Homologs in group_1297

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07940 FBDBKF_07940 71.3 Morganella morganii S1 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
EHELCC_13770 EHELCC_13770 71.3 Morganella morganii S2 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
NLDBIP_14215 NLDBIP_14215 71.3 Morganella morganii S4 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
LHKJJB_08635 LHKJJB_08635 71.3 Morganella morganii S3 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
HKOGLL_08185 HKOGLL_08185 71.3 Morganella morganii S5 citB DNA-binding response regulator, NarL/FixJ family, contains REC and HTH domains
F4V73_RS13045 F4V73_RS13045 72.2 Morganella psychrotolerans - response regulator transcription factor

Distribution of the homologs in the orthogroup group_1297

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1297

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P27667 4.41e-61 192 50 3 201 3 uhpA Transcriptional regulatory protein UhpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGA9 5e-59 187 49 3 196 3 uhpA Transcriptional regulatory protein UhpA Shigella flexneri
P0AGA6 5e-59 187 49 3 196 1 uhpA Transcriptional regulatory protein UhpA Escherichia coli (strain K12)
P0AGA7 5e-59 187 49 3 196 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AGA8 5e-59 187 49 3 196 3 uhpA Transcriptional regulatory protein UhpA Escherichia coli O157:H7
P0AED6 1.45e-41 143 37 3 209 3 uvrY Response regulator UvrY Shigella flexneri
P0AED5 1.45e-41 143 37 3 209 1 uvrY Response regulator UvrY Escherichia coli (strain K12)
P66797 2.65e-41 142 37 3 209 3 uvrY Response regulator UvrY Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P66798 2.65e-41 142 37 3 209 3 uvrY Response regulator UvrY Escherichia coli O157:H7
Q5HLK6 1.04e-40 140 37 3 216 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN75 5.51e-40 139 36 3 216 3 nreC Oxygen regulatory protein NreC Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7WZY4 1.46e-39 137 35 2 215 1 nreC Oxygen regulatory protein NreC Staphylococcus carnosus (strain TM300)
Q4L8Q6 9.92e-38 133 34 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus haemolyticus (strain JCSC1435)
Q6GE42 1.16e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MRSA252)
Q2YZ42 1.16e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A029 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MW2)
A8Z580 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6T0 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain MSSA476)
Q7A3U5 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain N315)
Q99RN8 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QJN1 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Newman)
Q5HDG5 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain COL)
A5IVH2 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH9)
Q2FVM7 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEA6 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain USA300)
A6U4C0 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain JH1)
A7X623 1.53e-36 130 33 2 215 3 nreC Oxygen regulatory protein NreC Staphylococcus aureus (strain Mu3 / ATCC 700698)
P13800 5.5e-33 121 33 1 220 1 degU Transcriptional regulatory protein DegU Bacillus subtilis (strain 168)
P9WMF9 9.66e-33 120 36 1 204 1 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF8 9.66e-33 120 36 1 204 2 devR DNA-binding transcriptional activator DevR/DosR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P54662 2.83e-32 119 33 3 208 3 degU Transcriptional regulatory protein DegU Brevibacillus brevis
P44845 3.8e-31 115 33 0 193 3 narP Nitrate/nitrite response regulator protein homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31802 3.91e-31 116 36 1 194 3 narP Nitrate/nitrite response regulator protein NarP Escherichia coli (strain K12)
P0AF31 2.29e-29 111 35 2 185 3 narL Nitrate/nitrite response regulator protein NarL Shigella flexneri
P0AF28 2.29e-29 111 35 2 185 1 narL Nitrate/nitrite response regulator protein NarL Escherichia coli (strain K12)
