Homologs in group_1616

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_04960 EHELCC_04960 100.0 Morganella morganii S2 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
NLDBIP_04960 NLDBIP_04960 100.0 Morganella morganii S4 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
LHKJJB_13670 LHKJJB_13670 100.0 Morganella morganii S3 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
HKOGLL_12865 HKOGLL_12865 100.0 Morganella morganii S5 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
F4V73_RS00180 F4V73_RS00180 95.3 Morganella psychrotolerans proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV
PMI_RS02030 PMI_RS02030 83.5 Proteus mirabilis HI4320 proV glycine betaine/L-proline ABC transporter ATP-binding protein ProV

Distribution of the homologs in the orthogroup group_1616

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1616

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
E0SCY1 0.0 624 75 0 396 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
P14175 0.0 622 76 0 398 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
P17328 0.0 619 76 0 398 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KIF7 2.45e-133 391 50 1 392 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
P46920 5.29e-133 390 50 1 390 1 opuAA Glycine betaine transport ATP-binding protein OpuAA Bacillus subtilis (strain 168)
Q9RR46 1.61e-120 358 47 5 391 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q4FL37 8.72e-87 270 46 1 278 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q5LT65 5.03e-85 265 44 3 334 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
O34992 1.29e-65 216 36 7 358 1 opuCA Glycine betaine/carnitine/choline transport ATP-binding protein OpuCA Bacillus subtilis (strain 168)
Q45460 1.41e-65 216 35 7 358 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q9KHT9 1.03e-64 214 34 7 365 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 1.03e-64 214 34 7 365 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q4L4R9 1.86e-61 204 43 2 242 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q49W48 1.03e-60 202 43 1 230 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HQQ9 5.62e-59 198 41 2 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q82TL6 5.84e-59 199 41 1 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
O85818 4.19e-58 197 40 2 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q8CTB2 4.68e-58 196 40 2 242 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q831K6 5.45e-58 196 43 1 230 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q4QK57 1.26e-57 195 41 2 250 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q6HP89 1.33e-57 194 43 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81ZF5 1.51e-57 194 43 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81IN8 1.54e-57 194 43 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0AGF4 2.69e-57 194 39 1 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q2YWP2 2.92e-57 194 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXH5 3.81e-57 193 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 3.81e-57 193 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 3.81e-57 193 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 3.81e-57 193 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 3.81e-57 193 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q88UV2 4.11e-57 193 46 1 228 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P45171 4.62e-57 194 40 2 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q73EL7 4.77e-57 193 42 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6GIH9 7.38e-57 192 41 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q63GR8 8.03e-57 192 42 2 241 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q8ZPK4 1.02e-56 193 33 8 367 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q7A6M2 1.17e-56 192 41 1 230 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 1.17e-56 192 41 1 230 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9CP06 1.44e-56 192 40 2 255 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q8EPK1 2.01e-56 191 41 1 238 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2SJY7 2.22e-56 192 42 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q65F80 2.51e-56 191 45 3 236 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q98HF7 2.62e-56 192 38 5 306 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5LYN4 3.53e-56 192 43 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q03JH1 3.76e-56 192 43 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q9K789 3.98e-56 191 43 1 232 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5M397 4.28e-56 192 43 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q815Y7 5.93e-56 190 42 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q72Y96 7.58e-56 190 42 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9I6L0 8.22e-56 189 37 7 325 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P14788 1.22e-55 189 39 2 253 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q6D201 1.94e-55 188 40 2 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D734 1.96e-55 189 35 3 298 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q0I3Y9 1.99e-55 190 37 3 270 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q7VNG4 2.46e-55 189 39 3 262 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8DIA0 2.67e-55 188 40 2 263 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q631Y4 