Homologs in group_2069

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15210 FBDBKF_15210 100.0 Morganella morganii S1 proA glutamate-5-semialdehyde dehydrogenase
NLDBIP_11380 NLDBIP_11380 100.0 Morganella morganii S4 proA glutamate-5-semialdehyde dehydrogenase
LHKJJB_11240 LHKJJB_11240 100.0 Morganella morganii S3 proA glutamate-5-semialdehyde dehydrogenase
HKOGLL_09850 HKOGLL_09850 100.0 Morganella morganii S5 proA glutamate-5-semialdehyde dehydrogenase
F4V73_RS12235 F4V73_RS12235 89.7 Morganella psychrotolerans proA glutamate-5-semialdehyde dehydrogenase
PMI_RS01770 PMI_RS01770 74.3 Proteus mirabilis HI4320 proA glutamate-5-semialdehyde dehydrogenase

Distribution of the homologs in the orthogroup group_2069

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2069

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N7B1 0.0 653 75 0 416 3 proA Gamma-glutamyl phosphate reductase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8AKP4 0.0 631 73 0 417 3 proA Gamma-glutamyl phosphate reductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4W6X5 0.0 630 73 0 417 3 proA Gamma-glutamyl phosphate reductase Enterobacter sp. (strain 638)
B1JIH2 0.0 629 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DY8 0.0 629 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K6Q4 0.0 629 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FLI1 0.0 629 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6T561 0.0 629 73 0 417 3 proA Gamma-glutamyl phosphate reductase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4TPK0 0.0 628 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis (strain Pestoides F)
Q1CLC6 0.0 628 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2X0 0.0 628 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC09 0.0 628 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis
Q1C4E7 0.0 628 73 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia pestis bv. Antiqua (strain Antiqua)
B5Y169 0.0 627 73 0 417 3 proA Gamma-glutamyl phosphate reductase Klebsiella pneumoniae (strain 342)
A1JNX6 0.0 626 72 0 417 3 proA Gamma-glutamyl phosphate reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P17857 0.0 625 73 0 417 3 proA Gamma-glutamyl phosphate reductase Serratia marcescens
B7UJD1 0.0 624 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LNF7 0.0 623 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N8H4 0.0 622 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B5Z1I7 0.0 622 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7N4 0.0 622 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O157:H7
Q83SH9 0.0 621 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri
Q0T7R6 0.0 621 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella flexneri serotype 5b (strain 8401)
Q6D1I4 0.0 621 72 0 417 3 proA Gamma-glutamyl phosphate reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GAD4 0.0 619 72 0 417 3 proA Gamma-glutamyl phosphate reductase Serratia proteamaculans (strain 568)
A7MI49 0.0 619 72 0 417 3 proA Gamma-glutamyl phosphate reductase Cronobacter sakazakii (strain ATCC BAA-894)
B4EUV1 0.0 613 74 0 416 3 proA Gamma-glutamyl phosphate reductase Proteus mirabilis (strain HI4320)
A9MNR4 0.0 612 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C6DCX4 0.0 610 72 0 417 3 proA Gamma-glutamyl phosphate reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5EWK6 0.0 610 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella agona (strain SL483)
B7MQ79 0.0 610 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O81 (strain ED1a)
Q2NVE9 0.0 609 71 0 416 3 proA Gamma-glutamyl phosphate reductase Sodalis glossinidius (strain morsitans)
B4TZ91 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella schwarzengrund (strain CVM19633)
B5BDP7 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain AKU_12601)
C0Q6U2 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi C (strain RKS4594)
Q5PF69 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57ST2 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella choleraesuis (strain SC-B67)
Q1RFS7 0.0 609 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain UTI89 / UPEC)
A1A7V4 0.0 609 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O1:K1 / APEC
B7MC93 0.0 609 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B4SVW6 0.0 609 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella newport (strain SL254)
B7NK82 0.0 608 73 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q8FKM3 0.0 608 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A9MY02 0.0 608 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T7Q6 0.0 608 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella heidelberg (strain SL476)
Q32J27 0.0 607 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella dysenteriae serotype 1 (strain Sd197)
B5R5R9 0.0 607 70 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R4S6 0.0 607 70 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella enteritidis PT4 (strain P125109)
B5FJX5 0.0 607 70 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella dublin (strain CT_02021853)
P40861 0.0 607 71 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3Z594 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella sonnei (strain Ss046)
P07004 0.0 606 72 0 417 1 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12)
B1J0Z1 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XDY6 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12 / DH10B)
C4ZTA0 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B1LHT9 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain SMS-3-5 / SECEC)
Q0TL73 0.0 606 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q325P3 0.0 605 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella boydii serotype 4 (strain Sb227)
B2U3T4 0.0 605 72 0 417 3 proA Gamma-glutamyl phosphate reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z932 0.0 602 70 1 417 3 proA Gamma-glutamyl phosphate reductase Salmonella typhi
B6I023 0.0 602 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain SE11)
A7ZWK6 0.0 602 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O9:H4 (strain HS)
B7M272 0.0 602 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O8 (strain IAI1)
A7ZI02 0.0 602 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7L3Z5 0.0 601 72 0 417 3 proA Gamma-glutamyl phosphate reductase Escherichia coli (strain 55989 / EAEC)
B2VHM6 0.0 598 70 0 416 3 proA Gamma-glutamyl phosphate reductase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9CM98 0.0 568 66 0 416 3 proA Gamma-glutamyl phosphate reductase Pasteurella multocida (strain Pm70)
Q65S49 0.0 561 65 0 416 3 proA Gamma-glutamyl phosphate reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A5UF66 0.0 558 64 0 416 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain PittGG)
P45121 0.0 556 64 0 416 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I2E5 0.0 555 65 0 415 3 proA Gamma-glutamyl phosphate reductase Histophilus somni (strain 129Pt)