P0AF29 2.29e-29 111 35 2 185 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AF30 2.29e-29 111 35 2 185 3 narL Nitrate/nitrite response regulator protein NarL Escherichia coli O157:H7
Q51373 4.05e-29 110 30 3 212 3 gacA Response regulator GacA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P32967 2.56e-28 108 30 1 213 1 gacA Response regulator GacA Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
O32197 3.7e-28 108 33 1 210 2 liaR Transcriptional regulatory protein LiaR Bacillus subtilis (strain 168)
Q1M7A0 6.03e-28 107 31 1 206 3 mctR Transcriptional regulatory protein MctR Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
O07528 6.09e-28 107 34 3 210 3 yhcZ Uncharacterized transcriptional regulatory protein YhcZ Bacillus subtilis (strain 168)
P55184 1.68e-27 107 30 2 213 3 yxjL Uncharacterized transcriptional regulatory protein YxjL Bacillus subtilis (strain 168)
P95582 1.75e-27 106 30 2 214 3 gacA Response regulator GacA Pseudomonas viridiflava
O34723 1.94e-27 106 31 2 197 1 desR Transcriptional regulatory protein DesR Bacillus subtilis (strain 168)
A8R3S7 1.99e-27 106 32 1 210 2 exaE Transcriptional activator protein ExaE Pseudomonas putida
Q52376 3.08e-27 106 29 2 214 3 gacA Response regulator GacA Pseudomonas syringae pv. syringae (strain B728a)
P24908 1.21e-26 104 34 3 209 1 PA0034 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7A0I0 1.4e-26 104 31 1 206 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MW2)
Q6G850 1.4e-26 104 31 1 206 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MSSA476)
Q6GFH3 1.4e-26 104 31 1 206 3 vraR Response regulator protein VraR Staphylococcus aureus (strain MRSA252)
Q7A4R9 1.4e-26 104 31 1 206 1 vraR Response regulator protein VraR Staphylococcus aureus (strain N315)
Q7A2Q1 1.4e-26 104 31 1 206 1 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0C0Z1 1.4e-26 104 31 1 206 3 vraR Response regulator protein VraR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P94439 2.92e-26 103 31 2 201 1 lnrK Transcriptional regulatory protein LnrK Bacillus subtilis (strain 168)
P26319 8.1e-26 102 27 1 206 3 fimZ Fimbriae Z protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O07019 7.18e-24 97 30 2 201 3 yvfU Uncharacterized transcriptional regulatory protein YvfU Bacillus subtilis (strain 168)
Q8CNP9 7.11e-23 94 31 1 206 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HN50 7.11e-23 94 31 1 206 3 vraR Response regulator protein VraR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P96686 1.01e-22 94 30 2 211 3 ydfI Transcriptional regulatory protein YdfI Bacillus subtilis (strain 168)
P0ACZ7 1.23e-22 94 25 1 204 1 evgA DNA-binding transcriptional activator EvgA Shigella flexneri
P0ACZ4 1.23e-22 94 25 1 204 1 evgA DNA-binding transcriptional activator EvgA Escherichia coli (strain K12)
P0ACZ5 1.23e-22 94 25 1 204 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACZ6 1.23e-22 94 25 1 204 3 evgA DNA-binding transcriptional activator EvgA Escherichia coli O157:H7
P0AEL8 1.36e-22 94 26 1 206 3 fimZ Fimbriae Z protein Escherichia coli (strain K12)
P0AEL9 1.36e-22 94 26 1 206 3 fimZ Fimbriae Z protein Escherichia coli O157:H7
P0A4H2 2.03e-22 93 30 4 206 1 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0A4H4 2.03e-22 93 30 4 206 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P0A4H3 2.03e-22 93 30 4 206 3 bvgA Virulence factors putative positive transcription regulator BvgA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q49YS9 8e-22 92 30 1 206 3 vraR Response regulator protein VraR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HEP0 1.01e-21 91 31 1 206 3 vraR Response regulator protein VraR Staphylococcus aureus (strain COL)
Q2FX09 1.01e-21 91 31 1 206 1 vraR Response regulator protein VraR Staphylococcus aureus (strain NCTC 8325 / PS 47)
P9WGM5 1.4e-21 91 29 1 207 1 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM4 1.4e-21 91 29 1 207 3 narL Probable transcriptional regulatory protein NarL Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4L7J5 5.5e-21 89 30 1 206 3 vraR Response regulator protein VraR Staphylococcus haemolyticus (strain JCSC1435)