2.83e-55 188 42 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q81XL3 2.83e-55 188 42 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q6HBS0 5.3e-55 187 42 1 230 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P74548 6e-55 188 40 1 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q60AI1 7.97e-55 188 42 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8F6Z1 9.21e-55 187 38 2 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 9.21e-55 187 38 2 249 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q38WL5 9.96e-55 187 43 1 222 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q65UE1 1.11e-54 188 39 2 245 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O32169 1.31e-54 187 44 3 236 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q81GU1 1.57e-54 187 41 4 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q88CL2 2.06e-54 186 43 3 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P33360 2.47e-54 185 40 4 261 1 yehX Glycine betaine uptake system ATP-binding protein YehX Escherichia coli (strain K12)
Q8RFN2 2.63e-54 186 42 2 235 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q74K65 2.86e-54 186 41 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q832Y6 4.02e-54 186 42 1 224 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q7NQN5 4.92e-54 186 35 2 291 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3BNZ3 4.98e-54 185 44 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGE8 5.03e-54 185 44 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
P56344 5.28e-54 182 38 1 234 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q87AL9 5.6e-54 185 43 1 221 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q88AS5 5.74e-54 184 41 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2K8C8 5.81e-54 185 37 2 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1GIE5 8.06e-54 186 36 5 290 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q5KVK2 8.69e-54 184 40 2 244 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
O31339 9.13e-54 185 40 4 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6F9P2 1.16e-53 184 41 2 240 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8U6M1 1.46e-53 184 36 2 271 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8P4S7 1.47e-53 184 43 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UQD2 1.47e-53 184 43 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas campestris pv. campestris (strain 8004)
Q73F11 1.49e-53 184 39 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7MKU3 1.63e-53 185 41 3 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1.63e-53 185 41 3 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q2YAD6 1.66e-53 184 38 1 242 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7AH43 1.86e-53 184 37 1 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q5PMK1 2.49e-53 184 37 5 308 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1RD28 2.69e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 2.69e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q2P7S3 2.75e-53 183 43 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
P40790 2.83e-53 184 37 5 308 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 2.83e-53 184 37 5 308 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
P69877 2.89e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 2.89e-53 184 37 5 304 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 2.89e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 2.89e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 2.89e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q02R79 3e-53 184 38 3 292 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q32EY4 3.15e-53 184 36 5 308 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q0AU85 3.25e-53 183 38 4 268 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q3Z2Z3 3.28e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 3.28e-53 184 37 5 304 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
Q92WJ0 3.63e-53 183 39 1 233 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q9HY19 3.63e-53 184 38 3 292 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5H503 3.66e-53 182 43 1 223 3 metN Methionine import ATP-binding protein MetN Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q30V33 3.74e-53 184 38 5 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0T5R2 4.23e-53 184 37 6 307 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q5L222 6.17e-53 182 38 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q81GC1 6.23e-53 182 40 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9YGA6 6.45e-53 183 40 0 231 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q042G7 6.5e-53 183 41 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q8DZJ0 6.73e-53 183 40 3 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 6.73e-53 183 40 3 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 6.73e-53 183 40 3 246 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8YA75 6.81e-53 182 43 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q63H29 7e-53 182 39 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q5X627 7.81e-53 182 38 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q92EZ6 9.06e-53 182 43 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P31134 9.22e-53 183 40 3 252 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q160M2 9.22e-53 182 40 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q724C0 9.66e-53 182 43 2 231 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