Q4QJW6 0.0 555 64 0 416 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain 86-028NP)
B0USH2 0.0 554 65 0 415 3 proA Gamma-glutamyl phosphate reductase Histophilus somni (strain 2336)
A5UBQ2 0.0 552 63 0 416 3 proA Gamma-glutamyl phosphate reductase Haemophilus influenzae (strain PittEE)
A6VMV2 0.0 543 63 1 416 3 proA Gamma-glutamyl phosphate reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B3H321 0.0 521 62 2 416 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N3P3 0.0 521 62 2 416 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B0BTX9 0.0 521 62 2 416 3 proA Gamma-glutamyl phosphate reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B8F6K8 0.0 516 61 1 413 3 proA Gamma-glutamyl phosphate reductase Glaesserella parasuis serovar 5 (strain SH0165)
Q87RU9 0.0 515 60 2 416 3 proA Gamma-glutamyl phosphate reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0KNQ8 0.0 514 61 1 416 3 proA Gamma-glutamyl phosphate reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SJF6 0.0 512 61 1 414 3 proA Gamma-glutamyl phosphate reductase Aeromonas salmonicida (strain A449)
C4LBK4 2.81e-178 506 60 1 414 3 proA Gamma-glutamyl phosphate reductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9KPT9 7.9e-177 502 60 3 418 3 proA Gamma-glutamyl phosphate reductase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F602 7.9e-177 502 60 3 418 3 proA Gamma-glutamyl phosphate reductase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A8FYU6 1.3e-176 502 59 0 416 3 proA Gamma-glutamyl phosphate reductase Shewanella sediminis (strain HAW-EB3)
Q7MN58 2.04e-176 501 59 2 413 3 proA Gamma-glutamyl phosphate reductase Vibrio vulnificus (strain YJ016)
Q8DF94 5.65e-176 500 59 3 416 3 proA Gamma-glutamyl phosphate reductase Vibrio vulnificus (strain CMCP6)
Q6LTX2 5.99e-176 500 58 0 415 3 proA Gamma-glutamyl phosphate reductase Photobacterium profundum (strain SS9)
B8CKF0 6.8e-173 493 57 0 416 3 proA Gamma-glutamyl phosphate reductase Shewanella piezotolerans (strain WP3 / JCM 13877)
B0TQC4 3.1e-172 491 57 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella halifaxensis (strain HAW-EB4)
B7VJB0 9.86e-172 489 58 2 415 3 proA Gamma-glutamyl phosphate reductase Vibrio atlanticus (strain LGP32)
Q5E6W0 4.67e-171 488 60 3 418 3 proA Gamma-glutamyl phosphate reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FBJ5 1.26e-170 487 60 3 418 3 proA Gamma-glutamyl phosphate reductase Aliivibrio fischeri (strain MJ11)
B1KD27 4.75e-169 483 56 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella woodyi (strain ATCC 51908 / MS32)
A8H764 4.06e-168 480 57 0 415 3 proA Gamma-glutamyl phosphate reductase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A5URC6 7.19e-168 480 57 3 421 3 proA Gamma-glutamyl phosphate reductase Roseiflexus sp. (strain RS-1)
A1SYT9 3.85e-166 475 57 1 415 3 proA Gamma-glutamyl phosphate reductase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8EHU1 7.1e-163 467 57 0 416 3 proA Gamma-glutamyl phosphate reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A7NSB7 2.4e-162 466 59 2 385 3 proA Gamma-glutamyl phosphate reductase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B8G8E0 4.23e-158 455 54 2 420 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aggregans (strain MD-66 / DSM 9485)
A1S8L1 5.72e-154 444 57 1 415 3 proA Gamma-glutamyl phosphate reductase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B9LE47 7.78e-153 442 55 2 420 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WBM7 7.78e-153 442 55 2 420 3 proA Gamma-glutamyl phosphate reductase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q9WYC9 1.69e-142 415 48 4 419 1 proA Gamma-glutamyl phosphate reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1L9J9 1.76e-142 415 48 4 419 3 proA Gamma-glutamyl phosphate reductase Thermotoga sp. (strain RQ2)
A5IKB6 4.86e-142 414 47 4 420 3 proA Gamma-glutamyl phosphate reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q3Z6Z9 9.54e-142 414 49 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q2RKZ6 3.92e-139 407 50 1 415 3 proA Gamma-glutamyl phosphate reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8XHA7 6.38e-139 406 49 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain 13 / Type A)
Q0SPX8 7.27e-139 406 49 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain SM101 / Type A)
A5FQ48 7.49e-139 406 49 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3ZYH9 1.33e-138 405 49 1 416 3 proA Gamma-glutamyl phosphate reductase Dehalococcoides mccartyi (strain CBDB1)
Q82C81 1.38e-138 405 52 0 394 3 proA Gamma-glutamyl phosphate reductase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
C5CE09 2.14e-138 405 46 1 415 3 proA Gamma-glutamyl phosphate reductase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q0TM73 4.16e-138 404 49 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B0TBV8 3.76e-137 402 49 1 411 3 proA Gamma-glutamyl phosphate reductase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q92CE5 6.4e-137 401 47 1 416 3 proA Gamma-glutamyl phosphate reductase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93Q55 2.29e-136 399 47 1 416 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A6LPD5 4.79e-136 399 46 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q896G4 1.87e-135 398 47 2 418 3 proA Gamma-glutamyl phosphate reductase Clostridium tetani (strain Massachusetts / E88)
B2THG5 2.04e-135 397 46 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium botulinum (strain Eklund 17B / Type B)
Q8RAE5 5.86e-135 396 46 1 415 3 proA Gamma-glutamyl phosphate reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A6Q3B4 9.46e-135 395 47 1 415 3 proA Gamma-glutamyl phosphate reductase Nitratiruptor sp. (strain SB155-2)
A0AI64 1.09e-134 395 46 1 416 3 proA Gamma-glutamyl phosphate reductase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B8D0Y6 1.12e-134 395 50 3 417 3 proA Gamma-glutamyl phosphate reductase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B2UX78 1.2e-134 395 46 1 411 3 proA Gamma-glutamyl phosphate reductase Clostridium botulinum (strain Alaska E43 / Type E3)
A0PXA4 1.8e-134 395 47 2 408 3 proA Gamma-glutamyl phosphate reductase Clostridium novyi (strain NT)
B1VXE5 3.27e-134 394 51 1 392 3 proA Gamma-glutamyl phosphate reductase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C0QS00 4.76e-134 395 47 2 419 3 proA Gamma-glutamyl phosphate reductase Persephonella marina (strain DSM 14350 / EX-H1)
Q3AF39 5.29e-134 394 50 2 400 3 proA Gamma-glutamyl phosphate reductase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A9KMV0 2.2e-133 392 47 2 412 3 proA Gamma-glutamyl phosphate reductase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q47MW1 2.66e-133 392 50 1 398 3 proA Gamma-glutamyl phosphate reductase Thermobifida fusca (strain YX)
Q839W3 3.16e-133 392 47 2 417 3 proA Gamma-glutamyl phosphate reductase Enterococcus faecalis (strain ATCC 700802 / V583)
Q9RDK1 1.98e-132 390 50 0 401 3 proA Gamma-glutamyl phosphate reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8DHP3 6.5e-132 388 46 1 414 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4a (strain HCC23)
