Homologs in group_2069

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15210 FBDBKF_15210 74.3 Morganella morganii S1 proA glutamate-5-semialdehyde dehydrogenase
EHELCC_11035 EHELCC_11035 74.3 Morganella morganii S2 proA glutamate-5-semialdehyde dehydrogenase
NLDBIP_11380 NLDBIP_11380 74.3 Morganella morganii S4 proA glutamate-5-semialdehyde dehydrogenase
LHKJJB_11240 LHKJJB_11240 74.3 Morganella morganii S3 proA glutamate-5-semialdehyde dehydrogenase
HKOGLL_09850 HKOGLL_09850 74.3 Morganella morganii S5 proA glutamate-5-semialdehyde dehydrogenase
F4V73_RS12235 F4V73_RS12235 73.1 Morganella psychrotolerans proA glutamate-5-semialdehyde dehydrogenase

Distribution of the homologs in the orthogroup group_2069

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2069

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUV1 0.0 850 100 0 417 3 proA Gamma-glutamyl phosphate reductase Proteus mirabilis (strain HI4320)
Q7N7B1 0.0 690 80 0 417 3 proA Gamma-glutamyl phosphate reductase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JNX6 0.0 663 77 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JIH2 0.0 654 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DY8 0.0 654 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K6Q4 0.0 654 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FLI1 0.0 654 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPK0 0.0 652 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis (strain Pestoides F)
Q1CLC6 0.0 652 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2X0 0.0 652 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC09 0.0 652 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis
Q1C4E7 0.0 652 75 0 416 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
A8GAD4 0.0 640 74 0 416 3 proA Gamma-glutamyl phosphate reductase Serratia proteamaculans (strain 568)
Q6D1I4 0.0 636 74 0 416 3 proA Gamma-glutamyl phosphate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P17857 0.0 632 74 0 416 3 proA Gamma-glutamyl phosphate reductase Serratia marcescens
C6DCX4 0.0 623 74 0 416 3 proA Gamma-glutamyl phosphate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AKP4 0.0 620 73 0 416 3 proA Gamma-glutamyl phosphate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A7MI49 0.0 620 72 0 416 3 proA Gamma-glutamyl phosphate reductase Cronobacter sakazakii (strain ATCC BAA-894)
A4W6X5 0.0 616 72 0 416 3 proA Gamma-glutamyl phosphate reductase Enterobacter sp. (strain 638)
A6T561 0.0 615 71 0 416 3 proA Gamma-glutamyl phosphate reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VHM6 0.0 615 71 0 416 3 proA Gamma-glutamyl phosphate reductase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q83SH9 0.0 615 72 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri
Q0T7R6 0.0 615 72 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri serotype 5b (strain 8401)
B5Y169 0.0 613 71 0 416 3 proA Gamma-glutamyl phosphate reductase Klebsiella pneumoniae (strain 342)
B7N8H4 0.0 612 72 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UJD1 0.0 611 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5Z1I7 0.0 610 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7N4 0.0 610 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7
Q2NVE9 0.0 608 72 0 416 3 proA Gamma-glutamyl phosphate reductase Sodalis glossinidius (strain morsitans)
B7LNF7 0.0 607 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32J27 0.0 606 72 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella dysenteriae serotype 1 (strain Sd197)
B1LHT9 0.0 605 72 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain SMS-3-5 / SECEC)
B7L3Z5 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain 55989 / EAEC)
B7NK82 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B6I023 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain SE11)
A7ZWK6 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O9:H4 (strain HS)
B7M272 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O8 (strain IAI1)
A7ZI02 0.0 605 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3Z594 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella sonnei (strain Ss046)
P07004 0.0 604 71 0 416 1 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12)
B1J0Z1 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XDY6 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12 / DH10B)
C4ZTA0 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
Q1RFS7 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain UTI89 / UPEC)
A1A7V4 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O1:K1 / APEC
B7MC93 0.0 604 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7MQ79 0.0 603 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O81 (strain ED1a)
Q325P3 0.0 602 71 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella boydii serotype 4 (strain Sb227)
B2U3T4 0.0 602 71 0 416 3 proA Gamma-glutamyl phosphate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8FKM3 0.0 602 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TL73 0.0 600 71 0 416 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C0Q6U2 0.0 598 71 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi C (strain RKS4594)
Q57ST2 0.0 598 71 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella choleraesuis (strain SC-B67)
B4TZ91 0.0 596 71 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella schwarzengrund (strain CVM19633)
B4T7Q6 0.0 596 71 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella heidelberg (strain SL476)
A9MNR4 0.0 595 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EWK6 0.0 594 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella agona (strain SL483)
B4SVW6 0.0 594 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella newport (strain SL254)
Q8Z932 0.0 593 71 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella typhi
B5BDP7 0.0 593 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain AKU_12601)
Q5PF69 0.0 593 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P40861 0.0 592 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MY02 0.0 592 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5R5R9 0.0 590 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R4S6 0.0 590 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella enteritidis PT4 (strain P125109)
B5FJX5 0.0 590 70 1 416 3 proA Gamma-glutamyl phosphate reductase Salmonella dublin (strain CT_02021853)
P45121 0.0 553 63 0 417 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UBQ2 0.0 553 63 0 417 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain PittEE)
A5UF66 0.0 550 63 0 417 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain PittGG)
Q4QJW6 0.0 550 63 0 417 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain 86-028NP)