P58663 8.56e-21 89 28 1 201 1 rcsB Transcriptional regulatory protein RcsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69410 9.21e-21 89 28 1 201 3 rcsB Transcriptional regulatory protein RcsB Shigella flexneri
P0DMC8 9.21e-21 89 28 1 201 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli
P0DMC7 9.21e-21 89 28 1 201 1 rcsB Transcriptional regulatory protein RcsB Escherichia coli (strain K12)
P69408 9.21e-21 89 28 1 201 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69409 9.21e-21 89 28 1 201 3 rcsB Transcriptional regulatory protein RcsB Escherichia coli O157:H7
Q56127 1.33e-20 89 27 1 201 3 rcsB Transcriptional regulatory protein RcsB Salmonella typhi
Q7CQM5 1.46e-20 88 29 2 207 1 ssrB Response regulator SsrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P56644 1.83e-20 88 29 1 189 3 sgaR Probable transcriptional regulatory protein SgaR Hyphomicrobium methylovorum
O87940 1.1e-16 78 31 4 205 1 tdiR Transcriptional regulatory protein TdiR Thauera aromatica
P29904 1.45e-16 78 28 4 200 4 moxX Methanol utilization control regulatory protein MoxX Paracoccus denitrificans
P48359 3.82e-14 71 26 5 213 3 ycf29 Probable transcriptional regulator ycf29 Cyanophora paradoxa
P10958 4.58e-13 68 28 6 201 1 fixJ Transcriptional regulatory protein FixJ Rhizobium meliloti (strain 1021)
P14204 8.66e-13 67 24 4 210 1 comA Transcriptional regulatory protein ComA Bacillus subtilis (strain 168)
Q3LWR6 1.5e-12 67 31 3 148 3 todT Response regulator protein TodT Pseudomonas putida
I7CA98 1.5e-12 67 31 3 148 1 todT Response regulator protein TodT Pseudomonas putida (strain DOT-T1E)
A5W4E2 1.5e-12 67 31 3 148 1 todT Response regulator protein TodT Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8KR08 1.54e-12 67 30 3 148 1 tmoT Response regulator protein TmoT Pseudomonas mendocina
P23221 1.93e-12 66 28 3 156 3 fixJ Transcriptional regulatory protein FixJ Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P26487 3.77e-12 66 32 4 153 3 fixJ Transcriptional regulatory protein FixJ Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P15940 1.85e-11 64 25 5 198 3 nodW Nodulation protein W Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P58664 2.93e-11 63 27 5 209 4 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli O157:H7
P72781 6.28e-11 63 25 5 226 1 rre1 Response regulator Rre1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1XDE4 1.21e-10 62 27 4 173 3 ycf29 Probable transcriptional regulator ycf29 Neopyropia yezoensis
Q46791 2.51e-10 59 35 1 108 1 ygeK Uncharacterized response regulatory protein YgeK Escherichia coli (strain K12)
P29369 5.89e-10 60 25 1 152 3 agmR Glycerol metabolism activator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O31517 8.03e-10 60 25 1 119 3 yesN Uncharacterized transcriptional regulatory protein YesN Bacillus subtilis (strain 168)
P45671 1.35e-09 60 29 4 161 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
A8R3T0 3.96e-09 57 25 1 152 3 agmR Glycerol metabolism activator Pseudomonas putida
Q1IRH0 5.35e-09 58 33 4 144 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Koribacter versatilis (strain Ellin345)
P51343 6.15e-09 57 30 2 115 3 ycf29 Probable transcriptional regulator ycf29 Porphyra purpurea
Q9WY30 1.45e-08 57 29 3 103 1 TM_0186 Cyclic di-GMP phosphodiesterase TM_0186 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q2NB98 3.33e-08 55 42 0 59 1 ELI_04755 Light-activated DNA-binding protein EL222 Erythrobacter litoralis (strain HTCC2594)
Q2YC79 5.12e-08 55 32 2 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
P9WGM3 1.84e-07 53 30 3 115 1 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM2 1.84e-07 53 30 3 115 3 pdtaR Transcriptional regulatory protein PdtaR Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P72253 1.97e-07 53 33 1 114 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase of group 2 operon Rhodospirillum centenum (strain ATCC 51521 / SW)
O34903 4.1e-07 52 29 3 134 3 ykoG Uncharacterized transcriptional regulatory protein YkoG Bacillus subtilis (strain 168)