C1L2G7 1.83e-131 387 45 1 416 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5KYA2 1.91e-131 387 49 5 421 3 proA Gamma-glutamyl phosphate reductase Geobacillus kaustophilus (strain HTA426)
Q0AWJ6 2.6e-131 387 46 2 416 3 proA Gamma-glutamyl phosphate reductase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q720G3 3.59e-131 386 45 1 416 3 proA Gamma-glutamyl phosphate reductase Listeria monocytogenes serotype 4b (strain F2365)
Q97E62 4.28e-131 386 46 2 414 3 proA Gamma-glutamyl phosphate reductase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B0K9C5 1.19e-130 385 47 1 401 3 proA Gamma-glutamyl phosphate reductase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K0T2 1.41e-130 385 47 1 401 3 proA Gamma-glutamyl phosphate reductase Thermoanaerobacter sp. (strain X514)
C4Z9V4 1.55e-130 385 47 2 418 3 proA Gamma-glutamyl phosphate reductase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q3J7T1 1.65e-130 385 46 1 415 3 proA Gamma-glutamyl phosphate reductase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6AFX9 5.29e-130 384 50 2 411 3 proA Gamma-glutamyl phosphate reductase Leifsonia xyli subsp. xyli (strain CTCB07)
B5YEQ8 6.42e-130 383 45 2 411 3 proA Gamma-glutamyl phosphate reductase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
A5N0V1 1.39e-129 382 46 1 413 3 proA Gamma-glutamyl phosphate reductase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E4Q5 1.39e-129 382 46 1 413 3 proA Gamma-glutamyl phosphate reductase Clostridium kluyveri (strain NBRC 12016)
B4U4K6 1.67e-129 382 47 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B5YK66 1.93e-129 382 46 2 410 3 proA Gamma-glutamyl phosphate reductase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A4IPN4 2.29e-129 382 48 3 408 3 proA Gamma-glutamyl phosphate reductase Geobacillus thermodenitrificans (strain NG80-2)
B2V9F3 4.57e-129 382 45 2 418 3 proA Gamma-glutamyl phosphate reductase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q2YBP9 5.99e-129 381 48 2 415 3 proA Gamma-glutamyl phosphate reductase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B8E0D2 6.11e-129 380 45 3 417 3 proA Gamma-glutamyl phosphate reductase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
O67166 6.48e-129 381 44 1 419 3 proA Gamma-glutamyl phosphate reductase Aquifex aeolicus (strain VF5)
B9MK80 6.89e-129 380 45 0 415 3 proA Gamma-glutamyl phosphate reductase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B9L9A2 1.33e-128 380 45 1 415 3 proA Gamma-glutamyl phosphate reductase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
C5D2V2 2e-128 379 47 3 415 3 proA Gamma-glutamyl phosphate reductase Geobacillus sp. (strain WCH70)
A8MFQ5 3.15e-128 379 44 3 416 3 proA Gamma-glutamyl phosphate reductase Alkaliphilus oremlandii (strain OhILAs)
C4Z075 3.97e-128 379 46 1 415 3 proA Gamma-glutamyl phosphate reductase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A6QB48 4.09e-128 378 46 1 415 3 proA Gamma-glutamyl phosphate reductase Sulfurovum sp. (strain NBC37-1)
A4XK60 4.38e-128 379 45 0 415 3 proA Gamma-glutamyl phosphate reductase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B9DV79 8.59e-128 378 46 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B0U111 8.77e-128 378 44 1 413 3 proA Gamma-glutamyl phosphate reductase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1WRR6 1.3e-127 377 45 2 416 3 proA Gamma-glutamyl phosphate reductase Ligilactobacillus salivarius (strain UCC118)
Q8G5H9 1.99e-127 377 47 2 417 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium longum (strain NCC 2705)
B3E3M7 2.61e-127 377 46 2 413 3 proA Gamma-glutamyl phosphate reductase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q6FEN5 1.14e-126 375 46 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A2RJM8 1.58e-126 374 45 3 418 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. cremoris (strain MG1363)
Q02XW0 2.91e-126 374 45 3 418 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. cremoris (strain SK11)
B3WA82 3.99e-126 374 48 2 415 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus casei (strain BL23)
Q30SG0 4.85e-126 373 45 1 406 3 proA Gamma-glutamyl phosphate reductase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A1A1U9 5.6e-126 374 47 2 415 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q9CF73 7.92e-126 373 45 3 418 3 proA Gamma-glutamyl phosphate reductase Lactococcus lactis subsp. lactis (strain IL1403)
Q99YJ8 9.74e-126 372 46 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M1
B7GTL2 1.15e-125 373 46 2 417 3 proA Gamma-glutamyl phosphate reductase Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B8FM70 1.35e-125 372 46 2 414 3 proA Gamma-glutamyl phosphate reductase Desulfatibacillum aliphaticivorans
Q1J5F6 1.36e-125 372 46 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M4 (strain MGAS10750)
A1AUT0 2.77e-125 371 46 1 413 3 proA Gamma-glutamyl phosphate reductase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B2G5W8 6.25e-125 370 46 2 412 3 proA Gamma-glutamyl phosphate reductase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIE0 6.25e-125 370 46 2 412 3 proA Gamma-glutamyl phosphate reductase Limosilactobacillus reuteri (strain DSM 20016)
P0DD21 6.97e-125 370 46 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DD20 6.97e-125 370 46 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q48RY7 7.2e-125 370 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RD38 7.2e-125 370 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JAG3 7.2e-125 370 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8NZX9 7.2e-125 370 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XAL0 7.2e-125 370 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q035M3 8.21e-125 370 48 2 415 3 proA Gamma-glutamyl phosphate reductase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A4X1X0 1.23e-124 370 49 2 393 3 proA Gamma-glutamyl phosphate reductase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A9VK31 1.28e-124 370 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus mycoides (strain KBAB4)
B7GJH1 1.7e-124 369 47 3 411 3 proA Gamma-glutamyl phosphate reductase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q03J03 2.99e-124 369 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q7UNV2 3.23e-124 369 45 2 413 3 proA Gamma-glutamyl phosphate reductase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q6HHC2 4.19e-124 368 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JD15 4.19e-124 368 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain AH820)
A8EVN0 4.62e-124 368 42 1 415 3 proA Gamma-glutamyl phosphate reductase Aliarcobacter butzleri (strain RM4018)
Q8DVM9 5.1e-124 368 47 4 421 3 proA Gamma-glutamyl phosphate reductase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
B5XML5 8.22e-124 367 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M49 (strain NZ131)
P96489 8.59e-124 367 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus
Q5M2U1 9.89e-124 367 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LY84 9.89e-124 367 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus thermophilus (strain CNRZ 1066)
Q1JKL4 1.03e-123 367 45 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pyogenes serotype M12 (strain MGAS9429)
B0V4S6 1.45e-123 367 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AYE)
B7I5F5 1.45e-123 367 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AB0057)
B7H081 1.45e-123 367 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain AB307-0294)
Q8E783 1.65e-123 367 45 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype III (strain NEM316)
Q65IS9 1.72e-123 367 46 2 396 3 proA2 Gamma-glutamyl phosphate reductase 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q65KU7 1.94e-123 367 48 2 396 3 proA1 Gamma-glutamyl phosphate reductase 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q2LU85 1.96e-123 367 45 1 416 3 proA Gamma-glutamyl phosphate reductase Syntrophus aciditrophicus (strain SB)
B2I3D3 2.93e-123 366 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain ACICU)
Q24XR6 3.31e-123 366 47 4 412 3 proA Gamma-glutamyl phosphate reductase Desulfitobacterium hafniense (strain Y51)
Q639W9 4.2e-123 366 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain ZK / E33L)
Q2JDN7 4.29e-123 366 51 1 393 3 proA Gamma-glutamyl phosphate reductase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B0VKT1 4.48e-123 366 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain SDF)
Q3A1E0 8.42e-123 365 47 3 417 3 proA Gamma-glutamyl phosphate reductase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A3M1Z8 8.79e-123 365 45 1 415 3 proA Gamma-glutamyl phosphate reductase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q8E1R9 8.99e-123 365 45 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K395 8.99e-123 365 45 2 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A6TUA0 1.06e-122 365 43 3 416 3 proA Gamma-glutamyl phosphate reductase Alkaliphilus metalliredigens (strain QYMF)
A4VTT5 1.34e-122 364 46 5 409 3 proA Gamma-glutamyl phosphate reductase Streptococcus suis (strain 05ZYH33)
A4W028 1.34e-122 364 46 5 409 3 proA Gamma-glutamyl phosphate reductase Streptococcus suis (strain 98HAH33)
B1ZMC1 1.4e-122 365 48 1 418 3 proA Gamma-glutamyl phosphate reductase Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B9J498 1.51e-122 364 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain Q1)
B7HVK6 1.51e-122 364 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain AH187)
C1EZ15 2.81e-122 363 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain 03BB102)
A1U3C3 4.54e-122 363 46 2 416 3 proA Gamma-glutamyl phosphate reductase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q7NQ51 4.95e-122 363 45 2 416 3 proA Gamma-glutamyl phosphate reductase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7M8Z4 5.46e-122 363 45 1 415 3 proA Gamma-glutamyl phosphate reductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A4XYY4 7.48e-122 363 47 3 420 3 proA Gamma-glutamyl phosphate reductase Pseudomonas mendocina (strain ymp)
B9M0D6 8.25e-122 362 45 1 401 3 proA Gamma-glutamyl phosphate reductase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
A8ZRY3 1.03e-121 362 48 1 394 3 proA Gamma-glutamyl phosphate reductase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q1IZP1 1.1e-121 362 53 3 360 3 proA Gamma-glutamyl phosphate reductase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q735X3 2.58e-121 361 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain ATCC 10987 / NRS 248)
B8FUB6 4.64e-121 360 46 4 412 3 proA Gamma-glutamyl phosphate reductase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q81P27 5.12e-121 360 45 2 411 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis
C3LEW9 5.12e-121 360 45 2 411 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3NZU4 5.12e-121 360 45 2 411 3 proA Gamma-glutamyl phosphate reductase Bacillus anthracis (strain A0248)
Q8CUQ4 6.03e-121 360 43 2 413 3 proA Gamma-glutamyl phosphate reductase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q747Q4 6.09e-121 360 45 2 401 3 proA Gamma-glutamyl phosphate reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A4F9M1 8.53e-121 361 46 2 401 3 proA Gamma-glutamyl phosphate reductase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A4VR07 8.71e-121 360 45 1 416 3 proA Gamma-glutamyl phosphate reductase Stutzerimonas stutzeri (strain A1501)
A4T2I0 1.49e-120 359 49 2 400 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium gilvum (strain PYR-GCK)
A4SVE2 1.53e-120 359 43 3 420 3 proA Gamma-glutamyl phosphate reductase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q87VV6 1.55e-120 359 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1SHP5 1.63e-120 360 46 1 404 3 proA Gamma-glutamyl phosphate reductase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A1TC11 1.66e-120 359 48 1 398 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q4ZN73 1.93e-120 359 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas syringae pv. syringae (strain B728a)
A8AX77 2.03e-120 359 44 5 423 3 proA Gamma-glutamyl phosphate reductase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A6T242 2.17e-120 359 44 3 417 3 proA Gamma-glutamyl phosphate reductase Janthinobacterium sp. (strain Marseille)
C1D6E4 3.18e-120 358 45 1 415 3 proA Gamma-glutamyl phosphate reductase Laribacter hongkongensis (strain HLHK9)
Q48DL4 3.35e-120 358 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A8M064 3.87e-120 358 48 1 401 3 proA Gamma-glutamyl phosphate reductase Salinispora arenicola (strain CNS-205)
Q2SA27 4.17e-120 358 45 4 416 3 proA Gamma-glutamyl phosphate reductase Hahella chejuensis (strain KCTC 2396)
A3CMT1 5.23e-120 358 45 4 401 3 proA Gamma-glutamyl phosphate reductase Streptococcus sanguinis (strain SK36)
B5EEI4 6.3e-120 358 44 1 408 3 proA Gamma-glutamyl phosphate reductase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q0AEA6 7.82e-120 358 46 1 393 3 proA Gamma-glutamyl phosphate reductase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A4J3Q0 1.33e-119 357 43 2 415 3 proA Gamma-glutamyl phosphate reductase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B7V8A7 1.39e-119 357 49 3 374 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain LESB58)
Q5QY68 1.42e-119 357 43 3 401 3 proA Gamma-glutamyl phosphate reductase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q9HX20 1.58e-119 357 49 3 374 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0ABN0 2.5e-119 356 44 2 416 3 proA Gamma-glutamyl phosphate reductase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q02SH4 2.67e-119 356 49 3 374 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain UCBPP-PA14)
C1DMQ0 2.73e-119 356 47 4 416 3 proA Gamma-glutamyl phosphate reductase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q2S354 3.52e-119 357 47 3 403 3 proA Gamma-glutamyl phosphate reductase Salinibacter ruber (strain DSM 13855 / M31)