Q81IZ6 1.01e-52 182 39 2 234 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8DUF7 1.11e-52 183 41 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A0LUE6 1.2e-52 182 40 2 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8E8K8 1.21e-52 182 41 2 238 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5WDP1 1.28e-52 181 41 1 230 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q8ELQ6 1.35e-52 181 42 1 225 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q9A502 1.36e-52 181 43 1 219 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q03AH0 1.4e-52 182 40 1 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q5E586 1.43e-52 182 33 6 337 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8Z7H7 1.44e-52 182 36 6 311 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
Q1WVG9 1.69e-52 181 43 2 230 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
Q8XZP8 1.74e-52 182 40 3 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q110U3 2.06e-52 182 40 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q81VM2 2.13e-52 181 39 2 241 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q1J6Q6 2.57e-52 182 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 2.57e-52 182 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 2.57e-52 182 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 2.57e-52 182 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q63E84 2.61e-52 180 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.61e-52 180 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.61e-52 180 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0A0H2ZLL3 2.63e-52 177 41 3 226 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6HLQ9 2.81e-52 180 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q82WT5 3.55e-52 181 39 2 241 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q8FRX8 3.99e-52 181 39 2 249 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P0CZ35 4.22e-52 181 40 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 4.22e-52 181 40 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
P0CZ34 4.22e-52 181 40 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5FL41 4.39e-52 181 37 2 261 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q9PF03 4.64e-52 180 43 2 221 3 metN Methionine import ATP-binding protein MetN Xylella fastidiosa (strain 9a5c)
Q7CN92 4.64e-52 181 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q99ZS8 4.64e-52 181 41 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q1GB17 4.68e-52 181 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5XCA4 4.69e-52 181 40 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q81TH8 4.88e-52 179 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q6NJ07 5.04e-52 180 43 1 217 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8Z0H0 6.64e-52 179 37 3 265 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q87PH3 6.85e-52 181 38 1 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q043Y8 7.37e-52 180 38 3 257 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5ZWE4 8.89e-52 180 37 2 248 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q92VJ2 9.88e-52 180 39 2 237 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
P37009 1.03e-51 179 36 1 232 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q8YCG3 1.16e-51 179 36 2 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6LR20 1.23e-51 180 34 4 307 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q1MCN6 1.24e-51 180 41 1 226 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q04BG2 1.29e-51 179 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q9I6T2 1.33e-51 179 39 3 256 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KS33 1.42e-51 180 39 2 234 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q0SFW6 1.76e-51 178 43 2 227 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q79EE4 1.78e-51 179 39 1 233 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8DPC2 2.12e-51 179 41 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.12e-51 179 41 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.12e-51 179 41 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q4K681 2.24e-51 179 42 2 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A3CMQ7 2.34e-51 179 41 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q1QE80 2.34e-51 180 42 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q9HT70 2.59e-51 178 40 5 253 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 2.59e-51 178 40 5 253 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5WXF0 2.64e-51 179 37 2 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
A0PY57 2.89e-51 178 34 3 284 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q48PU6 3.76e-51 177 41 2 221 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q74IV9 5.26e-51 177 37 3 267 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q04F14 5.29e-51 177 41 1 222 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q578K3 5.35e-51 177 36 2 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 5.35e-51 177 36 2 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