Q8EDD7 4.52e-07 52 28 1 118 3 SO_2823 Uncharacterized response regulatory protein SO_2823 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q15RF6 7.44e-07 52 30 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q2WAJ8 8.12e-07 52 32 1 116 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
P37740 9.61e-07 50 28 7 167 3 dctR C4-dicarboxylate transport transcriptional regulatory protein DctR Rhodobacter capsulatus
P52942 1.1e-06 49 32 0 83 3 spo0F Sporulation initiation phosphotransferase F Bacillus thuringiensis subsp. kurstaki
P26275 1.14e-06 51 28 3 122 3 algR Positive alginate biosynthesis regulatory protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P44918 1.26e-06 50 32 2 113 3 arcA Aerobic respiration control protein ArcA homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52932 1.31e-06 50 29 2 119 3 spo0A Stage 0 sporulation protein A (Fragment) Priestia megaterium
Q167K9 2.11e-06 50 34 0 72 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8ZNN2 2.11e-06 50 30 1 120 3 btsR Transcriptional regulatory protein BtsR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q06239 2.14e-06 50 31 1 97 3 vanR Regulatory protein VanR Enterococcus faecium
Q39S45 2.26e-06 50 29 2 127 3 cheB4 Protein-glutamate methylesterase/protein-glutamine glutaminase 4 Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8Z5C1 2.46e-06 50 30 1 120 3 btsR Transcriptional regulatory protein BtsR Salmonella typhi
Q9HV32 3.34e-06 49 29 3 165 1 pmrA Response regulator protein PmrA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P26408 4.09e-06 50 30 4 115 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q7NV40 4.12e-06 50 30 2 125 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q3ADA6 4.12e-06 50 28 3 146 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q4L8L9 4.31e-06 49 36 2 90 3 hssR Heme response regulator HssR Staphylococcus haemolyticus (strain JCSC1435)
Q56312 4.35e-06 47 24 1 117 1 cheY Chemotaxis protein CheY Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P94514 4.82e-06 49 25 1 116 3 lytT Sensory transduction protein LytT Bacillus subtilis (strain 168)
O83639 5.15e-06 49 30 1 110 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Treponema pallidum (strain Nichols)
Q2RX18 5.15e-06 49 34 0 81 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2FMT2 5.16e-06 49 30 1 109 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q1D359 5.91e-06 49 30 2 117 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Myxococcus xanthus (strain DK1622)
Q55933 6.45e-06 48 28 2 119 1 rppA Response regulator RppA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P45785 6.62e-06 48 41 1 62 4 None Putative HTH-type transcriptional regulator in exeN 3'region (Fragment) Aeromonas salmonicida
P39663 8.74e-06 48 27 4 176 1 sphR Alkaline phosphatase synthesis transcriptional regulatory protein SphR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P13632 1e-05 48 25 6 225 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q0A9Z5 1.05e-05 48 29 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
O52262 1.15e-05 48 32 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Pseudomonas putida
Q88EW5 1.17e-05 48 32 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P11470 1.29e-05 45 47 1 55 1 gerE Spore germination protein GerE Bacillus subtilis (strain 168)
A1SMR4 1.31e-05 48 29 1 105 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nocardioides sp. (strain ATCC BAA-499 / JS614)
P36556 1.42e-05 47 29 2 114 1 basR Transcriptional regulatory protein BasR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q4UU85 1.54e-05 48 21 4 197 1 rpfG Cyclic di-GMP phosphodiesterase response regulator RpfG Xanthomonas campestris pv. campestris (strain 8004)
P0A4H5 1.64e-05 46 23 1 116 3 cheY Chemotaxis protein CheY Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P0A4H6 1.64e-05 46 23 1 116 3 cheY Chemotaxis protein CheY Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4ZYD3 1.65e-05 48 31 2 126 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. syringae (strain B728a)