A6VMV2 0.0 543 64 1 415 3 proA Gamma-glutamyl phosphate reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65S49 0.0 537 62 0 415 3 proA Gamma-glutamyl phosphate reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CM98 0.0 532 63 0 415 3 proA Gamma-glutamyl phosphate reductase Pasteurella multocida (strain Pm70)
Q0I2E5 0.0 530 62 0 416 3 proA Gamma-glutamyl phosphate reductase Histophilus somni (strain 129Pt)
Q6LTX2 0.0 529 60 0 415 3 proA Gamma-glutamyl phosphate reductase Photobacterium profundum (strain SS9)
B7VJB0 0.0 527 61 2 415 3 proA Gamma-glutamyl phosphate reductase Vibrio atlanticus (strain LGP32)
B0USH2 0.0 527 61 0 416 3 proA Gamma-glutamyl phosphate reductase Histophilus somni (strain 2336)
Q87RU9 0.0 522 61 2 415 3 proA Gamma-glutamyl phosphate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A4SJF6 0.0 517 61 1 411 3 proA Gamma-glutamyl phosphate reductase Aeromonas salmonicida (strain A449)
Q9KPT9 0.0 516 62 3 416 3 proA Gamma-glutamyl phosphate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F602 0.0 516 62 3 416 3 proA Gamma-glutamyl phosphate reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A0KNQ8 0.0 515 61 1 411 3 proA Gamma-glutamyl phosphate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7MN58 9.73e-180 509 60 3 413 3 proA Gamma-glutamyl phosphate reductase Vibrio vulnificus (strain YJ016)
C4LBK4 1.45e-179 509 62 1 409 3 proA Gamma-glutamyl phosphate reductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B0BTX9 3.69e-179 508 62 2 413 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N3P3 3.86e-179 508 62 2 413 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q8DF94 4.49e-179 508 60 3 413 3 proA Gamma-glutamyl phosphate reductase Vibrio vulnificus (strain CMCP6)
B3H321 4.5e-179 508 62 2 413 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q5E6W0 8.51e-179 507 60 2 416 3 proA Gamma-glutamyl phosphate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FBJ5 3.45e-178 506 60 2 416 3 proA Gamma-glutamyl phosphate reductase Aliivibrio fischeri (strain MJ11)
B8F6K8 4.78e-177 503 60 1 414 3 proA Gamma-glutamyl phosphate reductase Glaesserella parasuis serovar 5 (strain SH0165)
A8FYU6 5.65e-170 485 57 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella sediminis (strain HAW-EB3)
B8CKF0 2.74e-168 481 55 0 416 3 proA Gamma-glutamyl phosphate reductase Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KD27 4.98e-167 478 54 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella woodyi (strain ATCC 51908 / MS32)
A1SYT9 6.79e-166 474 57 2 415 3 proA Gamma-glutamyl phosphate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B0TQC4 4.82e-162 465 53 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella halifaxensis (strain HAW-EB4)
A8H764 2.56e-159 458 53 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q8EHU1 9.34e-158 454 56 2 416 3 proA Gamma-glutamyl phosphate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A5URC6 2.15e-152 441 53 3 420 3 proA Gamma-glutamyl phosphate reductase Roseiflexus sp. (strain RS-1)
B8G8E0 5.85e-152 439 52 2 419 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aggregans (strain MD-66 / DSM 9485)
A1S8L1 4.83e-150 434 55 1 415 3 proA Gamma-glutamyl phosphate reductase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B9LE47 7.09e-150 434 53 2 419 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WBM7 7.09e-150 434 53 2 419 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A7NSB7 8.89e-148 429 53 3 420 3 proA Gamma-glutamyl phosphate reductase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q2RKZ6 8.44e-147 426 50 1 416 3 proA Gamma-glutamyl phosphate reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B0TBV8 2.79e-141 412 48 1 411 3 proA Gamma-glutamyl phosphate reductase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q82C81 2.97e-141 412 52 0 395 3 proA Gamma-glutamyl phosphate reductase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A6Q3B4 6.27e-141 411 46 2 416 3 proA Gamma-glutamyl phosphate reductase Nitratiruptor sp. (strain SB155-2)
Q8RAE5 1.03e-140 410 48 1 416 3 proA Gamma-glutamyl phosphate reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A4IPN4 2.59e-140 409 49 3 418 3 proA Gamma-glutamyl phosphate reductase Geobacillus thermodenitrificans (strain NG80-2)
Q47MW1 3.06e-140 409 51 1 398 3 proA Gamma-glutamyl phosphate reductase Thermobifida fusca (strain YX)
Q5KYA2 5.15e-140 409 50 3 418 3 proA Gamma-glutamyl phosphate reductase Geobacillus kaustophilus (strain HTA426)
Q3AF39 5.62e-140 409 51 1 399 3 proA Gamma-glutamyl phosphate reductase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q0TM73 8.11e-139 406 48 2 414 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XHA7 2.05e-138 405 48 2 414 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain 13 / Type A)
C5CE09 2.07e-138 405 46 3 420 3 proA Gamma-glutamyl phosphate reductase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
B9L9A2 5.09e-138 404 45 1 415 3 proA Gamma-glutamyl phosphate reductase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
Q3ZYH9 2.52e-137 402 47 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain CBDB1)
Q0SPX8 2.65e-137 402 47 2 414 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain SM101 / Type A)
Q896G4 4.66e-137 402 46 1 417 3 proA Gamma-glutamyl phosphate reductase Clostridium tetani (strain Massachusetts / E88)
Q92CE5 4.66e-137 401 47 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AI64 8.49e-137 400 47 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A1AUT0 8.6e-137 400 47 1 413 3 proA Gamma-glutamyl phosphate reductase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B9MK80 1.12e-136 400 47 0 415 3 proA Gamma-glutamyl phosphate reductase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
A5FQ48 1.87e-136 400 47 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A6LPD5 2.03e-136 400 46 2 414 3 proA Gamma-glutamyl phosphate reductase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B3E3M7 2.5e-136 399 48 1 412 3 proA Gamma-glutamyl phosphate reductase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q93Q55 4.44e-136 399 46 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q3Z6Z9 6.48e-136 399 46 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B2THG5 1.11e-135 398 45 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium botulinum (strain Eklund 17B / Type B)
B7GJH1 1.77e-135 397 48 2 411 3 proA Gamma-glutamyl phosphate reductase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
B2UX78 2.23e-135 397 46 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium botulinum (strain Alaska E43 / Type E3)
A0PXA4 4.68e-135 396 47 2 408 3 proA Gamma-glutamyl phosphate reductase Clostridium novyi (strain NT)