Q88RL5 6.31e-51 177 41 2 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5FKL2 6.54e-51 177 39 3 238 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8YM92 7.2e-51 178 37 1 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7MN25 8.03e-51 177 42 1 223 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q3MAR5 8.09e-51 178 37 1 256 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8DFC3 8.47e-51 177 42 1 223 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q72FW5 1.03e-50 177 40 3 247 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q47T99 1.06e-50 177 38 3 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q1AS06 1.11e-50 177 39 1 239 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q6D4E2 1.29e-50 177 38 1 241 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6AE21 1.38e-50 176 40 2 237 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q87UN4 1.4e-50 176 40 2 221 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A3DDF6 1.72e-50 176 39 1 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q7W9U5 1.79e-50 176 38 2 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q664X5 1.99e-50 176 38 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 1.99e-50 176 38 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 1.99e-50 176 38 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 1.99e-50 176 38 1 232 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q1MQ44 2.16e-50 176 39 2 231 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q7CHF8 2.71e-50 175 42 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis
Q1C970 2.71e-50 175 42 3 228 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66CQ3 2.71e-50 175 42 3 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CG91 2.71e-50 175 42 3 228 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Nepal516)
Q2K4V4 2.73e-50 176 40 2 221 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7WGW1 2.76e-50 176 38 2 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6MCV4 2.8e-50 176 36 1 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q7N8B9 2.91e-50 176 36 2 247 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8NSN2 2.94e-50 176 39 1 238 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7VZE5 3e-50 176 38 2 250 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VV72 3.55e-50 176 40 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 3.55e-50 176 40 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 3.55e-50 176 40 4 255 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q92XW1 3.73e-50 175 39 2 237 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q0RAT5 3.82e-50 178 38 2 267 3 potA Spermidine/putrescine import ATP-binding protein PotA Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q87RS1 3.96e-50 175 37 2 262 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KLQ5 3.99e-50 175 36 2 246 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q57855 4.6e-50 172 41 4 239 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5YZY9 4.62e-50 174 40 1 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q830W6 4.7e-50 175 39 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q71X09 5.35e-50 174 40 2 242 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q4ZZR8 6.6e-50 174 41 2 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
O32151 8.12e-50 175 39 2 233 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q24QI5 8.42e-50 174 40 1 227 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q928L8 8.88e-50 174 40 2 242 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A1TAI4 9.79e-50 175 38 1 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q4L5B3 9.93e-50 174 38 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q6A6X6 1.06e-49 174 38 2 238 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q6MU19 1.09e-49 174 38 1 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q8ENU2 1.15e-49 174 43 3 229 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q1B8V9 1.18e-49 175 36 2 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.18e-49 175 36 2 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q8Y4L8 1.25e-49 174 40 2 242 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1IGZ0 1.41e-49 173 40 2 219 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q21BU8 1.47e-49 174 39 1 231 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q03P57 1.57e-49 174 31 5 354 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q0BMC9 1.6e-49 174 41 2 238 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.6e-49 174 41 2 238 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q2SSS4 1.82e-49 173 37 1 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P63354 1.86e-49 174 41 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.86e-49 174 41 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q04G50 1.93e-49 174 39 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q6N9W0 2e-49 174 39 1 233 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P9WQM1 2.01e-49 173 38 1 233 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 2.01e-49 173 38 1 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 2.01e-49 173 38 1 233 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9KTJ5 2.41e-49 173 37 2 262 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6LKD4 2.5e-49 173 35 1 239 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q5NFU5 2.55e-49 173 41 2 238 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14H97 2.68e-49 173 41 2 238 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q1JII9 2.7e-49 173 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q9CIN4 2.76e-49 173 38 4 247 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q8FVV5 2.77e-49 173 35 2 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q1GAN9 2.9e-49 173 40 2 238 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q04B25 3.06e-49 173 40 2 238 3 metN Methionine import ATP-binding protein MetN Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q5XDS8 3.12e-49 173 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1BY14 3.14e-49 172 41 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 3.14e-49 172 41 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