Q9KU36 1.67e-05 47 29 3 117 3 VC_0693 Uncharacterized response regulatory protein VC_0693 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7CQM8 1.7e-05 47 24 6 208 1 ttrR Tetrathionate response regulatory protein TtrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A6QJK3 1.75e-05 47 28 5 185 1 hssR Heme response regulator HssR Staphylococcus aureus (strain Newman)
Q5HDJ4 1.75e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain COL)
Q6GE73 1.78e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MRSA252)
Q2YZ24 1.83e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain bovine RF122 / ET3-1)
P18769 1.84e-05 48 31 3 117 1 frzE Gliding motility regulatory protein Myxococcus xanthus
Q1GZZ0 1.87e-05 48 29 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q7A039 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MW2)
A8Z552 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6V9 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain MSSA476)
Q7A3X1 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain N315)
Q99RR6 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE2 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH9)
Q2FVQ9 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED5 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain USA300)
A6U488 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain JH1)
A7X5Y5 1.9e-05 47 28 5 185 3 hssR Heme response regulator HssR Staphylococcus aureus (strain Mu3 / ATCC 700698)
P0A4I4 1.92e-05 47 27 2 121 3 spo0A Stage 0 sporulation protein A Bacillus thuringiensis
P0A4I3 1.92e-05 47 27 2 121 3 spo0A Stage 0 sporulation protein A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P10046 2.01e-05 48 28 7 225 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P06534 2.05e-05 47 28 2 121 1 spo0A Stage 0 sporulation protein A Bacillus subtilis (strain 168)
Q4L6C6 2.08e-05 47 27 4 140 3 arlR Response regulator ArlR Staphylococcus haemolyticus (strain JCSC1435)
P0AFT5 2.38e-05 47 30 1 104 1 btsR Transcriptional regulatory protein BtsR Escherichia coli (strain K12)
P0AFT6 2.38e-05 47 30 1 104 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0DUE6 2.38e-05 47 30 1 104 3 btsR Transcriptional regulatory protein BtsR Escherichia coli O157:H7
P0DUE7 2.38e-05 47 30 1 104 4 btsR Transcriptional regulatory protein-like BtsR Enterobacteria phage VT1-Sakai
P30843 2.55e-05 47 36 0 69 1 basR Transcriptional regulatory protein BasR Escherichia coli (strain K12)
P37640 2.66e-05 46 24 3 168 1 yhjB Putative HTH-type transcriptional regulator YhjB Escherichia coli (strain K12)
Q3KFZ6 2.67e-05 47 31 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain Pf0-1)
Q48ND9 2.97e-05 47 31 2 126 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q47I43 2.99e-05 47 33 0 72 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Dechloromonas aromatica (strain RCB)
P59640 3.01e-05 47 30 1 104 3 btsR Transcriptional regulatory protein BtsR Shigella flexneri
A1TEL7 3.42e-05 46 27 2 120 3 mprA Response regulator MprA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q04848 3.6e-05 47 30 0 82 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P10577 3.85e-05 47 27 2 111 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P0C001 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain MW2)
Q6G9E6 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain MSSA476)
Q6GGZ3 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain MRSA252)
P0C000 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG04 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain COL)
Q2YY03 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9KJN4 3.95e-05 46 24 3 156 1 arlR Response regulator ArlR Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH23 3.95e-05 46 24 3 156 3 arlR Response regulator ArlR Staphylococcus aureus (strain USA300)
Q4L8V4 4.02e-05 46 21 6 228 3 lytR Sensory transduction protein LytR Staphylococcus haemolyticus (strain JCSC1435)
Q8ZBV2 4.46e-05 46 31 3 116 3 YPO3287 Uncharacterized response regulatory protein YPO3287/y0902/YP_0397 Yersinia pestis