Q7NQ51 6.01e-135 396 47 1 415 3 proA Gamma-glutamyl phosphate reductase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B1VXE5 5.57e-134 394 50 0 393 3 proA Gamma-glutamyl phosphate reductase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
B9DV79 7.03e-134 393 47 4 418 3 proA Gamma-glutamyl phosphate reductase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q747Q4 1.61e-133 392 48 1 401 3 proA Gamma-glutamyl phosphate reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A5N0V1 1.83e-133 392 47 1 413 3 proA Gamma-glutamyl phosphate reductase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E4Q5 1.83e-133 392 47 1 413 3 proA Gamma-glutamyl phosphate reductase Clostridium kluyveri (strain NBRC 12016)
Q839W3 2.14e-133 392 47 1 415 3 proA Gamma-glutamyl phosphate reductase Enterococcus faecalis (strain ATCC 700802 / V583)
A5IKB6 2.38e-133 392 45 2 418 3 proA Gamma-glutamyl phosphate reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q97E62 2.74e-133 392 46 1 414 3 proA Gamma-glutamyl phosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B1L9J9 4.47e-133 391 45 2 418 3 proA Gamma-glutamyl phosphate reductase Thermotoga sp. (strain RQ2)
C4Z9V4 6.07e-133 391 47 1 415 3 proA Gamma-glutamyl phosphate reductase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q9WYC9 6.61e-133 391 45 2 418 1 proA Gamma-glutamyl phosphate reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C1L2G7 1.94e-132 389 45 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q9RDK1 3.56e-132 389 48 0 402 3 proA Gamma-glutamyl phosphate reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8DHP3 4.8e-132 389 45 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4a (strain HCC23)
Q720G3 4.95e-132 389 45 1 415 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4b (strain F2365)
A4XK60 5.07e-132 389 46 0 415 3 proA Gamma-glutamyl phosphate reductase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A9KMV0 5.46e-132 388 45 1 412 3 proA Gamma-glutamyl phosphate reductase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B9M0D6 6.59e-132 388 47 1 402 3 proA Gamma-glutamyl phosphate reductase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q3A1E0 8.65e-132 388 46 2 415 3 proA Gamma-glutamyl phosphate reductase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C5D2V2 3.67e-131 386 46 3 414 3 proA Gamma-glutamyl phosphate reductase Geobacillus sp. (strain WCH70)
B4U4K6 4.01e-131 386 47 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0QS00 4.17e-131 387 44 1 418 3 proA Gamma-glutamyl phosphate reductase Persephonella marina (strain DSM 14350 / EX-H1)
B8D0Y6 8.22e-131 385 46 1 410 3 proA Gamma-glutamyl phosphate reductase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q6AFX9 1.78e-130 385 49 1 410 3 proA Gamma-glutamyl phosphate reductase Leifsonia xyli subsp. xyli (strain CTCB07)
Q0AWJ6 2.24e-130 384 47 3 419 3 proA Gamma-glutamyl phosphate reductase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q2JDN7 2.24e-130 384 51 1 396 3 proA Gamma-glutamyl phosphate reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q2SA27 2.72e-130 384 44 1 416 3 proA Gamma-glutamyl phosphate reductase Hahella chejuensis (strain KCTC 2396)
B0K9C5 3.03e-130 384 47 2 403 3 proA Gamma-glutamyl phosphate reductase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K0T2 4.78e-130 384 47 2 403 3 proA Gamma-glutamyl phosphate reductase Thermoanaerobacter sp. (strain X514)
A1A1U9 6.81e-130 384 48 1 415 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
P96489 1.01e-129 383 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus
C4Z075 1.06e-129 382 45 1 416 3 proA Gamma-glutamyl phosphate reductase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q48RY7 1.08e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RD38 1.08e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JAG3 1.08e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8NZX9 1.08e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAL0 1.08e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5M2U1 1.62e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LY84 1.62e-129 382 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain CNRZ 1066)
Q8G5H9 1.79e-129 382 47 2 416 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium longum (strain NCC 2705)
Q99YJ8 4e-129 381 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M1
Q03J03 4.31e-129 381 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q65IS9 6.06e-129 381 47 2 401 3 proA2 Gamma-glutamyl phosphate reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6HHC2 1.87e-128 379 44 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JD15 1.87e-128 379 44 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain AH820)
Q1JKL4 1.91e-128 379 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M12 (strain MGAS9429)
A5G906 2.16e-128 379 46 1 408 3 proA Gamma-glutamyl phosphate reductase Geotalea uraniireducens (strain Rf4)
B0U111 2.4e-128 379 44 2 413 3 proA Gamma-glutamyl phosphate reductase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A8MFQ5 2.92e-128 379 44 3 417 3 proA Gamma-glutamyl phosphate reductase Alkaliphilus oremlandii (strain OhILAs)
Q0ABN0 3.13e-128 379 45 1 415 3 proA Gamma-glutamyl phosphate reductase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1J5F6 3.6e-128 379 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M4 (strain MGAS10750)
B7GTL2 4.11e-128 379 46 2 416 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
A4VTT5 4.32e-128 378 48 4 408 3 proA Gamma-glutamyl phosphate reductase Streptococcus suis (strain 05ZYH33)
A4W028 4.32e-128 378 48 4 408 3 proA Gamma-glutamyl phosphate reductase Streptococcus suis (strain 98HAH33)
B5EEI4 7.3e-128 378 46 1 408 3 proA Gamma-glutamyl phosphate reductase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q24XR6 8.32e-128 378 46 3 411 3 proA Gamma-glutamyl phosphate reductase Desulfitobacterium hafniense (strain Y51)
C5BNN0 9.9e-128 378 44 1 414 3 proA Gamma-glutamyl phosphate reductase Teredinibacter turnerae (strain ATCC 39867 / T7901)
B5XML5 1.45e-127 377 46 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M49 (strain NZ131)
Q639W9 1.72e-127 377 44 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain ZK / E33L)
Q39QR2 2.84e-127 377 47 1 402 3 proA Gamma-glutamyl phosphate reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
C3K2M9 2.91e-127 377 45 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain SBW25)
Q2YBP9 3e-127 377 46 2 419 3 proA Gamma-glutamyl phosphate reductase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A4VR07 4.3e-127 376 46 1 415 3 proA Gamma-glutamyl phosphate reductase Stutzerimonas stutzeri (strain A1501)
C1D6E4 4.74e-127 376 46 2 417 3 proA Gamma-glutamyl phosphate reductase Laribacter hongkongensis (strain HLHK9)