P0CZ31 3.33e-49 173 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 3.33e-49 173 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q1J8E4 3.58e-49 173 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q6D3Q6 3.66e-49 172 41 2 238 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q49WM4 4.03e-49 173 39 1 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1JNE0 4.61e-49 172 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 4.61e-49 172 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q9G4F5 5e-49 172 39 2 238 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q8GEH7 5.19e-49 171 42 2 226 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q3J1N0 5.92e-49 172 41 4 238 3 metN Methionine import ATP-binding protein MetN Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q48V78 6.26e-49 172 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 6.26e-49 172 37 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q3KK97 6.33e-49 172 39 2 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
O83658 6.68e-49 173 40 2 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q8Y0X3 7.95e-49 172 40 2 233 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8UH62 8.89e-49 171 40 2 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q03ZQ0 9.37e-49 172 41 3 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q4JTG9 9.37e-49 172 41 2 227 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
D4GP38 9.74e-49 172 41 2 230 1 xacJ Xylose/arabinose import ATP-binding protein XacJ Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q6LN52 1.04e-48 171 41 1 223 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
Q07LR5 1.11e-48 172 39 2 243 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
Q8UBB7 1.11e-48 172 37 2 249 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q39IE7 1.21e-48 171 41 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3A9G5 1.28e-48 171 41 1 225 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q02ME3 1.3e-48 172 41 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q134N9 1.5e-48 172 38 3 263 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q98G42 1.64e-48 171 41 1 221 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P94360 1.67e-48 171 36 7 288 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
Q8EBC3 1.69e-48 172 39 2 241 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q88WA5 1.75e-48 171 41 2 224 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8P2K6 1.81e-48 171 36 6 279 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q609Q1 1.87e-48 171 36 5 274 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9X196 1.88e-48 171 38 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q89UD2 2.01e-48 171 38 4 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q00752 2.25e-48 171 39 4 248 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93DX8 2.58e-48 168 37 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q1LQF6 2.64e-48 170 41 1 228 3 metN Methionine import ATP-binding protein MetN Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7NIW1 2.78e-48 170 39 2 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7N8M2 2.92e-48 170 35 4 264 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N6Z2 3.22e-48 171 38 2 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q0BH79 3.44e-48 170 40 1 228 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1TXH7 3.5e-48 171 35 9 334 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q660M8 5.7e-48 169 35 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
P9WQI3 6.1e-48 171 38 3 236 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 6.1e-48 171 38 3 236 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7N986 6.23e-48 170 37 1 227 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A3PRY1 6.25e-48 169 40 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q3KJS6 6.25e-48 170 40 1 229 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q65QT6 8e-48 170 41 3 221 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9K876 8.52e-48 169 37 2 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q7A169 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 9.07e-48 169 38 1 213 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 9.07e-48 169 38 1 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q6NBT1 9.58e-48 169 40 3 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q13VD7 1.06e-47 169 39 1 227 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q65M34 1.08e-47 168 36 2 236 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O51587 1.08e-47 169 35 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q0SML1 1.11e-47 169 35 2 232 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q7NX01 1.16e-47 169 39 2 238 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1WVI7 1.25e-47 169 37 1 235 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q6N798 1.3e-47 169 40 4 243 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q4KKK8 1.35e-47 168 40 2 219 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7A7E3 1.35e-47 168 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 1.35e-47 168 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8G5P8 1.4e-47 170 42 1 221 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q5WKL3 1.54e-47 168 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q6GJL2 1.6e-47 168 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q8Z8R5 1.78e-47 168 40 1 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q3KBH4 1.86e-47 168 34 2 268 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