Q7A0U4 4.71e-05 46 26 2 115 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MW2)
Q9L524 4.71e-05 46 26 2 115 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus
Q6G972 4.71e-05 46 26 2 115 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MSSA476)
Q6GGK6 4.71e-05 46 26 2 115 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain MRSA252)
Q7A5H6 4.71e-05 46 26 2 115 1 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain N315)
Q7A2R6 4.71e-05 46 26 2 115 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HFT0 4.71e-05 46 26 2 115 2 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain COL)
Q2FY79 4.71e-05 46 26 2 115 3 srrA Transcriptional regulatory protein SrrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8EEQ0 4.75e-05 46 27 5 138 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9ZVD3 5.44e-05 47 26 6 146 3 ARR13 Putative two-component response regulator ARR13 Arabidopsis thaliana
Q99U73 5.86e-05 45 27 3 124 3 arlR Response regulator ArlR Staphylococcus aureus (strain N315)
Q9AAK0 5.92e-05 46 33 3 105 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A0PWB4 6.14e-05 45 27 2 120 3 mprA Response regulator MprA Mycobacterium ulcerans (strain Agy99)
P35163 6.16e-05 46 26 2 116 1 resD Transcriptional regulatory protein ResD Bacillus subtilis (strain 168)
Q9KA55 6.31e-05 46 28 1 111 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P52928 6.45e-05 46 26 2 121 3 spo0A Stage 0 sporulation protein A Bacillus anthracis
Q44929 6.52e-05 45 26 3 156 3 gtcR Response regulator GtcR Aneurinibacillus migulanus
P50350 6.58e-05 45 30 2 118 3 chvI Transcriptional regulatory protein ChvI Rhizobium meliloti (strain 1021)
Q884V3 6.93e-05 46 31 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0AYL3 6.98e-05 46 26 5 164 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q4ZQV7 7.5e-05 46 31 1 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Pseudomonas syringae pv. syringae (strain B728a)
Q8DET1 7.73e-05 45 24 1 124 3 VV1_0503 Uncharacterized response regulatory protein VV1_0503 Vibrio vulnificus (strain CMCP6)
L7N689 7.95e-05 45 31 0 100 1 trcR Transcriptional regulatory protein TrcR Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P23620 8.25e-05 45 32 1 89 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2LR65 8.31e-05 46 25 2 130 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Syntrophus aciditrophicus (strain SB)
Q12YX1 8.4e-05 46 29 3 129 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
B0R4K1 8.55e-05 43 26 1 116 1 cheY Chemotaxis protein CheY Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q48GG6 8.63e-05 46 31 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P52934 8.72e-05 45 24 2 121 1 spo0A Stage 0 sporulation protein A Geobacillus stearothermophilus
P51586 9.06e-05 44 30 2 117 3 None Uncharacterized 14.6 kDa protein in sodA1 3'region Leptolyngbya boryana
Q5HLN2 9.33e-05 45 30 2 88 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN92 9.51e-05 45 30 2 88 3 hssR Heme response regulator HssR Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P50351 0.000108 45 30 2 118 3 chvI Transcriptional regulatory protein ChvI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O85128 0.000111 45 28 0 74 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q4A010 0.000114 45 28 1 116 3 lytR Sensory transduction protein LytR Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9CD68 0.000123 45 28 2 120 3 mprA Response regulator MprA Mycobacterium leprae (strain TN)
Q1B3X8 0.000126 45 27 2 120 3 mprA Response regulator MprA Mycobacterium sp. (strain MCS)
A1UL70 0.000126 45 27 2 120 3 mprA Response regulator MprA Mycobacterium sp. (strain KMS)
A3Q5L9 0.000126 45 27 2 120 3 mprA Response regulator MprA Mycobacterium sp. (strain JLS)
Q52883 0.000127 45 30 0 71 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase of group 1 operon Rhizobium meliloti (strain 1021)
O34534 0.000129 45 26 0 104 1 citT Transcriptional regulatory protein CitT Bacillus subtilis (strain 168)
