56 25 4 191 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q87UN0 5.68e-13 72 27 4 200 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 2.99e-06 52 25 5 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1R597 5.68e-13 72 29 9 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q1R597 4.3e-10 63 29 6 196 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli (strain UTI89 / UPEC)
Q9KQB8 5.74e-13 72 31 5 199 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 4.51e-08 57 28 2 171 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6VMN4 5.79e-13 74 22 14 488 3 xylG Xylose import ATP-binding protein XylG Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
O85818 5.97e-13 73 27 7 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
O85818 1.56e-05 50 26 5 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q5NHP2 6.04e-13 71 27 5 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NHP2 0.000262 46 30 8 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 6.04e-13 71 27 5 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q2A4V5 0.000262 46 30 8 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 6.04e-13 71 27 5 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q14J44 0.000262 46 30 8 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q88R93 6.39e-13 72 28 8 230 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88R93 0.000359 45 26 4 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4QP85 6.41e-13 73 26 6 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q0BZD8 6.51e-13 72 29 10 247 3 phnC Phosphonates import ATP-binding protein PhnC Hyphomonas neptunium (strain ATCC 15444)
Q49588 6.64e-13 72 28 8 207 3 pstB Phosphate import ATP-binding protein PstB Mycobacterium intracellulare
A3CRB9 6.75e-13 72 27 6 213 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus sanguinis (strain SK36)
Q8YCG3 7.53e-13 73 30 7 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P14788 7.62e-13 73 32 5 174 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q48HL2 7.81e-13 72 27 10 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A9CKL2 7.9e-13 74 23 15 470 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 4.08e-06 53 22 10 251 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 1.37e-05 51 26 7 201 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4ZZS2 8.74e-13 72 26 3 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 3.05e-06 52 25 4 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q97KS6 8.88e-13 73 31 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 9.12e-06 51 27 6 180 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
P45046 9.22e-13 73 21 13 475 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45046 2.99e-09 62 27 9 218 3 xylG Xylose import ATP-binding protein XylG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23703 9.28e-13 72 26 10 260 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P23703 0.000186 47 21 6 223 3 nodI Nod factor export ATP-binding protein I Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8FCJ1 9.34e-13 71 29 9 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCJ1 4.11e-10 63 29 6 196 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBU8 9.34e-13 71 29 9 235 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBU8 4.11e-10 63 29 6 196 3 hmuV Hemin import ATP-binding protein HmuV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8TYV9 9.38e-13 72 28 6 209 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TYV9 3.51e-11 67 29 7 214 3 MK0182 Putative ABC transporter ATP-binding protein MK0182 Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q1IGY7 9.39e-13 71 28 5 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 3.89e-06 52 25 5 175 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q50294 9.68e-13 72 25 8 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q50294 2.28e-09 62 25 8 217 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q042G7 1e-12 73 30 10 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q042G7 2.68e-05 50 25 4 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q2PBM0 1.02e-12 73 23 14 490 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Photorhabdus luminescens
Q0T7M2 1.04e-12 71 28 4 211 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri serotype 5b (strain 8401)
Q0T7M2 1.38e-05 50 28 6 190 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri serotype 5b (strain 8401)
Q47C66 1.04e-12 70 31 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q2RFS8 1.07e-12 72 27 7 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RFS8 5.85e-05 48 27 6 204 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q6D4E2 1.08e-12 73 28 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4E2 9.08e-05 48 27 5 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3YSK9 1.09e-12 71 27 6 196 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q3YSK9 5.12e-06 51 30 6 170 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q8Z0H0 1.1e-12 72 28 7 204 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8Z0H0 0.000235 47 28 7 182 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q0BN75 1.12e-12 70 30 5 166 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q0BN75 0.000237 46 30 8 182 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain OSU18)