Q03Z27 1.95e-47 168 37 1 232 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q14Q07 2.1e-47 168 35 2 269 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q9I1C8 2.2e-47 169 41 4 243 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q46Y69 2.44e-47 167 40 1 228 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6F0V4 2.46e-47 168 38 1 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
D8KFN1 2.79e-47 168 37 4 247 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 2.79e-47 168 37 4 247 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q63TY1 2.83e-47 167 36 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q65S66 3.02e-47 167 36 1 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q62K82 3.08e-47 167 36 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q0I2Z4 3.12e-47 167 36 1 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q87DT9 3.28e-47 167 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8FV85 3.31e-47 168 40 4 241 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 3.31e-47 168 40 4 241 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 3.31e-47 168 40 4 241 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 3.31e-47 168 40 4 241 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q73XU8 3.32e-47 168 35 2 252 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8ZR89 3.48e-47 167 40 1 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Y8T6 3.85e-47 168 34 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6F9A8 4.12e-47 167 39 2 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3IX40 4.56e-47 167 39 1 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q5HIL5 5.14e-47 167 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 5.14e-47 167 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 5.14e-47 167 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q28QL7 5.29e-47 167 40 2 222 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
P77481 6.13e-47 167 40 1 221 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q5E715 6.15e-47 167 39 2 230 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8RI39 6.58e-47 167 41 2 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q03A07 7.35e-47 167 40 3 230 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q9CM80 8.05e-47 166 36 1 233 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q8X8K4 8.14e-47 167 40 1 221 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q2KVK2 8.28e-47 167 38 6 265 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
P54933 8.69e-47 166 38 1 230 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q146E7 9.54e-47 164 40 3 242 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q7VM95 9.57e-47 166 37 2 233 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q032A0 9.94e-47 167 37 4 247 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q4KK46 1.05e-46 167 40 4 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q722B1 1.13e-46 166 34 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q9CGD4 1.19e-46 168 37 1 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q57S53 1.28e-46 166 40 1 223 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q5PCG9 1.3e-46 166 40 1 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q2YVT7 1.34e-46 166 38 2 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9A7X1 1.56e-46 166 41 2 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P44785 1.62e-46 166 40 1 221 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FHR3 1.73e-46 166 39 1 221 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q02Z10 1.74e-46 167 37 2 230 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q4QMH4 1.75e-46 166 40 1 221 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q0TI47 1.83e-46 166 39 1 221 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q38VW6 1.94e-46 166 38 1 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
Q5HQ70 2.01e-46 166 36 1 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7NWX3 2.17e-46 166 37 2 247 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
O34900 2.18e-46 162 35 6 277 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q04DA7 2.57e-46 165 36 5 266 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q8Z245 2.67e-46 165 39 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhi
Q8ZLF4 2.69e-46 165 39 1 227 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0KDG3 2.71e-46 165 39 1 228 3 metN Methionine import ATP-binding protein MetN Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9PDN2 2.72e-46 165 38 3 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8NY21 2.83e-46 165 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 2.83e-46 165 38 1 226 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q12B04 2.98e-46 165 39 1 228 3 metN Methionine import ATP-binding protein MetN Polaromonas sp. (strain JS666 / ATCC BAA-500)