Q6AK09 3.62e-119 356 44 1 414 3 proA Gamma-glutamyl phosphate reductase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C6E7L9 4.35e-119 355 44 3 409 3 proA Gamma-glutamyl phosphate reductase Geobacter sp. (strain M21)
Q47UQ0 8.18e-119 355 43 2 413 3 proA Gamma-glutamyl phosphate reductase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A0R115 1.25e-118 355 47 1 401 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q73XR2 1.41e-118 355 48 1 401 3 proA Gamma-glutamyl phosphate reductase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q31IE5 1.93e-118 354 44 1 415 3 proA Gamma-glutamyl phosphate reductase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1I4F0 4.21e-118 353 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas entomophila (strain L48)
A6V0A3 4.26e-118 353 49 3 374 3 proA Gamma-glutamyl phosphate reductase Pseudomonas aeruginosa (strain PA7)
A5G906 4.31e-118 353 44 2 415 3 proA Gamma-glutamyl phosphate reductase Geotalea uraniireducens (strain Rf4)
C5BNN0 5.84e-118 353 44 1 414 3 proA Gamma-glutamyl phosphate reductase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q9RTD9 6.53e-118 353 49 5 423 3 proA Gamma-glutamyl phosphate reductase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q39JM2 7.01e-118 353 44 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q5P255 7.89e-118 353 43 1 418 3 proA Gamma-glutamyl phosphate reductase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A0LPG2 1.16e-117 352 44 1 413 3 proA Gamma-glutamyl phosphate reductase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A4G8E9 2.67e-117 351 43 1 415 3 proA Gamma-glutamyl phosphate reductase Herminiimonas arsenicoxydans
A0LCZ1 2.78e-117 351 44 1 417 3 proA Gamma-glutamyl phosphate reductase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q4K5F9 3.24e-117 351 45 2 416 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1B639 3.32e-117 351 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain MCS)
A1UIZ7 3.32e-117 351 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain KMS)
A3Q2E3 3.32e-117 351 46 1 401 3 proA Gamma-glutamyl phosphate reductase Mycobacterium sp. (strain JLS)
C3K2M9 3.57e-117 351 45 2 416 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain SBW25)
B2JGX3 4.69e-117 350 44 1 411 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A7Z3T1 5.91e-117 350 47 1 394 3 proA Gamma-glutamyl phosphate reductase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A1KAH8 7.41e-117 350 45 1 418 3 proA Gamma-glutamyl phosphate reductase Azoarcus sp. (strain BH72)
Q054P8 9.42e-117 350 43 2 416 3 proA Gamma-glutamyl phosphate reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04Q92 9.42e-117 350 43 2 416 3 proA Gamma-glutamyl phosphate reductase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q47IN4 1.22e-116 349 44 1 415 3 proA Gamma-glutamyl phosphate reductase Dechloromonas aromatica (strain RCB)
Q820I7 2.14e-116 349 47 1 393 3 proA Gamma-glutamyl phosphate reductase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P9WHV1 2.64e-116 348 48 1 396 1 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHV0 2.64e-116 348 48 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5C2 2.64e-116 348 48 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AQZ3 2.64e-116 348 48 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLC0 2.64e-116 348 48 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65789 2.64e-116 348 48 1 396 3 proA Gamma-glutamyl phosphate reductase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q890J4 3.01e-116 348 44 3 416 3 proA Gamma-glutamyl phosphate reductase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C6BSC1 3.61e-116 348 44 2 409 3 proA Gamma-glutamyl phosphate reductase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
P94872 4.21e-116 348 44 2 408 3 proA Gamma-glutamyl phosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q67LC2 4.62e-116 348 48 2 406 3 proA Gamma-glutamyl phosphate reductase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B0KJY5 4.68e-116 348 43 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain GB-1)
Q21FC9 5.63e-116 348 44 0 413 3 proA Gamma-glutamyl phosphate reductase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B4RLE6 7.31e-116 347 44 3 415 3 proA Gamma-glutamyl phosphate reductase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8D3 7.31e-116 347 44 3 415 3 proA Gamma-glutamyl phosphate reductase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4UVI0 7.33e-116 347 45 1 407 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain 8004)
Q0VN49 8.32e-116 347 44 2 418 3 proA Gamma-glutamyl phosphate reductase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q7NEF6 9.39e-116 347 44 4 416 3 proA Gamma-glutamyl phosphate reductase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q88DL4 1.28e-115 347 43 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9JZG3 2.03e-115 346 44 2 410 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B7H673 2.37e-115 346 45 1 411 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain B4264)
A5WH78 3.14e-115 346 43 2 421 3 proA Gamma-glutamyl phosphate reductase Psychrobacter sp. (strain PRwf-1)
A1KTV4 3.85e-115 345 45 2 410 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
C0QLF1 6.01e-115 345 43 2 417 3 proA Gamma-glutamyl phosphate reductase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q12SX8 1e-114 345 42 1 417 3 proA Gamma-glutamyl phosphate reductase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B7ILK1 1.04e-114 344 45 1 412 3 proA Gamma-glutamyl phosphate reductase Bacillus cereus (strain G9842)
P39821 1.07e-114 344 47 2 394 3 proA Gamma-glutamyl phosphate reductase Bacillus subtilis (strain 168)
A8L1V4 1.09e-114 344 50 2 404 3 proA Gamma-glutamyl phosphate reductase Parafrankia sp. (strain EAN1pec)
B1YTB0 1.2e-114 344 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia ambifaria (strain MC40-6)
Q1BZ67 1.34e-114 344 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia orbicola (strain AU 1054)
A0K4I3 1.34e-114 344 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia cenocepacia (strain HI2424)
Q72NQ9 1.82e-114 344 43 2 408 3 proA Gamma-glutamyl phosphate reductase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B0RS59 1.93e-114 343 44 1 407 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain B100)
Q8P8K3 2.37e-114 343 44 1 407 3 proA Gamma-glutamyl phosphate reductase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A4JBI4 2.59e-114 343 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q39QR2 2.66e-114 343 43 1 401 3 proA Gamma-glutamyl phosphate reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1QXB4 2.82e-114 343 45 1 416 3 proA Gamma-glutamyl phosphate reductase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q28Q10 3.02e-114 343 42 2 419 3 proA Gamma-glutamyl phosphate reductase Jannaschia sp. (strain CCS1)
B1J133 3.33e-114 343 44 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain W619)
B1JVH2 3.88e-114 343 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia orbicola (strain MC0-3)
