Homologs in group_1568

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10160 FBDBKF_10160 83.5 Morganella morganii S1 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
EHELCC_04960 EHELCC_04960 83.5 Morganella morganii S2 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
NLDBIP_04960 NLDBIP_04960 83.5 Morganella morganii S4 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
LHKJJB_13670 LHKJJB_13670 83.5 Morganella morganii S3 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
HKOGLL_12865 HKOGLL_12865 83.5 Morganella morganii S5 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
F4V73_RS00180 F4V73_RS00180 82.2 Morganella psychrotolerans proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV

Distribution of the homologs in the orthogroup group_1568

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1568

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
E0SCY1 0.0 622 73 0 396 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
P14175 0.0 611 73 0 398 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
P17328 0.0 610 72 0 398 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P46920 1.22e-133 392 50 2 390 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q9KIF7 6.37e-129 380 48 1 392 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q9RR46 1.91e-119 355 47 7 404 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q4FL37 3.44e-88 273 47 2 282 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q5LT65 3.34e-84 263 48 1 277 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q45460 1.04e-65 217 35 7 354 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
O34992 5.22e-64 212 33 6 356 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q49W48 1.31e-61 205 44 1 225 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q4L4R9 3.42e-61 204 44 1 225 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q8CTB2 2.31e-60 201 43 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQQ9 4.82e-60 201 43 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8ZPK4 3.68e-59 199 34 8 359 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KHT9 7.84e-59 199 32 6 351 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 7.84e-59 199 32 6 351 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q88UV2 2.63e-58 196 46 2 231 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q2YWP2 3.43e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXH5 4.88e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 4.88e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 4.88e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 4.88e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 4.88e-58 196 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q6GIH9 8.22e-58 195 42 1 225 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q7A6M2 1.45e-57 194 42 1 225 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 1.45e-57 194 42 1 225 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
P14788 7.74e-57 192 39 2 265 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5LYN4 2.83e-56 192 41 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q03JH1 3.21e-56 192 41 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M397 3.46e-56 192 41 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q832Y6 1.36e-55 189 44 1 224 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q82TL6 2e-55 189 41 1 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q0AU85 4.76e-55 188 36 5 289 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2SJY7 6.76e-55 188 40 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q9K789 7.56e-55 187 41 1 232 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q831K6 9.7e-55 187 41 1 236 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q5KVK2 1.01e-54 187 41 2 244 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q0AGF4 2.95e-54 186 39 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7VNG4 4.67e-54 186 40 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q6HP89 4.77e-54 185 40 2 245 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 5.54e-54 185 40 2 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81IN8 6.29e-54 185 40 2 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73EL7 7.54e-54 184 40 2 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63GR8 1.16e-53 184 40 2 245 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8RFN2 1.67e-53 184 41 2 236 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q73F11 1.9e-53 184 38 3 249 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q38WL5 2.26e-53 183 40 2 246 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q9CP06 2.47e-53 184 40 1 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
A0LUE6 2.82e-53 184 40 2 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q4QK57 4.7e-53 183 39 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q81IZ6 6.37e-53 182 37 3 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88AS5 1.42e-52 181 41 3 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A0A0H2ZLL3 1.43e-52 178 40 2 226 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8DUF7 1.69e-52 182 40 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