Q65KU7 5.82e-127 375 48 1 401 3 proA1 Gamma-glutamyl phosphate reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q30SG0 6.27e-127 375 44 2 420 3 proA Gamma-glutamyl phosphate reductase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
C6E7L9 6.71e-127 375 46 1 408 3 proA Gamma-glutamyl phosphate reductase Geobacter sp. (strain M21)
P0DD21 7.01e-127 375 45 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD20 7.01e-127 375 45 2 416 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B5YK66 1e-126 375 45 1 411 3 proA Gamma-glutamyl phosphate reductase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B5YEQ8 1.13e-126 375 44 1 410 3 proA Gamma-glutamyl phosphate reductase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q6FEN5 1.47e-126 375 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
C1EZ15 1.67e-126 374 43 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain 03BB102)
A8M064 1.8e-126 374 49 1 402 3 proA Gamma-glutamyl phosphate reductase Salinispora arenicola (strain CNS-205)
A4XYY4 1.83e-126 374 47 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas mendocina (strain ymp)
C1DMQ0 1.89e-126 374 47 1 415 3 proA Gamma-glutamyl phosphate reductase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B9J498 2.29e-126 374 43 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain Q1)
B7HVK6 2.29e-126 374 43 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain AH187)
A8EVN0 2.76e-126 374 40 1 416 3 proA Gamma-glutamyl phosphate reductase Aliarcobacter butzleri (strain RM4018)
A2RJM8 3.07e-126 374 44 2 417 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. cremoris (strain MG1363)
Q02XW0 3.28e-126 374 44 2 417 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. cremoris (strain SK11)
Q2LU85 3.51e-126 374 45 1 415 3 proA Gamma-glutamyl phosphate reductase Syntrophus aciditrophicus (strain SB)
A6QB48 3.82e-126 373 44 1 415 3 proA Gamma-glutamyl phosphate reductase Sulfurovum sp. (strain NBC37-1)
P9WHV1 4.08e-126 374 49 1 396 1 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHV0 4.08e-126 374 49 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5C2 4.08e-126 374 49 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AQZ3 4.08e-126 374 49 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLC0 4.08e-126 374 49 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65789 4.08e-126 374 49 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A5WH78 4.51e-126 374 45 2 420 3 proA Gamma-glutamyl phosphate reductase Psychrobacter sp. (strain PRwf-1)
O67166 7.03e-126 374 43 2 419 3 proA Gamma-glutamyl phosphate reductase Aquifex aeolicus (strain VF5)
Q4K5F9 8.1e-126 373 45 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2S354 8.55e-126 373 47 1 401 3 proA Gamma-glutamyl phosphate reductase Salinibacter ruber (strain DSM 13855 / M31)
B8FUB6 1.09e-125 372 46 3 411 3 proA Gamma-glutamyl phosphate reductase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A9VK31 1.25e-125 372 43 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus mycoides (strain KBAB4)
B2V9F3 1.36e-125 373 44 1 418 3 proA Gamma-glutamyl phosphate reductase Sulfurihydrogenibium sp. (strain YO3AOP1)
B7V8A7 1.56e-125 372 48 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain LESB58)
Q8DVM9 1.89e-125 372 46 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A6TUA0 2.45e-125 371 43 4 417 3 proA Gamma-glutamyl phosphate reductase Alkaliphilus metalliredigens (strain QYMF)
Q7M8Z4 2.56e-125 371 42 1 416 3 proA Gamma-glutamyl phosphate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9HX20 2.62e-125 372 48 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02SH4 4.18e-125 371 48 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V0A3 4.37e-125 371 48 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain PA7)
Q735X3 4.87e-125 370 43 2 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain ATCC 10987 / NRS 248)
A4X1X0 4.92e-125 370 48 1 393 3 proA Gamma-glutamyl phosphate reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A8ZRY3 6.46e-125 370 47 2 396 3 proA Gamma-glutamyl phosphate reductase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q9CF73 7.36e-125 370 44 2 417 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. lactis (strain IL1403)
A6T242 8.12e-125 370 42 1 415 3 proA Gamma-glutamyl phosphate reductase Janthinobacterium sp. (strain Marseille)
Q81P27 8.38e-125 370 44 2 412 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis
C3LEW9 8.38e-125 370 44 2 412 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3NZU4 8.38e-125 370 44 2 412 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis (strain A0248)
A1U3C3 1.46e-124 370 44 1 415 3 proA Gamma-glutamyl phosphate reductase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0LPG2 1.66e-124 369 45 1 412 3 proA Gamma-glutamyl phosphate reductase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q21FC9 4.28e-124 369 44 0 412 3 proA Gamma-glutamyl phosphate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4G8E9 1.01e-123 367 42 1 415 3 proA Gamma-glutamyl phosphate reductase Herminiimonas arsenicoxydans
Q1QXB4 1.22e-123 367 46 1 415 3 proA Gamma-glutamyl phosphate reductase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A0LCZ1 1.6e-123 367 43 1 416 3 proA Gamma-glutamyl phosphate reductase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q1WRR6 1.82e-123 367 43 3 416 3 proA Gamma-glutamyl phosphate reductase Ligilactobacillus salivarius (strain UCC118)
Q8E1R9 3.31e-123 366 44 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K395 3.31e-123 366 44 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B8E0D2 3.61e-123 366 43 2 416 3 proA Gamma-glutamyl phosphate reductase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A3CMT1 5.95e-123 365 48 4 405 3 proA Gamma-glutamyl phosphate reductase Streptococcus sanguinis (strain SK36)
A8AX77 1.12e-122 365 47 3 405 3 proA Gamma-glutamyl phosphate reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8CUQ4 1.42e-122 364 42 1 413 3 proA Gamma-glutamyl phosphate reductase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0AEA6 1.72e-122 364 45 1 396 3 proA Gamma-glutamyl phosphate reductase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8E783 1.97e-122 364 44 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype III (strain NEM316)
B2G5W8 2.05e-122 364 44 2 413 3 proA Gamma-glutamyl phosphate reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIE0 2.05e-122 364 44 2 413 3 proA Gamma-glutamyl phosphate reductase Limosilactobacillus reuteri (strain DSM 20016)
Q890J4 3.46e-122 363 45 2 415 3 proA Gamma-glutamyl phosphate reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B3WA82 3.53e-122 363 47 2 416 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus casei (strain BL23)