Q9WYN9 0.00013 45 27 1 108 1 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1LH11 0.000138 45 28 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3SIG0 0.000142 45 26 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thiobacillus denitrificans (strain ATCC 25259)
A1KHB7 0.000144 45 27 2 120 3 mprA Response regulator MprA Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X4 0.000144 45 27 2 120 1 mprA Response regulator MprA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q888V8 0.000145 45 30 2 126 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5FQQ0 0.000165 45 31 0 73 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Gluconobacter oxydans (strain 621H)
P06628 0.000182 43 26 0 83 1 spo0F Sporulation initiation phosphotransferase F Bacillus subtilis (strain 168)
Q742C1 0.000187 44 30 0 86 3 mprA Response regulator MprA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QBQ9 0.000187 44 30 0 86 3 mprA Response regulator MprA Mycobacterium avium (strain 104)
Q3ADG9 0.000203 45 34 2 101 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q46PH7 0.000214 44 28 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8TLG9 0.000228 44 28 3 124 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P70955 0.00023 44 26 1 104 1 natR Transcriptional regulatory protein NatR Bacillus subtilis (strain 168)
Q10WZ6 0.000235 44 27 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Trichodesmium erythraeum (strain IMS101)
P52929 0.000237 44 26 1 119 3 spo0A Stage 0 sporulation protein A (Fragment) Brevibacillus parabrevis
P9WGM9 0.000237 44 27 2 120 1 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGM8 0.000237 44 27 2 120 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U123 0.000237 44 27 2 120 3 mprA Response regulator MprA Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P62637 0.000261 44 31 0 63 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q81JL3 0.000273 44 22 1 115 3 lytT Sensory transduction protein LytT Bacillus anthracis
Q4KG36 0.000281 44 30 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A0R3I8 0.000292 43 26 2 120 1 mprA Response regulator MprA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q2FQU2 0.000293 44 32 0 74 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
P52931 0.000296 43 25 1 118 3 spo0A Stage 0 sporulation protein A (Fragment) Niallia circulans
Q311M8 0.000327 44 26 2 107 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q21IQ9 0.000391 43 30 1 103 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8TUQ0 0.000416 43 24 2 152 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8ECD7 0.000422 43 27 1 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5L0L0 0.000428 43 26 2 112 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Geobacillus kaustophilus (strain HTA426)
P31908 0.000469 43 25 2 119 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q01473 0.000478 43 26 0 95 3 rcaC Protein RcaC Microchaete diplosiphon
Q2SFK0 0.000496 43 27 2 110 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Hahella chejuensis (strain KCTC 2396)
Q07783 0.000501 43 28 2 129 3 chvI Transcriptional regulatory protein ChvI Rhizobium radiobacter
Q3IRR4 0.000534 43 27 4 128 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q814J1 0.000546 43 22 1 115 4 lytT Sensory transduction protein LytT Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O87125 0.000558 43 31 1 104 1 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2FWH6 0.000567 43 32 1 84 1 kdpE Transcriptional regulatory protein KdpE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q3A5A8 0.00059 43 29 3 109 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q0HKN5 0.000604 43 27 1 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-4)
Q8Q009 0.000609 43 31 0 74 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P41789 0.000617 43 34 0 72 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45709 0.000652 41 24 1 118 3 ccdB Protein CcdB Bacillus subtilis (strain 168)
Q4UU97 0.000657 43 30 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Xanthomonas campestris pv. campestris (strain 8004)