O32169 1.79e-52 181 42 1 232 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q815Y7 1.87e-52 181 40 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63H29 1.88e-52 181 37 3 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q92EZ6 1.91e-52 181 42 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P45171 1.94e-52 182 39 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q724C0 1.99e-52 181 42 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q72Y96 2.06e-52 181 40 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q74K65 3.15e-52 181 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q79EE4 3.25e-52 181 38 2 246 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8YA75 3.27e-52 180 42 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3A9G5 3.58e-52 180 41 2 246 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0I3Y9 3.85e-52 181 34 5 300 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q81GU1 4.31e-52 181 39 2 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8DIA0 4.45e-52 180 39 2 253 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q81VM2 4.72e-52 180 37 3 257 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q0SFW6 5.91e-52 179 42 2 227 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q631Y4 8.43e-52 179 39 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q81XL3 8.43e-52 179 39 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q8F6Z1 9.48e-52 179 37 2 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 9.48e-52 179 37 2 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q92WJ0 1.03e-51 179 39 1 232 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q88CL2 1.09e-51 179 42 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9I6L0 1.15e-51 179 36 7 317 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1WVG9 1.26e-51 179 42 2 230 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q6HBS0 1.34e-51 179 39 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q1J6Q6 1.5e-51 180 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 1.5e-51 180 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 1.5e-51 180 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 1.5e-51 180 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q21BU8 1.53e-51 179 34 4 312 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q98HF7 1.64e-51 179 36 5 306 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q830W6 1.66e-51 179 40 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q2K8C8 1.77e-51 179 39 1 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8Z0H0 1.86e-51 178 36 2 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q5XCA4 2.17e-51 179 38 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 2.26e-51 179 38 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 2.26e-51 179 38 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 2.26e-51 179 38 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
O31339 2.27e-51 179 39 2 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q65F80 2.28e-51 178 41 4 244 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6D201 2.51e-51 177 41 2 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5WDP1 2.8e-51 178 40 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q7MKU3 2.94e-51 179 40 1 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 2.94e-51 179 40 1 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q8EPK1 3.33e-51 177 39 1 228 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65UE1 3.33e-51 179 38 1 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9KS33 4.83e-51 178 37 1 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7CN92 5.14e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 5.14e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
O85818 5.39e-51 178 38 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q7CHF8 5.44e-51 177 42 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 5.44e-51 177 42 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 5.44e-51 177 42 3 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 5.44e-51 177 42 3 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8E8K8 5.56e-51 177 39 2 244 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q03Z27 6.03e-51 177 38 3 247 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q043Y8 6.18e-51 177 39 3 245 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8DPC2 6.23e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 6.23e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 6.23e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q160M2 6.25e-51 177 40 1 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q6HLQ9 6.41e-51 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63E84 6.41e-51 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 6.41e-51 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 6.41e-51 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q8Y0X3 6.83e-51 177 41 1 222 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A3CMQ7 7.3e-51 178 39 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q042G7 7.73e-51 177 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q6NJ07 9.67e-51 176 41 3 234 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q81TH8 1.11e-50 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q87UN4 1.13e-50 176 40 2 220 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q81GC1 1.14e-50 176 42 2 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O83658 1.23e-50 177 38 1 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q9A502 1.25e-50 176 41 1 223 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q664X5 1.41e-50 177 37 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 1.41e-50 177 37 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 1.41e-50 177 37 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 1.41e-50 177 37 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q03AH0 1.43e-50 177 40 1 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q88RL5 1.88e-50 176 40 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1MQ44 2.03e-50 176 40 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q8ELQ6 2.57e-50 175 41 1 225 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5X627 2.64e-50 176 37 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q6F9P2 2.74e-50 175 41 1 226 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q03ZQ0 3e-50 176 39 2 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03P57 3.17e-50 176 39 2 235 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q04G50 3.19e-50 176 36 3 280 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q30V33 3.39e-50 176 37 2 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8YCG3 3.67e-50 175 