Homologs in group_1619

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10180 FBDBKF_10180 82.5 Morganella morganii S1 mprA transcriptional repressor MprA
EHELCC_04980 EHELCC_04980 82.5 Morganella morganii S2 mprA transcriptional repressor MprA
NLDBIP_04980 NLDBIP_04980 82.5 Morganella morganii S4 mprA transcriptional repressor MprA
LHKJJB_13650 LHKJJB_13650 82.5 Morganella morganii S3 mprA transcriptional repressor MprA
HKOGLL_12885 HKOGLL_12885 82.5 Morganella morganii S5 mprA transcriptional repressor MprA
F4V73_RS00160 F4V73_RS00160 83.6 Morganella psychrotolerans mprA transcriptional repressor MprA

Distribution of the homologs in the orthogroup group_1619

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1619

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACR9 4.69e-79 235 68 1 169 2 mprA Transcriptional repressor MprA Escherichia coli (strain K12)
P0ACS0 4.69e-79 235 68 1 169 3 mprA Transcriptional repressor MprA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACS1 4.69e-79 235 68 1 169 3 mprA Transcriptional repressor MprA Escherichia coli O157:H7
P62088 7.86e-28 105 37 0 153 4 prsX HTH-type transcriptional regulator PrsX Escherichia coli
P62089 7.86e-28 105 37 0 153 4 prsX HTH-type transcriptional regulator PrsX Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P42193 1.5e-25 99 39 1 143 4 papX HTH-type transcriptional regulator PapX Escherichia coli
O34949 2.4e-11 62 32 1 109 4 ykoM Uncharacterized HTH-type transcriptional regulator YkoM Bacillus subtilis (strain 168)
E7GT88 6.57e-07 49 33 1 111 4 bilQ HTH-type transcriptional regulator BilQ Clostridium symbiosum (strain WAL-14163)
P0DXC9 2.21e-06 48 27 3 121 4 bilQ HTH-type transcriptional regulator BilQ Clostridioides difficile (strain CD3)
O31541 3.06e-06 48 21 0 132 1 yetL HTH-type transcriptional repressor YetL Bacillus subtilis (strain 168)
P42195 5.41e-06 47 30 0 88 4 pecS HTH-type transcriptional regulator PecS Dickeya dadantii (strain 3937)
O31564 1.26e-05 46 30 1 79 4 yfiV Uncharacterized HTH-type transcriptional regulator YfiV Bacillus subtilis (strain 168)
P54182 2.23e-05 45 30 0 86 4 ypoP Uncharacterized HTH-type transcriptional regulator YpoP Bacillus subtilis (strain 168)
P0A2T4 8.41e-05 43 33 2 102 4 marR Multiple antibiotic resistance protein MarR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2T5 8.41e-05 43 33 2 102 3 marR Multiple antibiotic resistance protein MarR Salmonella typhi
O32181 0.000295 42 27 2 130 1 yusO Uncharacterized HTH-type transcriptional regulator YusO Bacillus subtilis (strain 168)
P25150 0.000309 42 28 2 109 4 ywaE Uncharacterized HTH-type transcriptional regulator YwaE Bacillus subtilis (strain 168)
O31672 0.000786 41 25 1 116 2 mhqR HTH-type transcriptional regulator MhqR Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02005
Feature type CDS
Gene mprA
Product transcriptional repressor MprA
Location 472371 - 472898 (strand: -1)
Length 528 (nucleotides) / 175 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1619
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01047 MarR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1846 Transcription (K) K DNA-binding transcriptional regulator, MarR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15974 MarR family transcriptional regulator, negative regulator of the multidrug operon emrRAB - -

Protein Sequence

MESSFTPTEELLNTRATQQKSLNKDIPYQEILLTRLSMHVQSKLLESRNNMLKSQGINETLFMALMILDTTENRSIQPSELSAALGSSRTNATRIADELEKQGWIERRESHNDRRCLHLHLTDAGEEFLNSLLPPQHECLKKIWSVLDEGEQKQLETLMRKLLLQLDTLADNQQE

Flanking regions ( +/- flanking 50bp)

TGTTGATAACAACGTTATCCTAATTATCGAAACTAACAAGGTGTCTAAAAATGGAAAGCTCATTTACGCCAACAGAAGAACTACTAAACACTCGCGCTACACAACAGAAATCGCTTAACAAAGATATTCCTTACCAAGAAATTTTGTTAACTCGCCTGTCTATGCACGTCCAGAGCAAACTTCTTGAAAGTCGTAATAATATGTTAAAGTCTCAGGGCATTAACGAGACATTATTTATGGCACTTATGATTTTAGATACAACGGAAAATCGTAGTATTCAACCATCAGAATTGAGTGCGGCGTTAGGCTCATCAAGAACAAATGCCACTCGTATTGCAGATGAATTAGAAAAACAAGGATGGATTGAGCGTCGTGAAAGTCATAATGACCGTCGCTGTCTACATCTTCATTTAACTGATGCTGGAGAAGAGTTTTTAAATAGCTTATTACCACCACAGCACGAATGTTTAAAGAAAATTTGGTCAGTATTAGATGAAGGTGAACAAAAACAGCTAGAAACCCTAATGCGTAAATTATTATTACAACTTGATACATTAGCGGATAATCAGCAGGAATAACCATCACTATCAATAAACTTATTGATCTAATCTGTATTAGCTCAGATTTG