Homologs in group_3696

Help

2 homologs were identified in 2 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12535 FBDBKF_12535 40.2 Morganella morganii S1 rcnR Ni(II)/Co(II)-binding transcriptional repressor RcnR
F4V73_RS07765 F4V73_RS07765 42.5 Morganella psychrotolerans rcnR Ni(II)/Co(II)-binding transcriptional repressor RcnR

Distribution of the homologs in the orthogroup group_3696

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3696

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3Z549 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Shigella sonnei (strain Ss046)
Q1RFI6 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli (strain UTI89 / UPEC)
B1LIP2 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli (strain SMS-3-5 / SECEC)
P0AAP3 7.6e-30 104 57 0 91 1 frmR Transcriptional repressor FrmR Escherichia coli (strain K12)
B1J084 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AAP4 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKS6 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A836 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O1:K1 / APEC
A7ZX05 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O9:H4 (strain HS)
Q8X5J3 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O157:H7
A7ZIA5 7.6e-30 104 57 0 91 3 frmR Transcriptional repressor FrmR Escherichia coli O139:H28 (strain E24377A / ETEC)
P55757 7.46e-27 97 50 0 91 3 None Uncharacterized protein in bioA 5'region Serratia marcescens
Q57K94 3.99e-16 69 40 2 94 3 rcnR Transcriptional repressor RcnR homolog Salmonella choleraesuis (strain SC-B67)
Q3Z0A5 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Shigella sonnei (strain Ss046)
P64533 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR homolog Shigella flexneri
Q0T334 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Shigella flexneri serotype 5b (strain 8401)
Q32E99 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Shigella dysenteriae serotype 1 (strain Sd197)
Q1R9W7 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli (strain UTI89 / UPEC)
P64530 1.54e-15 68 39 2 94 1 rcnR Transcriptional repressor RcnR Escherichia coli (strain K12)
P64531 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFY7 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0C7I3 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli O1:K1 / APEC
A8A1X0 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli O9:H4 (strain HS)
P64532 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR Escherichia coli O157:H7
A7ZNS4 1.54e-15 68 39 2 94 3 rcnR Transcriptional repressor RcnR homolog Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7CPV3 2.87e-15 67 39 2 94 3 rcnR Transcriptional repressor RcnR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFV2 2.87e-15 67 39 2 94 3 rcnR Transcriptional repressor RcnR homolog Salmonella typhi
A9N3J4 2.87e-15 67 39 2 94 3 rcnR Transcriptional repressor RcnR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEQ5 2.87e-15 67 39 2 94 3 rcnR Transcriptional repressor RcnR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A9MRK3 3.31e-15 67 39 2 94 3 rcnR Transcriptional repressor RcnR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AP75 4.07e-15 67 45 1 77 3 rcnR Transcriptional repressor RcnR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
O32222 3.61e-07 47 25 1 88 1 csoR Copper-sensing transcriptional repressor CsoR Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02225
Feature type CDS
Gene frmR
Product formaldehyde-responsive transcriptional repressor FrmR
Location 519444 - 519719 (strand: -1)
Length 276 (nucleotides) / 91 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3696
Orthogroup size 3
N. genomes 3

Actions

Genomic region

Domains

PF02583 Metal-sensitive transcriptional repressor

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1937 Transcription (K) K DNA-binding transcriptional regulator, FrmR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K23239 FrmR/RcnR family transcriptional regulator, repressor of frmRAB operon - -

Protein Sequence

MPHSPAEKKAALTRVRKIKGQILALETALENENECGQVLQQIAAIRGAINGLMAGVLESHLREGLMDAVASPEDQKNSVDDAISLIRTYLR

Flanking regions ( +/- flanking 50bp)

TACATTCACGCTAATACTATACTCCCCCATAGTATAATTAAGGATTATGTATGCCACACTCACCAGCAGAAAAAAAAGCCGCGTTAACCCGTGTAAGAAAAATCAAAGGGCAAATTTTGGCATTAGAAACCGCCCTTGAAAACGAAAATGAATGCGGCCAAGTTTTACAGCAAATTGCTGCCATTCGGGGTGCTATCAATGGCCTGATGGCGGGCGTACTCGAAAGTCATTTACGTGAAGGTCTAATGGATGCCGTCGCTTCTCCTGAAGATCAAAAAAACTCCGTTGATGATGCAATCTCACTAATACGCACTTACCTGCGCTAATAACAACAAGGATATCATTATGAAATCTCGTGCTGCGGTCGCCTTTGGAC