36 2 249 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P33360 4.16e-50 174 39 5 252 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q1GIE5 4.19e-50 176 35 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q8DFC3 4.23e-50 175 41 1 224 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q4ZZR8 4.25e-50 174 40 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q8U6M1 4.29e-50 175 36 2 264 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7MN25 4.46e-50 175 41 1 224 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q9X196 4.53e-50 176 38 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q0BMC9 5.08e-50 175 42 1 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 5.08e-50 175 42 1 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q8ENU2 5.7e-50 174 41 3 230 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6MU19 5.79e-50 175 37 1 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5FKL2 6.08e-50 175 38 2 236 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q110U3 6.12e-50 176 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q6AE21 6.35e-50 174 40 1 217 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q5ZWE4 6.39e-50 175 36 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q02R79 6.65e-50 175 39 1 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3BNZ3 6.9e-50 174 41 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
P56344 7.05e-50 171 37 1 234 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q9HY19 7.78e-50 175 39 1 228 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT70 7.92e-50 174 40 2 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 7.92e-50 174 40 2 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q48PU6 7.92e-50 174 40 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4L5B3 8.15e-50 175 40 1 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q7NQN5 8.5e-50 174 35 2 261 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8PGE8 9.18e-50 174 41 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q5NFU5 1.03e-49 174 42 1 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q87AL9 1.03e-49 174 41 1 221 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q2SSS4 1.03e-49 174 37 1 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q32EY4 1.04e-49 175 34 4 308 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q8P4S7 1.2e-49 173 41 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 1.2e-49 173 41 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q2YAD6 1.22e-49 174 37 1 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q60AI1 1.28e-49 175 38 2 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q14H97 1.4e-49 174 42 1 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q1RD28 1.42e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.42e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
P69877 1.48e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.48e-49 174 35 4 304 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.48e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.48e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.48e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q47T99 1.52e-49 174 38 3 253 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q3Z2Z3 1.62e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.62e-49 174 35 4 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
O51587 1.69e-49 173 37 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A3DDF6 1.8e-49 173 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q1GB17 1.82e-49 174 38 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7N986 1.96e-49 174 39 1 227 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q87PH3 1.99e-49 174 37 1 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q578K3 2.14e-49 173 36 2 249 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 2.14e-49 173 36 2 249 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q7AH43 2.21e-49 173 35 1 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q5L222 2.42e-49 173 37 1 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5WXF0 2.46e-49 173 36 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q660M8 2.72e-49 173 36 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0T5R2 3.23e-49 174 39 2 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q8XZP8 3.57e-49 173 38 2 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0RAT5 3.75e-49 176 39 4 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8DZJ0 4.45e-49 173 37 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 4.45e-49 173 37 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 4.45e-49 173 37 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q9YGA6 4.75e-49 173 36 0 238 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q04BG2 4.96e-49 172 38 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1AS06 4.96e-49 173 38 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q0SML1 5.12e-49 172 36 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q5FL41 5.16e-49 172 37 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8FRX8 5.17e-49 172 37 2 249 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5E586 5.22e-49 173 32 4 311 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0PY57 5.45e-49 172 35 3 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q57855 5.85e-49 169 38 4 239 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8Y8T6 7.33e-49 172 35 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q49WM4 7.6e-49 172 36 2 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1WVI7 7.63e-49 172 38 1 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q07LR5 9.88e-49 172 34 5 305 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q92VJ2 1.01e-48 172 39 2 225 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q72FW5 1.09e-48 172 37 2 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8NSN2 1.18e-48 171 38 1 229 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q1IGZ0 