A0AGP9 3.01e-46 166 33 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q57IS3 3.15e-46 165 39 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella choleraesuis (strain SC-B67)
Q1RC47 3.15e-46 165 39 1 221 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q9JUX4 3.33e-46 165 37 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q1IGN4 3.54e-46 165 40 4 242 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q93DA2 4.48e-46 164 37 3 238 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9TKX3 4.86e-46 164 37 2 242 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q92DL6 5.13e-46 165 33 4 264 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P77795 5.13e-46 164 38 2 236 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q9JZW0 5.23e-46 164 37 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9KUI0 5.52e-46 165 39 3 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9L1C3 5.6e-46 164 40 6 248 3 metN Methionine import ATP-binding protein MetN Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P44531 5.81e-46 164 35 2 246 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5LT05 5.88e-46 165 38 1 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q88RB3 6.24e-46 165 40 1 226 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q57SD6 7.53e-46 164 36 3 247 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q827Y0 8.07e-46 164 39 6 248 3 metN Methionine import ATP-binding protein MetN Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9MUN1 9.78e-46 164 38 1 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q47RE8 1.07e-45 162 40 2 238 3 metN Methionine import ATP-binding protein MetN Thermobifida fusca (strain YX)
Q668K6 1.13e-45 164 37 3 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2SY12 1.24e-45 163 37 3 261 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q8A883 1.27e-45 166 32 2 296 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5PJL1 1.27e-45 164 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q01937 1.31e-45 164 39 2 222 3 lacK Lactose transport ATP-binding protein LacK Rhizobium radiobacter
Q8D954 1.32e-45 164 38 2 223 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain CMCP6)
A1JIE0 1.42e-45 164 37 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7MLB8 1.45e-45 164 38 2 223 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio vulnificus (strain YJ016)
Q6D5H7 1.5e-45 163 42 2 228 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8CPN0 1.55e-45 163 36 1 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8X6U5 1.82e-45 163 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O157:H7
Q67SV5 1.92e-45 162 39 5 244 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q3YW77 1.94e-45 163 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella sonnei (strain Ss046)
Q31VH5 2e-45 163 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Shigella boydii serotype 4 (strain Sb227)
Q8CQS7 2.08e-45 162 36 2 236 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 2.08e-45 162 36 2 236 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1VZQ5 2.11e-45 159 35 4 262 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P10907 2.17e-45 163 38 1 227 1 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain K12)
Q64SQ6 2.22e-45 166 32 2 287 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q8ELR4 2.34e-45 163 37 1 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q63S19 2.36e-45 162 37 3 261 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 2.36e-45 162 37 3 261 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 2.36e-45 162 37 3 261 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q0P9X7 2.47e-45 159 35 4 262 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q667L9 2.58e-45 162 36 3 250 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
P24137 2.61e-45 161 37 5 273 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
Q5M1F6 2.91e-45 162 39 3 228 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q1R5H8 3.04e-45 162 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli (strain UTI89 / UPEC)
A1AGY1 3.04e-45 162 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O1:K1 / APEC
Q5M5Z2 3.26e-45 162 38 3 229 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q8FCQ2 3.37e-45 162 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1LLP5 3.49e-45 162 40 2 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q65T42 3.57e-45 162 35 2 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8PC11 3.65e-45 162 36 2 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q0TC10 3.67e-45 162 38 1 227 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8D0W8 5.91e-45 162 36 3 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q65VG9 6.01e-45 161 38 2 234 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9Z3R9 7.04e-45 162 38 2 238 3 aglK Alpha-glucoside transport ATP-binding protein AglK Rhizobium meliloti (strain 1021)
Q8E3S0 7.17e-45 161 38 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q4W575 7.25e-45 161 36 3 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 7.25e-45 161 36 3 260 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q1BT84 7.53e-45 159 39 4 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
A0KAV6 7.53e-45 159 39 4 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