Q3J7T1 5.11e-122 363 43 1 415 3 proA Gamma-glutamyl phosphate reductase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q035M3 5.23e-122 363 47 2 416 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A4J3Q0 5.4e-122 363 43 1 415 3 proA Gamma-glutamyl phosphate reductase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q1IZP1 8.42e-122 363 51 3 404 3 proA Gamma-glutamyl phosphate reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q5P255 8.7e-122 363 42 2 422 3 proA Gamma-glutamyl phosphate reductase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q5QY68 1.23e-121 362 42 3 401 3 proA Gamma-glutamyl phosphate reductase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1IS80 1.67e-121 362 48 4 399 3 proA Gamma-glutamyl phosphate reductase Koribacter versatilis (strain Ellin345)
Q9RTD9 2.28e-121 362 49 3 420 3 proA Gamma-glutamyl phosphate reductase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q47UQ0 3.28e-121 361 42 2 414 3 proA Gamma-glutamyl phosphate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B7H673 3.58e-121 361 44 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain B4264)
Q31IE5 3.95e-121 361 44 2 417 3 proA Gamma-glutamyl phosphate reductase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q73XR2 3.97e-121 361 47 1 401 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B2I3D3 5.64e-121 360 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain ACICU)
B0VKT1 7.09e-121 360 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain SDF)
Q39JM2 9e-121 360 44 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3SG61 1.08e-120 360 44 1 418 3 proA Gamma-glutamyl phosphate reductase Thiobacillus denitrificans (strain ATCC 25259)
B0V4S6 1.08e-120 360 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AYE)
B7I5F5 1.08e-120 360 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AB0057)
B7H081 1.08e-120 360 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AB307-0294)
Q3IEY7 1.11e-120 360 43 2 416 3 proA Gamma-glutamyl phosphate reductase Pseudoalteromonas translucida (strain TAC 125)
A7Z3T1 1.18e-120 359 47 1 397 3 proA Gamma-glutamyl phosphate reductase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B0RS59 1.21e-120 359 45 1 407 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain B100)
B2JGX3 1.58e-120 359 44 2 415 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B8FM70 1.58e-120 359 43 1 412 3 proA Gamma-glutamyl phosphate reductase Desulfatibacillum aliphaticivorans
A3M1Z8 1.75e-120 359 43 1 416 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A4T2I0 4.65e-120 358 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium gilvum (strain PYR-GCK)
A4SVE2 5.07e-120 358 43 1 416 3 proA Gamma-glutamyl phosphate reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A4JBI4 6.02e-120 358 43 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A8L1V4 9.11e-120 357 49 1 407 3 proA Gamma-glutamyl phosphate reductase Parafrankia sp. (strain EAN1pec)
Q9KCR5 9.84e-120 357 44 2 417 3 proA Gamma-glutamyl phosphate reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B1ZMC1 9.92e-120 357 47 1 417 3 proA Gamma-glutamyl phosphate reductase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
C1CDS9 9.93e-120 357 48 3 401 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain JJA)
A1SHP5 1e-119 358 45 1 404 3 proA Gamma-glutamyl phosphate reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B1JVH2 1.04e-119 357 44 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia orbicola (strain MC0-3)
B7ILK1 1.16e-119 357 43 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain G9842)
Q97R94 1.36e-119 357 48 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q12SX8 1.73e-119 357 43 2 416 3 proA Gamma-glutamyl phosphate reductase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q1I4F0 1.88e-119 357 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas entomophila (strain L48)
Q0VN49 2.01e-119 357 42 1 416 3 proA Gamma-glutamyl phosphate reductase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A1TC11 2.27e-119 356 47 1 399 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q47IN4 2.73e-119 356 43 2 417 3 proA Gamma-glutamyl phosphate reductase Dechloromonas aromatica (strain RCB)
Q88DL4 2.82e-119 356 45 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1BZ67 3.31e-119 356 44 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia orbicola (strain AU 1054)
A0K4I3 3.31e-119 356 44 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia cenocepacia (strain HI2424)
Q7VI05 4.6e-119 355 44 3 408 3 proA Gamma-glutamyl phosphate reductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2KXE0 5.07e-119 355 44 2 412 3 proA Gamma-glutamyl phosphate reductase Bordetella avium (strain 197N)
Q5GZF2 5.13e-119 355 45 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q7UNV2 6.53e-119 356 44 1 412 3 proA Gamma-glutamyl phosphate reductase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B1YTB0 6.64e-119 355 43 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia ambifaria (strain MC40-6)
A4F9M1 6.77e-119 356 44 1 401 3 proA Gamma-glutamyl phosphate reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q9CBZ7 9.75e-119 354 47 1 375 3 proA Gamma-glutamyl phosphate reductase Mycobacterium leprae (strain TN)
B8ZRN0 9.75e-119 354 47 1 375 3 proA Gamma-glutamyl phosphate reductase Mycobacterium leprae (strain Br4923)
B2SHW6 9.84e-119 355 45 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2G1 9.84e-119 355 45 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
C0QLF1 1.12e-118 355 43 1 417 3 proA Gamma-glutamyl phosphate reductase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q6AK09 2.53e-118 353 43 1 413 3 proA Gamma-glutamyl phosphate reductase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q054P8 2.59e-118 353 43 2 415 3 proA Gamma-glutamyl phosphate reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04Q92 2.59e-118 353 43 2 415 3 proA Gamma-glutamyl phosphate reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
C1CRW1 2.61e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DQ60 2.61e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KZ2 2.61e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q820I7 3.01e-118 353 46 2 396 3 proA Gamma-glutamyl phosphate reductase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A1KAH8 3.35e-118 353 43 1 419 3 proA Gamma-glutamyl phosphate reductase Azoarcus sp. (strain BH72)
Q4ZN73 3.43e-118 353 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas syringae pv. syringae (strain B728a)
C1C6R4 3.82e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain 70585)
Q0BIB2 4.39e-118 353 43 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B2IP88 4.54e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain CGSP14)