Q1BWL4 1.12e-12 72 25 8 278 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 1.12e-12 72 25 8 278 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q4L884 1.15e-12 72 25 5 207 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q4L884 1.88e-05 50 24 8 211 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q6CYU2 1.15e-12 71 28 5 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6CYU2 0.000367 45 27 4 169 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8REG7 1.28e-12 71 24 7 240 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8REG7 0.000746 44 26 7 197 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4ZLS1 1.29e-12 71 27 4 222 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZLS1 2.41e-07 55 27 7 245 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q87UI3 1.37e-12 71 27 4 222 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 1.67e-07 56 27 7 245 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87PH3 1.38e-12 72 26 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4K681 1.39e-12 72 25 7 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4K681 1.25e-07 57 28 7 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q28QF9 1.4e-12 71 25 6 257 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q28QF9 1.42e-08 59 28 6 182 3 hmuV Hemin import ATP-binding protein HmuV Jannaschia sp. (strain CCS1)
Q32AY3 1.45e-12 71 29 9 235 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q32AY3 3.48e-10 63 29 6 196 3 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae serotype 1 (strain Sd197)
Q74K65 1.46e-12 72 30 10 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74K65 3.95e-05 49 25 4 176 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
P08720 1.56e-12 72 27 7 226 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
P08720 2.79e-06 52 23 6 215 3 nodI Nod factor export ATP-binding protein I Rhizobium leguminosarum bv. viciae
Q329I3 1.58e-12 71 26 7 223 3 phnC Phosphonates import ATP-binding protein PhnC Shigella dysenteriae serotype 1 (strain Sd197)
Q6G475 1.59e-12 71 28 7 227 3 hmuV Hemin import ATP-binding protein HmuV Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q0I4A9 1.6e-12 71 29 5 203 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q0I4A9 2.96e-06 52 24 4 225 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q2K0S7 1.63e-12 73 24 17 483 3 rbsA3 Ribose import ATP-binding protein RbsA 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q88RL1 1.63e-12 70 27 5 193 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 4.76e-06 51 25 5 173 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9X196 1.63e-12 72 28 8 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q03PF2 1.81e-12 72 26 7 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PF2 0.00011 48 25 9 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q48CA0 1.85e-12 70 27 4 222 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48CA0 7.31e-09 60 28 8 246 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5GRS1 1.94e-12 70 24 5 214 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q5GRS1 7.49e-11 65 23 5 221 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q1RGL1 2.01e-12 70 27 4 190 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q1RGL1 8.89e-06 50 24 4 171 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia bellii (strain RML369-C)
Q9TKX3 2.08e-12 72 30 7 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q9TKX3 3.8e-06 52 29 7 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
A0LCH8 2.09e-12 70 26 4 194 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 2.75e-09 61 25 3 176 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q0SQH5 2.28e-12 70 27 7 211 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain SM101 / Type A)
Q9KXJ6 2.28e-12 72 29 6 208 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9KXJ6 2.17e-09 63 26 5 226 3 SCO2324 Putative ABC transporter ATP-binding protein SCO2324 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O57896 2.31e-12 71 26 6 227 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57896 2.03e-08 59 29 6 194 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5JEB0 2.53e-12 71 26 7 238 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q5JEB0 1.17e-08 60 31 6 167 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8ZRV2 2.81e-12 69 24 4 216 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZRV2 5.66e-10 63 30 6 209 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0BFQ0 2.82e-12 71 27 7 240 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q6LR20 2.86e-12 71 28 10 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
A3DJK3 3.19e-12 70 28 7 209 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8PUE7 3.32e-12 72 26 14 355 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PUE7 5.86e-08 58 28 7 201 3 MM_2387 Putative ABC transporter ATP-binding protein MM_2387 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q7VNG4 3.4e-12 71 29 7 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VNG4 1.94e-05 50 25 5 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MKU3 3.49e-12 71 26 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 3.49e-12 71 26 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
O70014 3.53e-12 70 29 9 235 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