Q48PN3 7.62e-45 162 38 1 229 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1BR30 7.86e-45 162 38 4 249 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 7.86e-45 162 38 4 249 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q87UV4 9.69e-45 162 39 1 229 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q39CJ6 1e-44 159 39 4 244 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8FVT0 1.06e-44 161 36 1 226 3 BRA0745 Putative ATP-binding protein BRA0745/BS1330_II0738 Brucella suis biovar 1 (strain 1330)
Q57293 1.1e-44 161 37 1 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q2YKZ7 1.22e-44 160 36 1 226 3 BAB2_0493 Putative ATP-binding protein BAB2_0493 Brucella abortus (strain 2308)
Q578M5 1.22e-44 160 36 1 226 3 BruAb2_0487 Putative ATP-binding protein BruAb2_0487 Brucella abortus biovar 1 (strain 9-941)
Q8DY54 1.28e-44 161 38 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.28e-44 161 38 3 234 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P55604 1.36e-44 161 38 2 233 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q2K164 1.36e-44 158 37 6 266 3 tauB Taurine import ATP-binding protein TauB Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8ELA5 1.44e-44 160 38 1 220 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88ZJ6 1.49e-44 161 38 1 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q18C09 1.8e-44 159 41 3 214 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q6D1C4 1.86e-44 160 36 2 236 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2K1C8 2.02e-44 160 39 2 227 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8XBJ8 2.1e-44 160 37 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
P16676 2.22e-44 160 37 3 232 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
A1SWH9 2.22e-44 160 40 2 223 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9L0Q1 2.26e-44 160 38 1 218 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8FFB3 2.31e-44 160 37 3 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q98K23 2.46e-44 160 40 3 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1M7R4 2.47e-44 157 37 6 266 3 tauB Taurine import ATP-binding protein TauB Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q471U2 2.51e-44 157 36 4 254 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q53I83 2.64e-44 160 39 2 223 3 metN Methionine import ATP-binding protein MetN Streptomyces griseus
Q5LBT4 2.76e-44 162 36 1 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8UA73 2.81e-44 159 37 3 227 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
D4GP39 3.31e-44 160 38 2 235 1 xacK Xylose/arabinose import ATP-binding protein XacK Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q1M589 3.79e-44 159 38 2 227 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1CFH7 3.86e-44 159 35 3 250 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 3.86e-44 159 35 3 250 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 3.86e-44 159 35 3 250 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q5PFQ7 3.88e-44 160 37 2 224 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_10160
Feature type CDS
Gene proV
Product glycine betaine/L-proline ABC transporter ATP-binding protein ProV
Location 123142 - 124347 (strand: 1)
Length 1206 (nucleotides) / 401 (amino acids)
In genomic island -

Contig

Accession contig_11
Length 143616 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1616
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00571 CBS domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4175 Amino acid transport and metabolism (E) E ABC-type proline/glycine betaine transport system, ATPase component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02000 glycine betaine/proline transport system ATP-binding protein [EC:7.6.2.9] ABC transporters -

Protein Sequence

MAIKLEVKNLYKIFGEHPKQAFELLEQGLDKEHIFEKTGATVGVQDANLAIEEGEIFVIMGLSGSGKSTLVRLLNRLIEPTRGQVLIDGEDIAVISDQALREVRRKKISMVFQSFALMPHMSVIDNTAFGLELAGMSKAERHERALDALKQVNLEQWANSYPDELSGGMRQRIGLARALANDPDILLMDEAFSALDPLIRTEMQDELLSLQGDKQRTIVFISHDLDEAMRIGDRIAIMQGGVVVQVGTPDEILNNPANDYVRTFFRGVDISHVFSAKDIARRRADALLHVAPGFGPRSALKVLNDDDREYGYLIERGQKFAGIVSVASLEAALKAKKPITDAILSEPQAVSADTPLNELLTVVAQSPCAVPVVGNNNRYAGVISKGMLLQALDKETPNEPE

Flanking regions ( +/- flanking 50bp)

ATCCACATTTACCCATTTCACATCCACGTTATTCTGAATGGATATACTGCATGGCAATAAAACTCGAAGTTAAAAATCTTTATAAAATATTCGGTGAGCACCCGAAACAGGCATTTGAATTATTAGAACAGGGCCTGGACAAAGAACATATCTTTGAAAAGACCGGTGCTACCGTCGGCGTACAGGACGCCAATCTGGCCATTGAAGAAGGCGAAATATTCGTCATCATGGGACTGAGCGGTTCAGGGAAATCTACCTTAGTTCGTCTTCTCAATCGCCTGATAGAACCGACCCGTGGCCAGGTGCTGATCGACGGCGAAGATATCGCTGTGATTTCCGATCAGGCACTGCGCGAGGTACGGCGTAAAAAAATCAGCATGGTGTTTCAGTCCTTTGCTCTGATGCCGCATATGTCGGTGATCGATAATACCGCATTCGGCCTGGAACTGGCCGGGATGAGCAAAGCGGAACGCCATGAGCGCGCACTGGATGCGCTGAAACAGGTCAACCTGGAGCAGTGGGCGAATTCCTATCCGGATGAGCTGTCCGGCGGGATGCGTCAGCGGATCGGGCTTGCCCGCGCGCTGGCGAATGACCCGGATATCCTGCTGATGGATGAGGCGTTCTCCGCCCTTGATCCGCTGATCCGCACCGAAATGCAGGATGAGCTGCTGAGCCTCCAGGGCGATAAACAGCGTACCATCGTGTTTATTTCCCATGACCTCGACGAGGCCATGCGTATCGGCGACCGTATTGCCATTATGCAGGGCGGCGTTGTGGTGCAGGTCGGCACCCCGGATGAGATCCTCAATAATCCGGCTAATGATTATGTCCGTACCTTCTTCCGTGGTGTGGATATCAGTCATGTGTTCAGCGCCAAAGATATTGCCCGCCGCCGTGCGGATGCGCTGCTGCATGTTGCGCCGGGCTTCGGCCCGCGTTCGGCACTGAAAGTTCTCAATGATGATGACCGCGAGTACGGTTACCTGATTGAACGCGGACAAAAATTTGCCGGTATTGTTTCTGTTGCCTCACTGGAGGCGGCACTGAAAGCGAAAAAACCTATCACAGACGCCATTCTGAGCGAGCCGCAGGCGGTCAGTGCTGACACACCGCTCAATGAGCTGCTGACCGTTGTCGCGCAGTCACCGTGTGCTGTTCCGGTGGTCGGCAACAACAACCGCTATGCCGGGGTTATCTCAAAAGGGATGCTACTGCAGGCTTTAGATAAGGAGACGCCGAATGAGCCGGAATAATCAACAGGATACAGAACTGGATCCGTGGGCGGCAACATCAGAGCCGGATC