Q48DL4 5.01e-118 353 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C1CK18 5.83e-118 353 47 4 404 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain P1031)
Q0SH62 6.52e-118 352 46 1 401 3 proA Gamma-glutamyl phosphate reductase Rhodococcus jostii (strain RHA1)
A5W9J6 6.57e-118 353 45 2 417 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q5WH54 8.18e-118 352 43 1 413 3 proA Gamma-glutamyl phosphate reductase Shouchella clausii (strain KSM-K16)
B8ZP35 8.44e-118 352 48 2 399 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B0KJY5 1.48e-117 352 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain GB-1)
B1IBA0 3.07e-117 351 47 4 405 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain Hungary19A-6)
Q4UVI0 4.13e-117 350 46 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain 8004)
Q9JZG3 4.35e-117 350 45 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q87VV6 4.95e-117 350 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7WH30 5.9e-117 350 43 1 415 3 proA Gamma-glutamyl phosphate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q122S5 7.17e-117 350 43 2 418 3 proA Gamma-glutamyl phosphate reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B4U8A0 7.46e-117 351 43 2 407 3 proA Gamma-glutamyl phosphate reductase Hydrogenobaculum sp. (strain Y04AAS1)
A0R115 1.42e-116 349 47 1 401 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q7VWZ0 1.62e-116 349 43 1 415 3 proA Gamma-glutamyl phosphate reductase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O86053 1.71e-116 349 45 2 401 3 proA Gamma-glutamyl phosphate reductase Meiothermus ruber
Q1B639 2.04e-116 348 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain MCS)
A1UIZ7 2.04e-116 348 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain KMS)
A3Q2E3 2.04e-116 348 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain JLS)
Q8P8K3 2.17e-116 348 46 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q7W9M7 2.32e-116 348 43 1 415 3 proA Gamma-glutamyl phosphate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q1GZB2 2.94e-116 348 44 2 417 3 proA Gamma-glutamyl phosphate reductase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9JUK8 3.24e-116 348 45 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P54903 3.47e-116 348 44 2 408 3 proA Gamma-glutamyl phosphate reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B1J133 4.11e-116 348 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain W619)
B4RLE6 5.89e-116 348 44 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8D3 5.89e-116 348 44 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B2UC98 6.26e-116 348 42 1 413 3 proA Gamma-glutamyl phosphate reductase Ralstonia pickettii (strain 12J)
C6BSC1 7.01e-116 347 44 2 408 3 proA Gamma-glutamyl phosphate reductase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A2SCE2 1.04e-115 347 46 1 374 3 proA Gamma-glutamyl phosphate reductase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A6VZ85 1.15e-115 347 42 1 415 3 proA Gamma-glutamyl phosphate reductase Marinomonas sp. (strain MWYL1)
P39821 1.47e-115 347 44 1 397 3 proA Gamma-glutamyl phosphate reductase Bacillus subtilis (strain 168)
P94872 2.27e-115 346 43 2 408 3 proA Gamma-glutamyl phosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
A5CR34 2.27e-115 347 45 1 415 3 proA Gamma-glutamyl phosphate reductase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q72NQ9 2.42e-115 346 43 2 408 3 proA Gamma-glutamyl phosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A1KTV4 3e-115 346 45 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9HWX2 4.11e-115 345 42 1 412 3 proA Gamma-glutamyl phosphate reductase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q8XVT6 4.82e-115 345 41 1 413 3 proA Gamma-glutamyl phosphate reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5SH02 4.91e-115 345 43 2 408 3 proA Gamma-glutamyl phosphate reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q13U85 6.26e-115 345 44 2 415 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia xenovorans (strain LB400)
Q28Q10 8.58e-115 345 42 2 416 3 proA Gamma-glutamyl phosphate reductase Jannaschia sp. (strain CCS1)
A9LYY9 1.12e-114 344 45 4 415 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup C (strain 053442)
B2SYN3 1.57e-114 344 44 2 415 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q3K693 2.3e-114 344 43 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain Pf0-1)
A9BJ18 3e-114 343 43 2 410 3 proA Gamma-glutamyl phosphate reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
P54902 3.16e-114 344 42 3 413 3 proA1 Gamma-glutamyl phosphate reductase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2HME9 3.83e-114 343 46 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q46XE1 5.24e-114 343 42 1 398 3 proA Gamma-glutamyl phosphate reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1VTR9 2.6e-113 341 41 1 420 3 proA Gamma-glutamyl phosphate reductase Polaromonas naphthalenivorans (strain CJ2)
Q1LJ33 3.39e-113 341 42 1 397 3 proA Gamma-glutamyl phosphate reductase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q606Y1 3.76e-113 341 44 1 415 3 proA Gamma-glutamyl phosphate reductase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QDZ7 4.13e-113 341 42 3 422 3 proA Gamma-glutamyl phosphate reductase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A0PU04 7.83e-113 340 46 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium ulcerans (strain Agy99)
Q62H23 1.18e-112 339 42 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia mallei (strain ATCC 23344)
Q6A9H6 1.49e-112 339 43 3 411 3 proA Gamma-glutamyl phosphate reductase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q67LC2 1.56e-112 339 46 2 406 3 proA Gamma-glutamyl phosphate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q0K710 1.94e-112 339 42 1 416 3 proA Gamma-glutamyl phosphate reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B5E435 3.04e-112 338 47 2 399 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 19F (strain G54)
A1AVH0 3.66e-112 338 38 1 417 3 proA Gamma-glutamyl phosphate reductase Ruthia magnifica subsp. Calyptogena magnifica
Q165Y8 4.49e-112 338 41 2 416 3 proA Gamma-glutamyl phosphate reductase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3BSJ1 4.67e-112 337 46 1 407 3 proA Gamma-glutamyl phosphate reductase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6G0S6 6.91e-112 337 42 3 416 3 proA Gamma-glutamyl phosphate reductase Bartonella quintana (strain Toulouse)
A5CXP4 8.54e-112 337 38 1 417 3 proA Gamma-glutamyl phosphate reductase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B3R6R0 8.86e-112 337 41 1 416 3 proA Gamma-glutamyl phosphate reductase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A1WYZ4 9.58e-112 337 43 1 397 3 proA Gamma-glutamyl phosphate reductase Halorhodospira halophila (strain DSM 244 / SL1)