Q1IS80 4.31e-114 342 47 6 403 3 proA Gamma-glutamyl phosphate reductase Koribacter versatilis (strain Ellin345)
A6WDM6 6.55e-114 343 48 2 411 3 proA Gamma-glutamyl phosphate reductase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q0BIB2 7.35e-114 342 43 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1GHC8 8.21e-114 342 43 1 417 3 proA Gamma-glutamyl phosphate reductase Ruegeria sp. (strain TM1040)
B2UC98 1.45e-113 342 42 1 414 3 proA Gamma-glutamyl phosphate reductase Ralstonia pickettii (strain 12J)
A9BJ18 1.74e-113 341 44 2 411 3 proA Gamma-glutamyl phosphate reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
A5W9J6 2.11e-113 341 43 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q97R94 2.48e-113 341 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q122S5 2.7e-113 342 43 3 419 3 proA Gamma-glutamyl phosphate reductase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3IEY7 3e-113 340 42 1 416 3 proA Gamma-glutamyl phosphate reductase Pseudoalteromonas translucida (strain TAC 125)
C1CDS9 4.46e-113 340 45 2 409 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain JJA)
Q9JUK8 6.18e-113 340 45 2 410 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B8ZP35 9.03e-113 340 45 2 409 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q0SH62 1.24e-112 339 47 3 400 3 proA Gamma-glutamyl phosphate reductase Rhodococcus jostii (strain RHA1)
C1CK18 1.59e-112 339 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain P1031)
Q5WH54 1.72e-112 338 42 2 412 3 proA Gamma-glutamyl phosphate reductase Shouchella clausii (strain KSM-K16)
B2SHW6 1.94e-112 338 44 2 408 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2G1 1.94e-112 338 44 2 408 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5CXP4 2e-112 338 41 2 419 3 proA Gamma-glutamyl phosphate reductase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q165Y8 2.29e-112 338 43 2 420 3 proA Gamma-glutamyl phosphate reductase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
A9LYY9 2.7e-112 338 45 2 410 3 proA Gamma-glutamyl phosphate reductase Neisseria meningitidis serogroup C (strain 053442)
C1CRW1 2.79e-112 338 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DQ60 2.79e-112 338 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04KZ2 2.79e-112 338 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1C6R4 3.36e-112 338 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain 70585)
B2IP88 3.43e-112 338 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain CGSP14)
Q8XVT6 3.6e-112 338 42 1 414 3 proA Gamma-glutamyl phosphate reductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5GZF2 4.47e-112 338 44 2 408 3 proA Gamma-glutamyl phosphate reductase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B4U8A0 5.24e-112 338 42 3 420 3 proA Gamma-glutamyl phosphate reductase Hydrogenobaculum sp. (strain Y04AAS1)
Q1GZB2 5.59e-112 337 43 1 416 3 proA Gamma-glutamyl phosphate reductase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A5CR34 7.41e-112 338 45 2 416 3 proA Gamma-glutamyl phosphate reductase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
P54903 8.39e-112 337 43 3 410 3 proA Gamma-glutamyl phosphate reductase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
O86053 1.22e-111 337 43 1 401 3 proA Gamma-glutamyl phosphate reductase Meiothermus ruber
Q13U85 1.3e-111 337 44 1 411 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia xenovorans (strain LB400)
Q5SH02 1.4e-111 336 43 3 410 3 proA Gamma-glutamyl phosphate reductase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q3SG61 2.54e-111 336 42 2 419 3 proA Gamma-glutamyl phosphate reductase Thiobacillus denitrificans (strain ATCC 25259)
B1IBA0 2.78e-111 336 44 3 414 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae (strain Hungary19A-6)
Q3K693 4.19e-111 335 43 1 415 3 proA Gamma-glutamyl phosphate reductase Pseudomonas fluorescens (strain Pf0-1)
A9HWX2 6.27e-111 335 43 2 412 3 proA Gamma-glutamyl phosphate reductase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q7WH30 9.38e-111 334 43 2 416 3 proA Gamma-glutamyl phosphate reductase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A6VZ85 1.02e-110 334 42 2 414 3 proA Gamma-glutamyl phosphate reductase Marinomonas sp. (strain MWYL1)
A1WCP4 1.16e-110 334 43 1 414 3 proA Gamma-glutamyl phosphate reductase Acidovorax sp. (strain JS42)
Q7VWZ0 1.19e-110 334 43 2 417 3 proA Gamma-glutamyl phosphate reductase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A1TVU4 1.24e-110 334 43 1 417 3 proA Gamma-glutamyl phosphate reductase Paracidovorax citrulli (strain AAC00-1)
B9MH63 1.39e-110 334 43 1 414 3 proA Gamma-glutamyl phosphate reductase Acidovorax ebreus (strain TPSY)
Q9CBZ7 1.51e-110 333 46 2 375 3 proA Gamma-glutamyl phosphate reductase Mycobacterium leprae (strain TN)
B8ZRN0 1.51e-110 333 46 2 375 3 proA Gamma-glutamyl phosphate reductase Mycobacterium leprae (strain Br4923)
B8J495 1.79e-110 334 45 1 416 3 proA Gamma-glutamyl phosphate reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q6A9H6 2.32e-110 333 44 4 409 3 proA Gamma-glutamyl phosphate reductase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q7W9M7 5.99e-110 332 43 2 416 3 proA Gamma-glutamyl phosphate reductase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q62H23 1.64e-109 331 42 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia mallei (strain ATCC 23344)
Q64Z29 1.78e-109 331 42 5 411 3 proA Gamma-glutamyl phosphate reductase Bacteroides fragilis (strain YCH46)
Q5LI24 1.78e-109 331 42 5 411 3 proA Gamma-glutamyl phosphate reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q9KCR5 1.8e-109 331 43 3 416 3 proA Gamma-glutamyl phosphate reductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B2SYN3 2.12e-109 331 43 1 411 3 proA Gamma-glutamyl phosphate reductase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q46XE1 4.1e-109 330 42 2 419 3 proA Gamma-glutamyl phosphate reductase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0K710 1.41e-108 329 42 2 419 3 proA Gamma-glutamyl phosphate reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LJ33 2.04e-108 328 42 1 395 3 proA Gamma-glutamyl phosphate reductase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q63QT9 2.8e-108 328 41 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia pseudomallei (strain K96243)
Q3JNN5 2.8e-108 328 41 1 411 3 proA Gamma-glutamyl phosphate reductase Burkholderia pseudomallei (strain 1710b)
Q3BSJ1 3.32e-108 328 45 1 368 3 proA Gamma-glutamyl phosphate reductase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q220P2 3.53e-108 328 41 3 432 3 proA Gamma-glutamyl phosphate reductase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A7GVZ7 4.49e-108 328 42 3 438 3 proA Gamma-glutamyl phosphate reductase Campylobacter curvus (strain 525.92)
Q0AL88 4.89e-108 327 41 2 415 3 proA Gamma-glutamyl phosphate reductase Maricaulis maris (strain MCS10)