O70014 3e-10 64 29 6 196 1 hmuV Hemin import ATP-binding protein HmuV Shigella dysenteriae
Q4FQ27 3.58e-12 69 29 4 194 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 1.37e-08 58 26 7 206 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9RKC6 3.59e-12 70 28 9 211 3 SCO3161 Putative ABC transporter ATP-binding protein SCO3161 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9RKC6 8.55e-11 65 28 7 216 3 SCO3161 Putative ABC transporter ATP-binding protein SCO3161 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8T664 3.68e-12 72 26 7 219 3 abcH2 ABC transporter H family member 2 Dictyostelium discoideum
Q8T664 1.28e-06 54 25 5 184 3 abcH2 ABC transporter H family member 2 Dictyostelium discoideum
Q31GF5 3.72e-12 69 29 8 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9PKX1 3.75e-12 70 25 4 197 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q9PKX1 9.93e-08 56 24 8 234 3 TC_0339 Probable metal transport system ATP-binding protein TC_0339 Chlamydia muridarum (strain MoPn / Nigg)
Q28VN1 3.82e-12 69 27 3 203 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 4.37e-08 57 32 3 144 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q4L885 3.9e-12 70 25 4 207 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus haemolyticus (strain JCSC1435)
P45247 3.97e-12 69 28 10 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45247 1.02e-05 50 26 4 181 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 3.97e-12 69 28 10 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q4QKQ9 1.02e-05 50 26 4 181 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q58429 3.97e-12 70 25 7 221 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 5.99e-09 60 26 6 219 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1AS06 4.22e-12 71 26 8 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AS06 2.63e-06 53 24 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q119J0 4.39e-12 69 29 4 220 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Trichodesmium erythraeum (strain IMS101)
Q6FFL0 4.44e-12 69 25 3 199 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 4.48e-09 60 27 6 173 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P77795 4.72e-12 70 29 8 214 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
P77795 0.000123 47 29 8 173 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q9CL63 4.86e-12 71 22 13 505 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q9CL63 0.000143 48 23 6 236 3 rbsA2 Ribose import ATP-binding protein RbsA 2 Pasteurella multocida (strain Pm70)
Q93KD4 4.9e-12 68 25 3 212 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q93KD4 3.23e-08 57 27 4 187 1 tupC Tungstate uptake system ATP-binding protein TupC Peptoclostridium acidaminophilum
Q6F0V4 5.15e-12 70 26 4 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q6F0V4 6.76e-05 48 26 4 168 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q49WM4 5.4e-12 70 27 8 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P04983 5.43e-12 71 23 15 478 1 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain K12)
Q0TAW0 5.43e-12 71 23 15 478 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q21JQ9 5.61e-12 68 29 9 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21JQ9 1.31e-05 50 26 4 176 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8UAK2 5.63e-12 71 20 14 497 3 Atu3371 Putative ribose/galactose/methyl galactoside import ATP-binding protein 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2YAD6 5.98e-12 70 26 6 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q4ZU82 5.99e-12 69 26 9 229 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Pseudomonas syringae pv. syringae (strain B728a)
Q1R4I3 5.99e-12 71 23 15 478 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli (strain UTI89 / UPEC)
Q9I3N7 6.36e-12 68 29 5 185 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I3N7 2.97e-05 48 29 4 171 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q39GW5 6.36e-12 70 27 7 240 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8DMX9 6.54e-12 69 26 6 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 6.54e-12 69 26 6 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 6.54e-12 69 26 6 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
O83658 6.58e-12 70 29 8 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q81C68 6.72e-12 68 26 8 226 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81C68 7.15e-05 48 22 5 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P32721 6.73e-12 71 21 14 482 3 alsA D-allose import ATP-binding protein AlsA Escherichia coli (strain K12)
Q8XXY9 6.78e-12 70 28 9 214 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8XXY9 6.01e-08 58 23 7 256 3 nodI Nod factor export ATP-binding protein I Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q56927 6.9e-12 70 29 7 201 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Yersinia enterocolitica