1.34e-48 171 39 2 220 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q7N6Z2 1.6e-48 171 38 3 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q74IV9 1.61e-48 171 37 3 249 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q6LN52 1.76e-48 171 41 1 224 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q3KK97 1.84e-48 170 39 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q6N9W0 1.93e-48 171 38 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q7A169 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 2.13e-48 171 39 1 213 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 2.13e-48 171 39 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q8YM92 2.32e-48 171 35 2 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6LR20 2.35e-48 171 38 4 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q87RS1 2.38e-48 170 36 2 262 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3MAR5 2.56e-48 171 35 2 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q65QT6 2.63e-48 171 40 3 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4K681 2.66e-48 171 40 2 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6D4E2 2.97e-48 171 38 1 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8RI39 3.42e-48 171 39 4 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5PMK1 3.59e-48 171 39 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q4QMH4 3.69e-48 170 40 1 224 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q9I6T2 3.75e-48 171 39 2 227 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HQ70 3.76e-48 170 35 2 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8Z7H7 3.78e-48 171 39 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q7VM95 3.91e-48 170 38 1 225 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P44785 4.18e-48 170 40 1 224 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40790 4.2e-48 171 39 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 4.2e-48 171 39 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q38VW6 4.63e-48 170 35 3 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q4KKK8 4.87e-48 169 39 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q88WA5 5.29e-48 170 40 2 225 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q13VD7 5.54e-48 169 39 1 223 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q2P7S3 5.82e-48 169 40 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5M5Z2 6.26e-48 169 32 7 343 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M1F6 6.46e-48 169 32 7 343 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q04DA7 6.58e-48 169 41 3 229 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P74548 6.74e-48 169 35 1 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WQI3 7.01e-48 170 39 1 222 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 7.01e-48 170 39 1 222 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5H503 7.19e-48 169 40 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q1MCN6 7.4e-48 170 38 1 226 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2K4V4 7.48e-48 170 38 1 221 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9KTJ5 7.93e-48 169 40 1 224 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1BY14 8.27e-48 169 39 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 8.27e-48 169 39 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
P37009 8.3e-48 169 35 1 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8CQS7 8.35e-48 169 37 2 240 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 8.35e-48 169 37 2 240 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q82WT5 8.41e-48 169 38 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q3KJS6 8.68e-48 169 39 4 252 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
P63354 8.88e-48 169 39 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 8.88e-48 169 39 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FVV5 9.68e-48 169 35 2 249 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q3KBH4 1.07e-47 169 38 1 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q04F14 1.09e-47 169 39 1 222 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A0AGP9 1.13e-47 169 34 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q1JII9 1.14e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q722B1 1.15e-47 169 34 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
P0CZ31 1.19e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 1.19e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1JNE0 1.2e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 1.2e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8G5P8 1.33e-47 170 39 2 249 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q47RE8 1.33e-47 167 41 1 224 3 metN Methionine import ATP-binding protein MetN Thermobifida fusca (strain YX)
Q6MCV4 1.33e-47 169 35 1 237 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q5XDS8 1.35e-47 169 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q24QI5 1.62e-47 168 39 1 228 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q7N8B9 1.91e-47 168 35 1 238 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1J8E4 1.94e-47 168 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q88ZJ6 1.97e-47 168 38 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q9PF03 2.12e-47 167 40 2 221 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q71X09 2.34e-47 167 39 1 227 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
O32151 2.34e-47 168 38 1 221 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q48V78 2.64e-47 168 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 2.64e-47 168 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q39IE7 2.66e-47 167 39 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9MUN1 2.7e-47 167 39 1 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q928L8 2.71e-47 167 39 1 227 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5WKL3 2.74e-47 167 38 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q9CGD4 2.75e-47 170 36 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q0I2Z4 2.98e-47 167 36 1 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q4JTG9 2.98e-47 168 39 2 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