B0SRT9 5.99e-108 327 42 4 411 3 proA Gamma-glutamyl phosphate reductase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S9A5 5.99e-108 327 42 4 411 3 proA Gamma-glutamyl phosphate reductase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A1AVH0 6.34e-108 327 40 1 416 3 proA Gamma-glutamyl phosphate reductase Ruthia magnifica subsp. Calyptogena magnifica
Q5LRY6 7e-108 327 42 2 416 3 proA Gamma-glutamyl phosphate reductase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B2HME9 8.82e-108 327 46 1 393 3 proA Gamma-glutamyl phosphate reductase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q2SZ88 1.23e-107 327 42 1 389 1 proA Gamma-glutamyl phosphate reductase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1VTR9 1.31e-107 327 40 2 422 3 proA Gamma-glutamyl phosphate reductase Polaromonas naphthalenivorans (strain CJ2)
B5E435 1.44e-107 326 44 3 417 3 proA Gamma-glutamyl phosphate reductase Streptococcus pneumoniae serotype 19F (strain G54)
Q7VI05 1.99e-107 325 42 4 409 3 proA Gamma-glutamyl phosphate reductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q04FB2 3.11e-107 325 41 3 412 3 proA Gamma-glutamyl phosphate reductase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q2KXE0 4e-107 325 41 1 412 3 proA Gamma-glutamyl phosphate reductase Bordetella avium (strain 197N)
A1WGI4 4.18e-107 325 42 3 415 3 proA Gamma-glutamyl phosphate reductase Verminephrobacter eiseniae (strain EF01-2)
Q8FYM3 4.3e-107 325 42 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella suis biovar 1 (strain 1330)
B3R6R0 4.32e-107 325 41 2 419 3 proA Gamma-glutamyl phosphate reductase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A9M880 4.41e-107 325 42 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q6G0S6 5.7e-107 324 41 3 417 3 proA Gamma-glutamyl phosphate reductase Bartonella quintana (strain Toulouse)
A0PU04 6.62e-107 325 45 1 393 3 proA Gamma-glutamyl phosphate reductase Mycobacterium ulcerans (strain Agy99)
A2SCE2 7.4e-107 325 44 1 384 3 proA Gamma-glutamyl phosphate reductase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q8A1E8 1.16e-106 324 42 5 411 3 proA Gamma-glutamyl phosphate reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q4FUZ5 1.49e-106 324 42 2 421 3 proA Gamma-glutamyl phosphate reductase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8YJ78 1.86e-106 323 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RF92 2.01e-106 323 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella melitensis biotype 2 (strain ATCC 23457)
A3DC22 2.45e-106 323 40 2 414 3 proA Gamma-glutamyl phosphate reductase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q1QDZ7 3.98e-106 323 42 3 421 3 proA Gamma-glutamyl phosphate reductase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A5VSI3 5.75e-106 322 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57B47 6.32e-106 322 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella abortus biovar 1 (strain 9-941)
Q2YLI7 6.32e-106 322 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella abortus (strain 2308)
Q72AN9 7.21e-106 322 47 2 391 3 proA Gamma-glutamyl phosphate reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A1VCR9 7.7e-106 322 47 2 391 3 proA Gamma-glutamyl phosphate reductase Nitratidesulfovibrio vulgaris (strain DP4)
C4XSQ4 8.86e-106 322 44 1 415 3 proA Gamma-glutamyl phosphate reductase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
P54902 1.3e-105 322 41 2 406 3 proA1 Gamma-glutamyl phosphate reductase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A9WWW7 1.47e-105 321 42 6 418 3 proA Gamma-glutamyl phosphate reductase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q2N9V1 1.47e-105 321 41 3 407 3 proA Gamma-glutamyl phosphate reductase Erythrobacter litoralis (strain HTCC2594)
P0C1E0 1.7e-105 321 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QG75 1.7e-105 321 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium glutamicum (strain R)
C0R0B8 1.92e-105 321 38 4 414 3 proA Gamma-glutamyl phosphate reductase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q6NFW0 2.03e-105 321 43 2 403 3 proA Gamma-glutamyl phosphate reductase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
P0C1E1 5.66e-105 320 42 1 409 3 proA Gamma-glutamyl phosphate reductase Corynebacterium melassecola
Q5NLX5 5.82e-105 320 41 3 418 3 proA Gamma-glutamyl phosphate reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q606Y1 1.05e-104 319 43 2 416 3 proA Gamma-glutamyl phosphate reductase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6G4Z0 1.13e-104 318 39 3 423 3 proA Gamma-glutamyl phosphate reductase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8FN87 1.95e-104 319 42 2 408 3 proA Gamma-glutamyl phosphate reductase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B1MX68 2.2e-104 318 41 2 415 3 proA Gamma-glutamyl phosphate reductase Leuconostoc citreum (strain KM20)
B0JWW5 2.42e-104 318 40 3 411 3 proA Gamma-glutamyl phosphate reductase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A6WXS2 2.6e-104 318 41 5 418 3 proA Gamma-glutamyl phosphate reductase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5ICA4 6.62e-104 317 41 5 413 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Corby)
A1WYZ4 1.01e-103 317 44 4 396 3 proA Gamma-glutamyl phosphate reductase Halorhodospira halophila (strain DSM 244 / SL1)
B3QPW0 1.17e-103 316 41 5 415 3 proA Gamma-glutamyl phosphate reductase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B1XLA4 1.36e-103 316 40 2 411 3 proA Gamma-glutamyl phosphate reductase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A9IMB2 1.47e-103 316 41 3 414 3 proA Gamma-glutamyl phosphate reductase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A7HT65 1.49e-103 316 41 2 417 3 proA Gamma-glutamyl phosphate reductase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A5CZ28 1.65e-103 316 39 2 414 3 proA Gamma-glutamyl phosphate reductase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q5X4U9 1.85e-103 316 41 5 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Paris)
Q5ZV33 2.18e-103 315 41 5 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q18J39 2.66e-103 317 41 4 411 3 proA Gamma-glutamyl phosphate reductase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
B3EE24 3.21e-103 315 41 5 415 3 proA Gamma-glutamyl phosphate reductase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q3IP72 3.42e-103 316 41 4 409 3 proA Gamma-glutamyl phosphate reductase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q98EZ5 4.14e-103 315 41 2 417 3 proA Gamma-glutamyl phosphate reductase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A9GVS8 4.39e-103 315 46 4 399 3 proA Gamma-glutamyl phosphate reductase Sorangium cellulosum (strain So ce56)
Q3IXX7 4.83e-103 315 43 1 380 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A9C1G5 5.69e-103 315 43 3 416 3 proA Gamma-glutamyl phosphate reductase Delftia acidovorans (strain DSM 14801 / SPH-1)
B9KW06 6.54e-103 314 43 1 380 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