Q64Z29 1.02e-111 337 42 4 412 3 proA Gamma-glutamyl phosphate reductase Bacteroides fragilis (strain YCH46)
Q5LI24 1.02e-111 337 42 4 412 3 proA Gamma-glutamyl phosphate reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q1GHC8 3.61e-111 335 41 1 416 3 proA Gamma-glutamyl phosphate reductase Ruegeria sp. (strain TM1040)
Q63QT9 3.68e-111 335 42 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia pseudomallei (strain K96243)
Q3JNN5 3.68e-111 335 42 2 415 3 proA Gamma-glutamyl phosphate reductase Burkholderia pseudomallei (strain 1710b)
Q6G4Z0 7.76e-111 334 40 3 416 3 proA Gamma-glutamyl phosphate reductase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q4FUZ5 9.28e-111 335 42 3 423 3 proA Gamma-glutamyl phosphate reductase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q7NEF6 6.9e-110 332 41 2 415 3 proA Gamma-glutamyl phosphate reductase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A1TVU4 8.23e-110 332 42 1 416 3 proA Gamma-glutamyl phosphate reductase Paracidovorax citrulli (strain AAC00-1)
Q2SZ88 1.01e-109 332 42 2 396 1 proA Gamma-glutamyl phosphate reductase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P0C1E0 1.12e-109 332 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QG75 1.12e-109 332 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium glutamicum (strain R)
Q5NLX5 1.63e-109 332 42 1 416 3 proA Gamma-glutamyl phosphate reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B0U208 1.8e-109 332 45 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain M12)
Q8FN87 2.3e-109 332 43 1 408 3 proA Gamma-glutamyl phosphate reductase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q2N9V1 7.64e-109 330 41 3 415 3 proA Gamma-glutamyl phosphate reductase Erythrobacter litoralis (strain HTCC2594)
B3EPD4 1.99e-108 328 42 4 409 3 proA Gamma-glutamyl phosphate reductase Chlorobium phaeobacteroides (strain BS1)
A7GVZ7 2.22e-108 329 42 2 437 3 proA Gamma-glutamyl phosphate reductase Campylobacter curvus (strain 525.92)
Q5Z025 2.36e-108 328 45 1 399 3 proA Gamma-glutamyl phosphate reductase Nocardia farcinica (strain IFM 10152)
Q8A1E8 2.76e-108 328 42 4 411 3 proA Gamma-glutamyl phosphate reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P0C1E1 3.55e-108 328 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium melassecola
C4XSQ4 3.93e-108 328 43 1 415 3 proA Gamma-glutamyl phosphate reductase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q5LRY6 4.03e-108 328 41 1 415 3 proA Gamma-glutamyl phosphate reductase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A5ICA4 4.03e-108 328 40 4 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Corby)
B4SG68 5.82e-108 327 42 6 412 3 proA Gamma-glutamyl phosphate reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A6WDM6 6.24e-108 328 46 0 410 3 proA Gamma-glutamyl phosphate reductase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q8PK35 6.37e-108 327 46 2 409 3 proA Gamma-glutamyl phosphate reductase Xanthomonas axonopodis pv. citri (strain 306)
Q9PEM3 6.79e-108 327 45 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain 9a5c)
Q8YV15 9.38e-108 327 41 2 406 3 proA Gamma-glutamyl phosphate reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5CZ28 1.19e-107 327 41 3 412 3 proA Gamma-glutamyl phosphate reductase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q3MH53 1.26e-107 327 41 2 406 3 proA Gamma-glutamyl phosphate reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q87EK9 1.3e-107 327 45 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I7L2 1.3e-107 327 45 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain M23)
Q6NFW0 1.97e-107 326 43 2 411 3 proA Gamma-glutamyl phosphate reductase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A3DC22 2.78e-107 326 40 4 415 3 proA Gamma-glutamyl phosphate reductase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B3EE24 3.4e-107 325 41 4 412 3 proA Gamma-glutamyl phosphate reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B8HYG3 3.41e-107 326 42 3 412 3 proA Gamma-glutamyl phosphate reductase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
C0R0B8 3.64e-107 326 38 4 411 3 proA Gamma-glutamyl phosphate reductase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q220P2 4.25e-107 326 39 1 431 3 proA Gamma-glutamyl phosphate reductase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5ZV33 9.13e-107 324 40 4 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X4U9 9.85e-107 324 40 4 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Paris)
Q5WWN7 1.2e-106 324 40 4 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Lens)
Q2VZT9 2.02e-106 323 39 1 416 3 proA Gamma-glutamyl phosphate reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3IP72 2.16e-106 324 41 4 412 3 proA Gamma-glutamyl phosphate reductase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A1WCP4 3.31e-106 323 41 1 413 3 proA Gamma-glutamyl phosphate reductase Acidovorax sp. (strain JS42)
A1WGI4 3.35e-106 323 40 1 414 3 proA Gamma-glutamyl phosphate reductase Verminephrobacter eiseniae (strain EF01-2)
B8J495 4.27e-106 323 43 3 421 3 proA Gamma-glutamyl phosphate reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A7HT65 4.45e-106 323 42 2 417 3 proA Gamma-glutamyl phosphate reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B9MH63 5.28e-106 322 41 1 413 3 proA Gamma-glutamyl phosphate reductase Acidovorax ebreus (strain TPSY)
B2IZ89 1.97e-105 321 40 2 408 3 proA Gamma-glutamyl phosphate reductase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q3B2U3 5.23e-105 320 42 7 419 3 proA Gamma-glutamyl phosphate reductase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q98EZ5 7.47e-105 320 40 2 417 3 proA Gamma-glutamyl phosphate reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q18J39 7.74e-105 320 41 5 412 3 proA Gamma-glutamyl phosphate reductase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q04FB2 8.51e-105 319 40 3 413 3 proA Gamma-glutamyl phosphate reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q112S1 1.32e-104 319 40 2 411 3 proA Gamma-glutamyl phosphate reductase Trichodesmium erythraeum (strain IMS101)
Q12TF9 2.72e-104 319 40 5 419 3 proA Gamma-glutamyl phosphate reductase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q3IXX7 2.89e-104 318 44 2 375 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B0JWW5 4.2e-104 318 40 2 411 3 proA Gamma-glutamyl phosphate reductase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A3PQJ2 4.37e-104 317 44 2 375 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8DKU1 4.52e-104 318 41 3 412 3 proA Gamma-glutamyl phosphate reductase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q92LB2 4.71e-104 317 39 2 417 3 proA Gamma-glutamyl phosphate reductase Rhizobium meliloti (strain 1021)