A1JIE0 3.19e-47 168 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8EBC3 3.2e-47 168 38 3 242 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8CPN0 3.21e-47 168 35 2 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q24XJ2 3.47e-47 167 38 2 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
P77795 3.6e-47 167 38 2 231 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q92DL6 3.78e-47 168 34 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P31134 4.09e-47 168 40 2 230 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
A1TAI4 4.55e-47 167 38 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q02Z10 5.37e-47 169 36 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q89UD2 5.74e-47 167 38 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8UBB7 5.79e-47 167 35 4 271 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
P9WQM1 5.81e-47 167 37 1 232 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 5.81e-47 167 37 1 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 5.81e-47 167 37 1 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q01937 6.08e-47 167 39 2 222 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q9JUX4 6.23e-47 167 38 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8Y4L8 6.62e-47 166 39 1 227 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
D4GP38 6.91e-47 167 39 3 240 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q66FU4 6.93e-47 167 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q92XW1 7.23e-47 166 38 2 223 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q8P2K6 7.47e-47 167 38 4 255 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5E715 7.54e-47 166 39 1 225 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KLQ5 7.64e-47 166 35 1 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1QE80 8.05e-47 168 38 3 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q7VI92 8.48e-47 166 38 4 240 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q0BH79 9.02e-47 166 39 1 228 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q64SQ6 9.27e-47 169 33 2 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q9JZW0 1.04e-46 166 38 4 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5LBT4 1.29e-46 169 38 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q04B25 1.31e-46 166 41 3 232 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8A883 1.38e-46 169 38 2 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q1GAN9 1.39e-46 166 41 3 232 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q9CM80 1.43e-46 166 36 1 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q65VG9 1.6e-46 166 38 2 239 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8GEH7 1.64e-46 165 40 2 226 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q00752 1.65e-46 166 38 3 248 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1B8V9 1.66e-46 167 37 1 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.66e-46 167 37 1 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q2SY12 1.68e-46 166 38 2 237 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q6D5H7 1.76e-46 165 42 1 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D734 2.01e-46 166 31 3 297 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7VV72 2.05e-46 166 38 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.05e-46 166 38 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.05e-46 166 38 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8X6U5 2.06e-46 166 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
P27675 2.51e-46 162 40 5 225 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
P10907 2.54e-46 165 38 1 227 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q31VH5 2.59e-46 165 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q3YW77 2.65e-46 165 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
P44531 3.01e-46 164 36 1 226 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7N8M2 3.01e-46 165 34 4 266 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1CNC6 3.14e-46 165 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 3.14e-46 165 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 3.14e-46 165 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q9K876 3.14e-46 165 37 2 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q63S19 3.32e-46 165 37 2 237 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 3.32e-46 165 37 2 237 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 3.32e-46 165 37 2 237 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
P77481 3.41e-46 165 37 1 244 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q8X8K4 3.52e-46 165 37 1 244 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q6D3Q6 3.81e-46 164 40 4 237 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q98G42 3.88e-46 165 38 1 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q93DA2 3.97e-46 165 33 7 327 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
D8KFN1 4.07e-46 165 36 3 248 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 4.07e-46 165 36 3 248 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q0TC10 4.87e-46 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R5H8 4.97e-46 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 4.97e-46 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q8FCQ2 5.08e-46 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q65T42 5.67e-46 164 37 2 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8Z245 5.76e-46 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