Q2JPW6 6.98e-12 69 27 6 198 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q58903 6.99e-12 68 26 9 215 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58903 0.000337 45 23 3 193 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1GIE5 7.02e-12 70 28 9 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q1GIE5 7.32e-06 51 24 6 186 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q7NQN5 7.61e-12 70 27 6 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NQN5 0.000186 47 25 8 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8DWR3 7.66e-12 69 26 7 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 7.66e-12 69 26 7 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 7.66e-12 69 26 7 205 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q13RB6 7.7e-12 71 21 12 486 3 xylG Xylose import ATP-binding protein XylG Paraburkholderia xenovorans (strain LB400)
P44513 7.71e-12 70 26 6 216 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6G529 7.8e-12 68 31 4 176 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6D201 7.93e-12 70 29 7 192 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 0.001 45 38 0 59 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q1CMQ3 8.26e-12 68 29 6 212 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CMQ3 2.51e-07 55 25 7 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WJE4 8.26e-12 68 29 6 212 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q0WJE4 2.51e-07 55 25 7 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis
Q1C1Y5 8.26e-12 68 29 6 212 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1Y5 2.51e-07 55 25 7 217 3 thiQ Thiamine import ATP-binding protein ThiQ Yersinia pestis bv. Antiqua (strain Antiqua)
Q3B2U2 8.77e-12 68 28 10 217 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3B2U2 7.93e-10 62 28 4 183 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q5PJX5 8.99e-12 70 24 10 364 3 rbsA Ribose import ATP-binding protein RbsA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q62K56 9.29e-12 69 28 7 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q62K56 0.000253 47 25 4 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q110U3 9.53e-12 70 27 9 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q110U3 1.16e-07 57 26 6 180 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q03I83 9.68e-12 68 26 4 208 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03I83 6.09e-06 51 28 6 169 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M244 9.68e-12 68 26 4 208 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M244 6.09e-06 51 28 6 169 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ4 9.68e-12 68 26 4 208 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain CNRZ 1066)
Q5LXJ4 6.09e-06 51 28 6 169 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus thermophilus (strain CNRZ 1066)
Q2NU23 9.85e-12 68 28 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 2.25e-05 49 24 2 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q03PY6 9.94e-12 69 24 6 219 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PY6 5.27e-05 48 31 3 103 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
O34677 1.01e-11 68 26 7 214 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
O34677 0.000318 45 24 5 178 2 glnQ Glutamine transport ATP-binding protein GlnQ Bacillus subtilis (strain 168)
Q63TW1 1.04e-11 69 28 7 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q63TW1 0.000187 47 25 4 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q82HA2 1.04e-11 68 25 6 217 3 SAV_3608 Putative ABC transporter ATP-binding protein SAV_3608 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82HA2 2.02e-10 64 27 8 208 3 SAV_3608 Putative ABC transporter ATP-binding protein SAV_3608 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q1B8V9 1.04e-11 70 27 8 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.04e-11 70 27 8 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
P57030 1.04e-11 68 29 13 243 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9G4F5 1.05e-11 69 29 5 191 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8XAW7 1.08e-11 70 23 15 478 3 rbsA1 Ribose import ATP-binding protein RbsA 1 Escherichia coli O157:H7
Q5UW69 1.09e-11 68 26 7 215 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8FBS3 1.17e-11 70 23 15 478 3 rbsA Ribose import ATP-binding protein RbsA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q3JSR6 1.18e-11 69 28 7 222 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q3JSR6 0.000141 47 25 4 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q0K2U3 1.18e-11 68 30 6 186 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q7A169 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.2e-11 69 29 9 207 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.2e-11 69 29 9 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q73XU8 1.23e-11 69 25 6 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q6GEL4 1.27e-11 68 23 4 220 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MRSA252)
Q6GEL4 2.06e-09 62 24 7 212 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MRSA252)
Q18H36 1.34e-11 68 27 7 238 3 phnC2 Phosphonates import ATP-binding protein PhnC 2 Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q8PNN4 1.34e-11 69 28 5 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q8PNN4 1.45e-05 50 28 7 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
P25885 1.36e-11 68 28 8 201 3 R00382 Uncharacterized ABC transporter ATP-binding protein R00382 Rhizobium meliloti (strain 1021)