B9KW06 5.19e-104 317 44 2 375 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B0CFL0 6.69e-104 317 41 2 406 3 proA Gamma-glutamyl phosphate reductase Acaryochloris marina (strain MBIC 11017)
A1URN6 6.88e-104 317 41 3 413 3 proA Gamma-glutamyl phosphate reductase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q3ARL1 7.2e-104 317 42 5 408 3 proA Gamma-glutamyl phosphate reductase Chlorobium chlorochromatii (strain CaD3)
A6WXS2 8.27e-104 317 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q9HHA1 1.36e-103 317 39 4 409 3 proA Gamma-glutamyl phosphate reductase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A9GVS8 1.49e-103 316 44 3 403 3 proA Gamma-glutamyl phosphate reductase Sorangium cellulosum (strain So ce56)
A9M880 1.52e-103 316 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A2C148 1.57e-103 317 38 2 414 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain NATL1A)
Q46LW0 1.95e-103 316 38 2 414 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain NATL2A)
Q8FYM3 2.03e-103 316 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella suis biovar 1 (strain 1330)
B9JER3 3.57e-103 315 39 3 420 3 proA Gamma-glutamyl phosphate reductase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A9IMB2 3.74e-103 315 41 5 416 3 proA Gamma-glutamyl phosphate reductase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q2RV06 3.97e-103 315 43 1 362 3 proA Gamma-glutamyl phosphate reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8PYP2 6.16e-103 315 39 4 409 3 proA Gamma-glutamyl phosphate reductase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
C0RF92 9.04e-103 314 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella melitensis biotype 2 (strain ATCC 23457)
Q8YJ78 1.5e-102 313 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A9C1G5 1.75e-102 313 41 1 414 3 proA Gamma-glutamyl phosphate reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
A5VSI3 1.87e-102 313 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57B47 2.58e-102 313 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella abortus biovar 1 (strain 9-941)
Q2YLI7 2.58e-102 313 39 2 417 3 proA Gamma-glutamyl phosphate reductase Brucella abortus (strain 2308)
Q0AL88 2.89e-102 313 40 2 415 3 proA Gamma-glutamyl phosphate reductase Maricaulis maris (strain MCS10)
Q46F78 3.4e-102 313 39 4 409 3 proA Gamma-glutamyl phosphate reductase Methanosarcina barkeri (strain Fusaro / DSM 804)
A9WWW7 6.25e-102 312 39 3 417 3 proA Gamma-glutamyl phosphate reductase Brucella suis (strain ATCC 23445 / NCTC 10510)
A2BVQ3 7.18e-102 312 39 4 406 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9515)
Q0BWP1 8.66e-102 311 40 2 413 3 proA Gamma-glutamyl phosphate reductase Hyphomonas neptunium (strain ATCC 15444)
A5GJS5 9.12e-102 312 41 2 412 3 proA Gamma-glutamyl phosphate reductase Synechococcus sp. (strain WH7803)
Q72AN9 1.01e-101 311 43 1 387 3 proA Gamma-glutamyl phosphate reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VCR9 1.2e-101 311 43 1 387 3 proA Gamma-glutamyl phosphate reductase Nitratidesulfovibrio vulgaris (strain DP4)
B1XLA4 1.22e-101 311 40 3 409 3 proA Gamma-glutamyl phosphate reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q31BU4 1.23e-101 311 39 2 406 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9312)
A3PBW4 2.99e-101 311 39 3 415 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9301)
Q7V293 4.41e-101 310 37 2 411 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B1MX68 6.99e-101 309 40 2 415 3 proA Gamma-glutamyl phosphate reductase Leuconostoc citreum (strain KM20)
Q7VBM1 1.6e-100 309 40 2 403 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8KCE9 1.65e-100 308 40 6 413 3 proA Gamma-glutamyl phosphate reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q4JWT3 1.87e-100 308 41 2 410 3 proA Gamma-glutamyl phosphate reductase Corynebacterium jeikeium (strain K411)
Q03ZF1 2.57e-100 307 39 2 415 3 proA Gamma-glutamyl phosphate reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q2IMG0 3.47e-100 308 44 0 401 3 proA Gamma-glutamyl phosphate reductase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q8UBS1 4.49e-100 307 39 2 417 3 proA Gamma-glutamyl phosphate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
B0SRT9 4.5e-100 307 39 4 396 3 proA Gamma-glutamyl phosphate reductase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S9A5 4.5e-100 307 39 4 396 3 proA Gamma-glutamyl phosphate reductase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01770
Feature type CDS
Gene proA
Product glutamate-5-semialdehyde dehydrogenase
Location 419577 - 420830 (strand: 1)
Length 1254 (nucleotides) / 417 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2069
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00171 Aldehyde dehydrogenase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0014 Amino acid transport and metabolism (E) E Gamma-glutamyl phosphate reductase

Kegg Ortholog Annotation(s)

Protein Sequence

MLEQMGKAAREASWHLAQLSTEQKNQALLVIADLLEQQEAIILAANEKDMVAARESNINAAMLDRLLLTSERLKAIADDVRQVCHLEDPVGQVIDGRLLDSGLRLERRRVPLGVVGVIYEARPNVTIDVASLCLKTGNAAILRGGKETHHTNQAVVAVIQQALETCAIPAAAIQAIDKPDRELVAKMLKMDEYIDMLIPRGGAGLHKLCREQSTIPVITGGIGVCHTFVDESADLDQALNVIINAKVQRPSACNSLETLLVHEAIAESFLPQLSDAMAAQKVTLHASQRAITALKKGRATVVDVTEADYCDEWLSLDLNVEVVNDLTAAIAHIRQYGTAHSDAILTQSISHADRFVRQVDSAAVYVNASTRFTDGGQFGLGAEVAVSTQKLHARGPMGLDALTTYKWIGYGDNTLRR

Flanking regions ( +/- flanking 50bp)

AGTGTTGCGGTTCACCGTGATGATATGATTGTGAGCTAGGGAGTATAAATATGTTAGAACAAATGGGAAAAGCGGCGCGAGAAGCTTCTTGGCACTTAGCTCAGCTATCAACCGAACAAAAAAATCAGGCACTGTTAGTCATCGCTGATTTATTAGAGCAGCAAGAAGCCATTATTCTTGCTGCTAATGAAAAAGATATGGTGGCGGCACGAGAGTCTAATATTAATGCTGCAATGCTTGATCGTTTATTACTCACATCAGAACGTTTAAAAGCGATCGCTGATGATGTTCGCCAAGTTTGTCATCTAGAAGATCCTGTAGGTCAAGTGATAGATGGTCGTTTATTAGACAGTGGCTTACGTTTAGAACGCCGCCGAGTCCCTTTAGGGGTTGTTGGCGTTATTTACGAAGCTCGTCCAAATGTGACTATAGATGTAGCATCTTTATGCTTAAAAACAGGGAATGCGGCTATTCTCCGTGGCGGAAAAGAGACTCACCATACTAACCAAGCCGTTGTCGCGGTGATCCAGCAAGCACTAGAAACATGCGCTATTCCTGCGGCTGCTATTCAAGCTATCGATAAGCCAGATCGTGAATTAGTCGCAAAAATGCTAAAAATGGATGAGTATATTGATATGCTTATTCCTCGAGGTGGTGCAGGATTACATAAGTTATGTCGTGAACAATCCACTATTCCTGTGATCACGGGGGGGATTGGTGTTTGTCACACCTTTGTTGACGAAAGTGCTGATTTAGACCAAGCATTAAATGTTATTATTAATGCTAAAGTACAGCGTCCAAGCGCATGTAATTCGTTAGAAACGTTATTGGTACATGAAGCTATTGCGGAGAGTTTCTTACCTCAATTAAGTGATGCGATGGCAGCACAAAAGGTTACTTTGCATGCCAGTCAACGCGCTATAACTGCATTGAAAAAGGGACGTGCGACGGTCGTCGATGTGACTGAAGCAGATTATTGTGATGAATGGTTATCACTGGATCTGAATGTTGAAGTCGTTAATGATTTAACAGCGGCAATTGCTCATATTCGCCAATATGGTACCGCGCACTCAGATGCTATTTTAACGCAATCTATCAGCCATGCTGATCGCTTTGTACGCCAAGTTGATTCTGCTGCGGTATATGTGAATGCTAGTACACGTTTTACAGATGGTGGACAGTTTGGCTTAGGTGCTGAAGTAGCGGTGAGTACACAAAAGCTACATGCACGAGGCCCTATGGGATTAGATGCTCTAACCACCTATAAATGGATTGGTTACGGCGACAATACATTACGTCGCTAATAATCCCTTAAATAGCTAAGCCATACTTTCATAAAGTGTGGCTTTATTTT