Q1LQF6 5.98e-46 164 39 1 228 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q65S66 6.05e-46 164 36 1 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5ZUG5 6.58e-46 164 42 3 219 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q668K6 6.93e-46 164 37 3 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q9CIN4 7.39e-46 164 36 3 248 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q6G2E2 7.54e-46 164 35 6 283 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q6A6X6 7.82e-46 164 36 1 229 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6N798 8.01e-46 164 40 4 231 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8FHR3 8.06e-46 164 36 1 244 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q93DX8 8.26e-46 161 35 3 244 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q8ZLF4 8.4e-46 164 38 1 227 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6CZ34 8.79e-46 164 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2KVK2 8.9e-46 164 36 5 265 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
Q7WGW1 9.58e-46 164 37 4 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q5WVL8 1.06e-45 163 41 3 219 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q57IS3 1.06e-45 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
A1TXH7 1.07e-45 164 31 8 362 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q0TI47 1.1e-45 164 36 1 244 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9L1C3 1.15e-45 163 38 6 250 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8E3S0 1.21e-45 164 39 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q827Y0 1.29e-45 163 38 3 227 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8RQL7 1.31e-45 160 40 4 219 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9G4F5 1.34e-45 163 35 4 271 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q7W9U5 1.4e-45 163 36 3 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q032A0 1.46e-45 164 36 3 248 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q03A07 1.54e-45 163 39 3 230 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q1RC47 1.58e-45 163 36 1 244 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q5LT05 1.63e-45 163 37 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9Z3R9 1.72e-45 163 38 2 222 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q8DY54 1.9e-45 163 39 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.9e-45 163 39 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q14Q07 1.95e-45 163 35 4 260 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
A3PRY1 2.16e-45 162 38 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q146E7 2.18e-45 160 37 3 243 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
P54933 2.53e-45 162 36 1 228 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q5YZY9 2.57e-45 162 38 1 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
P94360 2.66e-45 163 37 1 222 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q87DT9 2.72e-45 162 37 3 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q73XU8 2.73e-45 163 37 1 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8FV85 2.8e-45 163 38 3 232 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 2.8e-45 163 38 3 232 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 2.8e-45 163 38 3 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 2.8e-45 163 38 3 232 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q7VZE5 2.88e-45 162 36 3 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5PID0 3.1e-45 162 35 4 261 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PJL1 3.22e-45 162 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q6F9A8 3.23e-45 162 37 2 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8UH62 3.26e-45 162 36 2 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7NX01 3.44e-45 162 39 2 228 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8D0W8 3.44e-45 162 37 3 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q1BR30 3.73e-45 163 37 4 250 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 3.73e-45 163 37 4 250 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q134N9 3.93e-45 162 37 1 227 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q6NBT1 4.45e-45 162 38 3 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
O26096 4.48e-45 161 37 1 216 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
Q9CK97 4.64e-45 162 36 2 235 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q5WJP0 4.64e-45 161 38 1 233 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q6LKD4 4.83e-45 162 35 1 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q7NIW1 4.84e-45 162 35 1 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q32JQ8 4.92e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q609Q1 4.94e-45 162 36 2 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5X484 5.21e-45 161 41 3 219 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q8D954 5.73e-45 162 37 1 223 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
Q39CJ6 6.01e-45 159 36 3 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q7A7E3 6.1e-45 161 37 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 6.1e-45 161 37 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7MLB8 6.71e-45 162 37 1 223 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q3JHC9 6.76e-45 162 36 6 269 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain 1710b)
Q6F0V4 6.81e-45 161 35 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q7MFC4 6.84e-45 162 37 1 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 6.84e-45 162 37 1 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q53I83 7.24e-45 161 38 2 224 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q6GJL2 7.37e-45 161 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q8Z990 7.41e-45 161 35 4 261 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhi
P30750 7.65e-45 161 36 2 238 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q3Z5F8 8.06e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 8.06e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 8.06e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 8.06e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q1CR30 8.96e-45 160 36 2 230 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q0TLD2 9.05e-45 161 36 2 238 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q46Y69 9.46e-45 161 37 2 251 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9L0Q1 1.01e-44 162 37 1 222 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q12B04 1.03e-44 161 38 1 228 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q5HIL5 1.03e-44 160 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 1.03e-44 160 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 1.03e-44 160 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q8ELR4 1.04e-44 161 35 2 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q65M34 1.04e-44 160 34 2 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q57293 1.05e-44 161 38 1 202 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q3IX40 1.09e-44 160 37 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q4ZZK0 1.15e-44 161 39 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. syringae (strain B728a)
Q5PCG9 1.2e-44 160 40 1 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9KL04 1.31e-44 161 37 1 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q325U1 1.42e-44 160 36 2 238 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q57T09 1.45e-44 160 35 4 261 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q28QL7 1.51e-44 160 37 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q8FVT0 1.54e-44 160 36 1 226 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q7W6G5 1.65e-44 160 37 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q2YKZ7 1.66e-44 160 36 1 226 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.66e-44 160 36 1 226 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q62B84 1.69e-44 161 36 6 269 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia mallei (strain ATCC 23344)
Q13LD8 1.77e-44 161 39 5 246 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q0I5E9 1.78e-44 160 36 3 242 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q63NI4 1.84e-44 161 36 6 269 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia pseudomallei (strain K96243)
Q87GB5 1.89e-44 160 37 1 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8ZRM9 2.58e-44 159 35 4 261 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZJ34 2.81e-44 159 37 1 216 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
O34900 2.82e-44 157 33 5 280 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q9KUI0 3.01e-44 160 37 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q48PN3 3.1e-44 160 39 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4KK46 3.13e-44 160 39 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7VYN2 3.58e-44 160 37 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q8RGC8 3.88e-44 160 37 2 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7WID6 3.94e-44 160 37 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8Z8R5 3.95e-44 159 39 1 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
P73265 4.27e-44 157 39 2 203 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8NY21 5.46e-44 159 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 5.46e-44 159 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q87UV4 5.8e-44 159 38 1 229 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q6LK87 5.99e-44 159 36 1 220 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q2YVT7 6.13e-44 159 37 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02030
Feature type CDS
Gene proV
Product glycine betaine/L-proline ABC transporter ATP-binding protein ProV
Location 479797 - 480996 (strand: -1)
Length 1200 (nucleotides) / 399 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1568
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00571 CBS domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4175 Amino acid transport and metabolism (E) E ABC-type proline/glycine betaine transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02000 glycine betaine/proline transport system ATP-binding protein [EC:7.6.2.9] ABC transporters -

Protein Sequence

MAIKLEVKNLYKIFGEHPKRAFELLGSGMNKDQIFDKTGLTVGVQNANLAIEEGEIFVIMGLSGSGKSTLVRLLNRLIDPTKGEVLIDGENITTMSDKDLRQVRRKKISMVFQSFALMPHMNVLDNTAFGMELAGISKEERYEKAMAALEQVNLSSHAQSWPDELSGGMRQRIGLARALANDPDILLMDEAFSALDPLIRTEMQDELLSLQGDKQRTIVFISHDLDEAMRIGDRIAIMQGGVVVQIGTPDEILNNPANDYVRTFFRGVDISHVFSAKDIAKRRPETLLHIAPGFGPRSALKVLEDEDRNFGYLIERGRKFAGIVSVTSLEEALKAKQPIGSAILTEPCAINGDTPLNELISTVAQSPCAIPVIDEKNRYIGLISKGMLLQALDKETPNE

Flanking regions ( +/- flanking 50bp)

TTAACATTTAATTTATTCCTTTCATATTTAAATAGGAAAATAGATATTGCATGGCAATTAAACTCGAAGTAAAAAACCTATATAAAATATTTGGTGAGCACCCTAAACGGGCCTTTGAATTATTAGGATCTGGTATGAACAAAGACCAAATCTTTGATAAAACAGGGTTAACCGTTGGTGTGCAAAATGCCAATCTGGCCATTGAAGAAGGCGAAATATTTGTCATCATGGGATTATCAGGCTCTGGTAAATCTACATTAGTGCGCCTTCTCAATCGTCTGATAGATCCCACTAAAGGCGAAGTCCTTATTGATGGTGAAAACATCACCACCATGTCTGATAAAGATTTACGACAAGTTCGACGTAAAAAAATCAGTATGGTGTTTCAATCATTCGCTTTAATGCCTCATATGAATGTACTCGATAATACAGCATTTGGTATGGAGCTTGCAGGCATTAGCAAAGAAGAGCGCTATGAAAAAGCCATGGCAGCATTAGAGCAAGTTAACTTAAGCTCTCATGCTCAATCTTGGCCGGATGAGTTATCCGGTGGGATGCGACAACGTATTGGGCTTGCTCGTGCACTGGCCAATGATCCTGATATCTTATTAATGGATGAGGCATTCTCCGCACTTGACCCATTAATCCGAACAGAAATGCAAGATGAGTTATTGAGCTTACAAGGTGATAAACAACGCACCATTGTGTTTATTTCTCATGATCTGGATGAAGCCATGCGTATTGGTGATCGTATCGCGATTATGCAAGGCGGTGTGGTGGTACAAATCGGTACCCCTGATGAAATTCTTAATAACCCAGCCAATGATTATGTACGTACCTTCTTCCGTGGCGTTGATATCAGTCATGTATTTAGCGCTAAAGATATTGCTAAACGTCGCCCAGAAACACTACTGCATATTGCGCCAGGTTTTGGTCCCCGTTCAGCATTAAAAGTACTGGAAGATGAAGATAGAAACTTTGGTTATTTAATTGAGCGAGGACGGAAATTTGCAGGTATTGTTTCTGTCACTTCTCTTGAAGAAGCATTAAAAGCGAAGCAACCTATTGGATCCGCTATTTTAACTGAACCTTGTGCGATTAATGGTGATACACCATTAAATGAACTGATTTCTACTGTTGCGCAATCTCCCTGTGCGATCCCTGTTATTGATGAAAAAAACCGTTATATCGGTTTAATTTCGAAAGGAATGTTGTTACAAGCACTGGATAAGGAGACACCAAATGAGTAAGACAAATAACCAAGCCAATCCTTGGGAAACGGACACTCAAGAAGCGGCAA