Q8YK28 1.41e-11 68 26 3 208 3 phnC3 Phosphonates import ATP-binding protein PhnC 3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1QSE9 1.43e-11 68 27 9 231 3 pstB2 Phosphate import ATP-binding protein PstB 2 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q3YVK8 1.48e-11 70 23 9 349 3 rbsA Ribose import ATP-binding protein RbsA Shigella sonnei (strain Ss046)
A0QQ70 1.49e-11 68 30 7 225 1 phnC Phosphate-import ATP-binding protein PhnC Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8TQW9 1.5e-11 70 24 18 455 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 2.4e-08 60 26 4 206 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQW9 4.11e-06 53 23 8 214 3 MA_1418 Putative ABC transporter ATP-binding protein MA_1418 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O68106 1.51e-11 68 28 8 210 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O68106 1.02e-07 57 25 8 230 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q160G4 1.52e-11 68 30 5 186 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160G4 4.06e-09 60 24 4 233 3 hmuV Hemin import ATP-binding protein HmuV Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A3CRB8 1.53e-11 68 29 9 218 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
A3CRB8 6.74e-09 60 26 5 195 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
Q5HBR8 1.56e-11 67 25 4 198 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5HBR8 1.04e-05 50 28 5 170 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.56e-11 67 25 4 198 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q5FHB0 1.04e-05 50 28 5 170 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q9CP24 1.56e-11 68 28 4 197 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q9CP24 0.000296 46 42 0 49 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q6FZX3 1.56e-11 67 31 7 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bartonella quintana (strain Toulouse)
Q7NUJ3 1.58e-11 70 26 7 221 3 macB Macrolide export ATP-binding/permease protein MacB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1WSB8 1.59e-11 68 27 7 214 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q8PC11 1.61e-11 69 28 5 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PC11 1.31e-05 50 26 5 180 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q5PB72 1.62e-11 67 25 6 199 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q5PB72 8.58e-09 59 27 5 190 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q1CDJ0 1.66e-11 70 22 17 496 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CDJ0 0.000675 45 20 6 235 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG00 1.66e-11 70 22 17 496 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q7CG00 0.000675 45 20 6 235 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis
Q1C1B8 1.66e-11 70 22 17 496 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C1B8 0.000675 45 20 6 235 3 rbsA Ribose import ATP-binding protein RbsA Yersinia pestis bv. Antiqua (strain Antiqua)
Q89UD2 1.7e-11 68 29 9 200 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 2.86e-05 49 21 4 289 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8XHV2 1.71e-11 68 26 7 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain 13 / Type A)
Q0TMS7 1.71e-11 68 26 7 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8DUF7 1.71e-11 69 28 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q98G43 1.71e-11 69 28 7 200 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98G43 2.28e-09 62 25 7 258 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q4UJW5 1.74e-11 67 26 4 205 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q4UJW5 0.000292 45 42 1 57 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q881U6 1.75e-11 67 27 6 217 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q881U6 0.000384 45 24 4 176 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8RFV0 1.76e-11 67 28 9 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
C0SPB4 1.81e-11 68 28 5 203 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
C0SPB4 2.26e-10 65 27 7 202 3 yhaQ Uncharacterized ABC transporter ATP-binding protein YhaQ Bacillus subtilis (strain 168)
Q82WT5 1.82e-11 69 26 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A0LM36 1.9e-11 70 29 10 221 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
O66646 1.9e-11 67 29 11 218 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O66646 0.000225 46 23 6 202 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
Q5FL41 1.91e-11 68 28 6 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
P74548 1.95e-11 68 30 5 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P74548 4.14e-05 49 26 6 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0A8P9 1.96e-11 67 28 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A8P9 1.01e-07 56 28 6 184 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q8DZJ0 1.97e-11 69 25 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DZJ0 5.01e-05 49 23 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.97e-11 69 25 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q8E554 5.01e-05 49 23 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.97e-11 69 25 5 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K0Y6 5.01e-05 49 23 5 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q217B2 2e-11 67 27 9 274 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q471U2 2.02e-11 67 30 6 187 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q12R52 2.07e-11 67 25 6 225 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q12R52 2.25e-07 55 25 8 224 3 hmuV Hemin import ATP-binding protein HmuV Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