A3PQJ2 6.9e-103 314 43 1 380 3 proA Gamma-glutamyl phosphate reductase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B8I6T0 7.06e-103 315 38 2 414 3 proA Gamma-glutamyl phosphate reductase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B3EPD4 7.81e-103 314 40 5 410 3 proA Gamma-glutamyl phosphate reductase Chlorobium phaeobacteroides (strain BS1)
B2IZ89 7.91e-103 315 42 3 406 3 proA Gamma-glutamyl phosphate reductase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q8PK35 1.44e-102 313 44 2 408 3 proA Gamma-glutamyl phosphate reductase Xanthomonas axonopodis pv. citri (strain 306)
Q8KCE9 1.49e-102 313 40 5 413 3 proA Gamma-glutamyl phosphate reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q12TF9 1.79e-102 314 38 4 417 3 proA Gamma-glutamyl phosphate reductase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q03ZF1 2.42e-102 313 41 2 415 3 proA Gamma-glutamyl phosphate reductase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A3PBW4 3.75e-102 313 40 3 415 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9301)
Q46LW0 5.06e-102 313 39 3 412 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain NATL2A)
Q92LB2 5.51e-102 312 40 4 418 3 proA Gamma-glutamyl phosphate reductase Rhizobium meliloti (strain 1021)
A2C148 5.63e-102 313 39 3 412 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain NATL1A)
Q5WWN7 8.18e-102 311 41 5 412 3 proA Gamma-glutamyl phosphate reductase Legionella pneumophila (strain Lens)
Q112S1 9.91e-102 311 39 2 411 3 proA Gamma-glutamyl phosphate reductase Trichodesmium erythraeum (strain IMS101)
Q5Z025 1.79e-101 311 45 2 399 3 proA Gamma-glutamyl phosphate reductase Nocardia farcinica (strain IFM 10152)
B8HYG3 1.81e-101 311 40 2 416 3 proA Gamma-glutamyl phosphate reductase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B4SG68 2.68e-101 310 40 5 412 3 proA Gamma-glutamyl phosphate reductase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A8G3V6 3.3e-101 310 40 5 412 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9215)
Q2RV06 5e-101 310 43 2 363 3 proA Gamma-glutamyl phosphate reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3ARL1 5.48e-101 309 41 4 407 3 proA Gamma-glutamyl phosphate reductase Chlorobium chlorochromatii (strain CaD3)
Q2VZT9 5.68e-101 310 37 1 416 3 proA Gamma-glutamyl phosphate reductase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q3MH53 4.07e-100 308 40 2 406 3 proA Gamma-glutamyl phosphate reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B0U208 5.09e-100 307 42 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain M12)
Q8YV15 7.29e-100 307 40 2 406 3 proA Gamma-glutamyl phosphate reductase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2IMG0 9.9e-100 306 46 0 354 3 proA Gamma-glutamyl phosphate reductase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q31BU4 4.97e-99 305 39 3 406 3 proA Gamma-glutamyl phosphate reductase Prochlorococcus marinus (strain MIT 9312)
Q8UBS1 6.84e-99 304 41 4 420 3 proA Gamma-glutamyl phosphate reductase Agrobacterium fabrum (strain C58 / ATCC 33970)
A4SFP8 6.92e-99 304 41 5 409 3 proA Gamma-glutamyl phosphate reductase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q311G6 7.59e-99 304 42 1 415 3 proA Gamma-glutamyl phosphate reductase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5GJS5 7.67e-99 304 41 2 411 3 proA Gamma-glutamyl phosphate reductase Synechococcus sp. (strain WH7803)
A8LK12 7.73e-99 304 42 4 380 3 proA Gamma-glutamyl phosphate reductase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A6KXU8 3.04e-98 302 40 4 417 3 proA Gamma-glutamyl phosphate reductase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A1URN6 3.1e-98 302 40 4 413 3 proA Gamma-glutamyl phosphate reductase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q9HHA1 3.38e-98 303 40 4 409 3 proA Gamma-glutamyl phosphate reductase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
B6YS10 3.68e-98 302 39 5 413 3 proA Gamma-glutamyl phosphate reductase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q9A2X6 3.76e-98 302 41 3 408 3 proA Gamma-glutamyl phosphate reductase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9PEM3 3.87e-98 302 42 1 415 3 proA Gamma-glutamyl phosphate reductase Xylella fastidiosa (strain 9a5c)
Q46F78 4.11e-98 303 40 5 409 3 proA Gamma-glutamyl phosphate reductase Methanosarcina barkeri (strain Fusaro / DSM 804)
B2S2U7 4.34e-98 302 41 5 419 3 proA Gamma-glutamyl phosphate reductase Treponema pallidum subsp. pallidum (strain SS14)
P74935 4.34e-98 302 41 5 419 3 proA Gamma-glutamyl phosphate reductase Treponema pallidum (strain Nichols)
A6UDV8 4.64e-98 302 40 3 417 3 proA Gamma-glutamyl phosphate reductase Sinorhizobium medicae (strain WSM419)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_11035
Feature type CDS
Gene proA
Product glutamate-5-semialdehyde dehydrogenase
Location 31263 - 32516 (strand: -1)
Length 1254 (nucleotides) / 417 (amino acids)
In genomic island -

Contig

Accession ZDB_220
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2069
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00171 Aldehyde dehydrogenase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0014 Amino acid transport and metabolism (E) E Gamma-glutamyl phosphate reductase

Kegg Ortholog Annotation(s)

Protein Sequence

MLEQMGKAAKAASWALAQLSGKQKNQALTRIADLLEQNSAPILAANELDIAKAREQGTSEAMLDRLLLTQARLESIAADVRKVCQLADPVGEVIDGGVLESGLRLERRRVPLGVVGVIYEARPNVTVDVASLCLKTGNAVILRGGKETHNTNVAMVSVIQQALSECGLPQAAIQAIDTPDRALVNELLKMDRYVDILIPRGGAGLHRLCREQSTIPVITGGIGVCHIFIDETADLHKALPVIRNAKVQRPSVCNAVETLLVHEKVAAEFLPLLSDHMAADNVTLHADPAALALLKNGPAKTEAVTEAQLSDEWLSLDLNVVIVKDIDGAIEHIRHYGTQHSESILTQSMSQADYFVSNIDSSAVYVNASTRFTDGGQFGLGAEVAVSTQKLHARGPMGLAALTTYKWIGVGDHTIRS

Flanking regions ( +/- flanking 50bp)

CAGTGGCTGTTCACCGCGACGATATGATTGTCAGTTAAGGATATCAGCATATGTTAGAACAAATGGGTAAAGCGGCCAAAGCCGCCTCCTGGGCACTGGCTCAGCTTTCCGGAAAACAGAAAAATCAGGCTCTGACCCGCATCGCCGATCTGCTGGAACAGAATAGTGCGCCGATCCTTGCTGCCAATGAACTTGATATTGCCAAAGCCCGTGAGCAGGGCACCTCAGAGGCGATGCTTGATCGCCTGCTGCTGACGCAGGCACGCCTGGAAAGTATTGCTGCGGACGTGCGTAAGGTGTGTCAGCTGGCGGATCCGGTCGGGGAAGTGATCGACGGCGGTGTGCTGGAAAGTGGTCTGCGCCTTGAGCGCCGCCGTGTGCCGCTCGGTGTGGTCGGTGTGATTTATGAAGCACGCCCGAATGTGACGGTGGATGTTGCCTCGCTGTGCCTGAAAACCGGTAATGCGGTGATCCTGCGCGGCGGCAAAGAGACACACAATACCAATGTGGCGATGGTCAGTGTTATTCAGCAGGCGCTCAGTGAGTGTGGCCTGCCGCAGGCGGCGATCCAGGCGATTGATACCCCGGATCGTGCGCTGGTCAATGAATTGCTGAAGATGGATCGCTATGTGGATATTCTTATTCCGCGCGGCGGTGCCGGTCTGCATCGTCTGTGTCGTGAGCAGTCCACGATCCCGGTGATCACCGGCGGTATCGGCGTGTGTCATATTTTTATCGATGAGACGGCGGATCTGCATAAAGCGCTGCCGGTCATCCGCAATGCCAAAGTGCAGCGTCCGAGTGTCTGTAATGCGGTGGAAACGCTGCTGGTGCATGAAAAAGTGGCTGCAGAATTCCTGCCGCTGTTGAGTGATCACATGGCGGCGGATAATGTTACCCTGCATGCGGATCCTGCCGCGCTGGCGCTGCTGAAAAACGGCCCGGCGAAGACGGAAGCAGTAACAGAAGCACAGCTGTCAGATGAATGGCTGTCACTTGATCTGAATGTGGTGATTGTGAAGGACATTGACGGGGCGATTGAGCATATCCGTCATTACGGCACTCAGCACTCGGAATCGATTCTGACACAATCCATGTCTCAGGCTGATTATTTCGTCTCAAATATTGATTCATCAGCAGTTTATGTTAACGCCAGCACCCGTTTCACTGACGGCGGTCAGTTCGGACTGGGCGCGGAAGTCGCGGTCAGCACTCAGAAACTGCATGCCCGCGGCCCGATGGGGCTGGCGGCACTGACCACCTATAAGTGGATCGGGGTCGGTGACCACACGATCCGTTCATAAACAGGCCGTTATGCATCCGCAGGACGTTTTTTGTCAGATGACAGCCACGT