Q8P9J7 0.000657 43 30 1 104 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q0HWY6 0.000676 43 27 1 105 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Shewanella sp. (strain MR-7)
Q5JF95 0.000692 43 31 1 93 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8EF61 0.000701 43 27 1 104 3 cheB2 Protein-glutamate methylesterase/protein-glutamine glutaminase 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P0AFB8 0.000722 43 34 0 72 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 0.000722 43 34 0 72 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P0DOA0 0.000778 43 28 2 120 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q7NSI8 0.000799 43 28 1 104 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P0A9Q4 0.000805 42 26 2 114 3 arcA Aerobic respiration control protein ArcA Shigella flexneri
P0A9Q1 0.000805 42 26 2 114 1 arcA Aerobic respiration control protein ArcA Escherichia coli (strain K12)
P0A9Q2 0.000805 42 26 2 114 3 arcA Aerobic respiration control protein ArcA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9Q3 0.000805 42 26 2 114 3 arcA Aerobic respiration control protein ArcA Escherichia coli O157:H7
P45607 0.000873 42 30 2 85 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella flexneri
P45606 0.000881 42 30 2 85 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Shigella dysenteriae
Q8F3H4 0.001 42 31 0 74 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P62643 0.001 42 31 0 74 3 cheB3 Protein-glutamate methylesterase/protein-glutamine glutaminase 3 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q820K0 0.001 42 25 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P0AFJ5 0.001 42 30 2 85 1 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli (strain K12)
P0AFJ6 0.001 42 30 2 85 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Escherichia coli O157:H7
O87717 0.001 42 31 0 73 3 cheB1 Protein-glutamate methylesterase/protein-glutamine glutaminase 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8XQ83 0.001 43 28 1 104 3 cheB Protein-glutamate methylesterase/protein-glutamine glutaminase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
P45605 0.001 42 31 2 85 3 phoB Phosphate regulon transcriptional regulatory protein PhoB Klebsiella pneumoniae

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00930
Feature type CDS
Gene -
Product response regulator transcription factor
Location 230251 - 230883 (strand: -1)
Length 633 (nucleotides) / 210 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1297
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00072 Response regulator receiver domain
PF00196 Bacterial regulatory proteins, luxR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4566 Signal transduction mechanisms (T)
Transcription (K)
TK DNA-binding response regulator, FixJ family, consists of REC and HTH domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K20264 two-component system, NarL family, response regulator FusR Two-component system
Quorum sensing
-

Protein Sequence

MINVALIDDHIVVRSGFAQLLMLEPDINIVGEYANGQEAWPYLLNDNIDVAVMDLSMPGESGLQLQSRLKQKRPDFRTIILSIYDTPAFVQSALDSGAHGYLTKRCGPQELVQAVRAVYQGGCYLCADAMKALRQTPEKEDALHSLTPREREIFNLLVQGINVKAIAVQLNLSHKTVHVHRANILGKLNCETTIDLVHFALNNQLITGTL

Flanking regions ( +/- flanking 50bp)

TGTTATAAAACAGATAAATATTACCTAACAATGCTTAGCCTAATAAAAATATGATAAACGTTGCTCTCATCGATGATCACATTGTTGTGCGTTCTGGATTTGCACAACTGCTAATGCTAGAGCCGGATATTAATATTGTCGGTGAATACGCAAATGGCCAAGAAGCTTGGCCCTATTTATTAAATGATAATATTGATGTGGCGGTGATGGATCTCTCTATGCCTGGAGAGAGTGGCCTACAATTACAAAGTCGATTAAAACAAAAACGCCCTGATTTTCGGACAATTATTTTAAGTATTTATGATACCCCCGCATTTGTACAAAGCGCTTTAGATTCCGGTGCCCATGGCTATTTAACTAAGCGCTGTGGTCCACAAGAGCTCGTTCAAGCAGTACGTGCTGTGTATCAAGGGGGCTGTTATCTCTGTGCTGATGCCATGAAAGCACTTCGACAGACACCAGAAAAAGAAGATGCTTTACATAGTTTAACCCCTCGCGAAAGAGAGATTTTTAATCTGCTAGTACAAGGTATTAATGTTAAAGCTATCGCCGTACAACTGAATCTCAGTCATAAAACGGTGCATGTTCATCGAGCCAATATACTGGGTAAATTGAACTGTGAAACAACCATTGATTTAGTCCATTTTGCATTAAACAATCAGTTAATCACCGGAACACTCTAACATGCAAAGAGGCGCACGTTTTTTTCTTCAATCTCTCTTTTTATTGTTGA