P9WQK9 2.07e-11 68 26 10 250 1 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK8 2.07e-11 68 26 10 250 3 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7U0Z9 2.07e-11 68 26 10 250 3 pstB2 Phosphate import ATP-binding protein PstB 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1WSB9 2.08e-11 68 28 9 223 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q1WSB9 2.79e-09 61 25 7 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
P55662 2.11e-11 67 27 8 239 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q03ZL6 2.21e-11 67 26 6 212 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZL6 5.87e-05 48 29 9 186 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q58488 2.24e-11 67 25 10 243 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58488 8.42e-11 66 26 7 210 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9Z8J5 2.29e-11 67 26 3 170 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q9Z8J5 4.65e-07 54 22 5 218 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q38UU0 2.3e-11 68 25 8 223 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Latilactobacillus sakei subsp. sakei (strain 23K)
Q38UU0 1.51e-07 56 26 11 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Latilactobacillus sakei subsp. sakei (strain 23K)
Q2IF17 2.32e-11 67 28 8 242 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Anaeromyxobacter dehalogenans (strain 2CP-C)
Q1GB17 2.33e-11 68 26 6 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q8XKQ2 2.36e-11 69 22 14 481 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Clostridium perfringens (strain 13 / Type A)
Q04BG2 2.37e-11 68 26 6 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q7CN92 2.38e-11 68 26 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7CN92 4.16e-05 49 24 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 2.38e-11 68 26 5 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q99ZS8 4.16e-05 49 24 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q68Y13 2.44e-11 67 27 4 190 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q68Y13 0.000496 45 22 4 162 3 znuC Zinc import ATP-binding protein ZnuC Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P37388 2.46e-11 69 21 15 509 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q5YTW4 2.56e-11 67 29 4 192 3 phnC Phosphonates import ATP-binding protein PhnC Nocardia farcinica (strain IFM 10152)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02915
Feature type CDS
Gene modF
Product molybdate ABC transporter ATP-binding protein ModF
Location 638016 - 639482 (strand: -1)
Length 1467 (nucleotides) / 488 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1500
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1119 Inorganic ion transport and metabolism (P) P ABC-type molybdenum transport system, ATPase component ModF/photorepair protein PhrA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05776 molybdate transport system ATP-binding protein ABC transporters -

Protein Sequence

MKYLQLTKTLFRLSDTLCLHIDDLTINEGESWAFVGSNGSGKTALANTLCQEGILLSGELINRFTRPINLSFEKLQKMIEEEWLRNNTDLLSEDEDDTGLTVAQVIQMQVKDNDRCLLLAKQFGIDALLSRRFKYLSTGESRKVLLIQLLMNKPDLLILDEPFDGLDIDSRRTLSELLSSLHQQKLTIVLILNRFNDIPDFVQNAGLLIDCKLVAQGKKSDILSDSVIAQLSHSETLENLILPASDSVDAVPTLPPTLSPIILKDGVVSYNDKPVLHHLTWEVKPQQHWQILGPNGAGKSTLLSLITGDHPQGYSNDLTLFGRKRGSGETIWEIKRHIGYVSNALHQSYRVSSSVKNVIISGFHDSIGIYQAVTDKQQKLADEWLTLIGLTALANHPFHSLSWGQQRLVLIVRALVKHPTLLILDEPLQGLDTTNRLLVQRFIDIMISHSNTQLLFVSHHQEDAPHCITHRLIFIKEGDIYRYQQQPC

Flanking regions ( +/- flanking 50bp)

AACCGATATTGGTAAGTATTCTACTTGTAATAAAAACAAGGATAATAATAATGAAGTACTTGCAACTCACAAAAACACTGTTTCGCTTAAGTGATACACTCTGCTTGCATATCGATGATTTAACTATCAATGAAGGAGAAAGTTGGGCATTCGTTGGTAGCAATGGTAGTGGTAAAACGGCGCTCGCTAATACATTATGCCAAGAGGGGATTTTATTATCGGGTGAGCTTATTAATAGGTTTACTCGTCCGATTAATCTCTCTTTTGAAAAATTACAAAAAATGATAGAGGAAGAGTGGCTGCGTAACAATACAGACTTATTAAGTGAAGATGAGGATGATACGGGATTAACCGTGGCTCAGGTGATCCAAATGCAGGTAAAAGATAATGATCGCTGCCTGTTATTAGCAAAACAATTTGGTATTGATGCACTTTTATCAAGGCGTTTTAAATATCTTTCAACGGGAGAGTCTCGTAAGGTACTGCTTATTCAGTTATTGATGAATAAACCTGATCTATTAATTTTAGATGAGCCTTTTGATGGTTTAGATATTGACTCTCGTCGTACATTAAGTGAGTTACTTTCATCACTACATCAACAAAAGCTAACGATTGTTCTTATTTTAAATCGCTTTAATGATATTCCTGATTTTGTGCAAAATGCTGGCTTATTGATTGACTGTAAACTCGTGGCACAAGGTAAAAAAAGTGATATTTTATCAGACTCAGTAATTGCGCAATTATCTCACAGTGAAACACTTGAAAATCTGATCTTACCCGCCTCAGACTCCGTTGATGCAGTTCCTACCTTACCACCAACGCTTTCCCCTATTATACTTAAGGATGGCGTGGTCAGTTATAATGATAAACCTGTGCTCCATCACTTAACCTGGGAAGTTAAACCACAACAACATTGGCAAATATTAGGTCCTAATGGCGCAGGAAAATCGACCTTATTAAGCTTAATCACAGGAGATCATCCTCAAGGCTATAGCAATGATTTAACACTATTTGGTCGTAAAAGAGGCAGTGGTGAAACCATTTGGGAGATCAAACGCCATATTGGTTATGTTAGTAATGCCTTACATCAAAGCTATCGCGTCTCTTCAAGTGTGAAAAATGTGATTATTTCTGGTTTTCATGACTCTATTGGTATTTATCAAGCCGTTACCGATAAACAGCAAAAATTAGCGGATGAATGGCTAACACTAATTGGTTTAACTGCACTCGCTAACCATCCTTTTCACTCACTTTCATGGGGACAACAGCGTCTAGTATTAATTGTAAGAGCATTGGTTAAACACCCGACATTATTGATCCTCGATGAACCACTACAAGGATTAGATACAACCAATAGACTATTAGTACAGCGCTTTATTGATATCATGATAAGCCATAGCAATACTCAACTACTGTTTGTCAGTCATCATCAAGAAGATGCACCTCACTGTATTACCCATCGACTGATTTTTATTAAAGAAGGAGATATCTATCGTTACCAACAACAACCCTGTTAACTAGATATAGGCTATTTTTAAGGTAAGATACATCATCACACTGAAGAAAA