Homologs in group_2111

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15870 FBDBKF_15870 86.4 Morganella morganii S1 clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
EHELCC_18470 EHELCC_18470 86.4 Morganella morganii S2 clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
NLDBIP_17305 NLDBIP_17305 86.4 Morganella morganii S4 clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
LHKJJB_17355 LHKJJB_17355 86.4 Morganella morganii S3 clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
HKOGLL_17040 HKOGLL_17040 86.4 Morganella morganii S5 clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
F4V73_RS16440 F4V73_RS16440 85.4 Morganella psychrotolerans clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP

Distribution of the homologs in the orthogroup group_2111

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2111

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EU53 1.38e-155 431 100 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Proteus mirabilis (strain HI4320)
Q60107 2.48e-139 390 88 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia enterocolitica
A1JNN2 2.48e-139 390 88 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7N0L3 1.87e-138 388 86 0 206 1 clpP ATP-dependent Clp protease proteolytic subunit Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66DT4 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPE3 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis (strain Pestoides F)
Q1CL65 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZC65 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis
Q1C4K8 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLC4 2.07e-137 385 87 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D827 5.81e-134 377 85 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3Z4W6 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella sonnei (strain Ss046)
P0A6H0 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella flexneri
Q0T7E6 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella flexneri serotype 5b (strain 8401)
Q32JJ3 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella dysenteriae serotype 1 (strain Sd197)
Q325G4 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Shigella boydii serotype 4 (strain Sb227)
Q1RF98 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain UTI89 / UPEC)
P0A6G7 2.67e-133 375 85 0 207 1 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain K12)
B1J011 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6G8 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKK4 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8A6 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O1:K1 / APEC
A7ZX95 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O9:H4 (strain HS)
P0A6G9 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O157:H7
A7ZIJ5 2.67e-133 375 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Escherichia coli O139:H28 (strain E24377A / ETEC)
P0A1D7 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1D8 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella typhi
B4TMC6 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella schwarzengrund (strain CVM19633)
B4SWU1 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella newport (strain SL254)
B4T9E3 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella heidelberg (strain SL476)
B5QTJ6 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella enteritidis PT4 (strain P125109)
Q57SB5 8.82e-133 374 85 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella choleraesuis (strain SC-B67)
B5BD83 4.67e-132 372 84 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella paratyphi A (strain AKU_12601)
Q5PFN4 4.67e-132 372 84 0 207 3 clpP ATP-dependent Clp protease proteolytic subunit Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C5BCJ6 7.31e-131 369 83 1 207 3 clpP ATP-dependent Clp protease proteolytic subunit Edwardsiella ictaluri (strain 93-146)
Q2NV79 2.06e-126 357 86 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Sodalis glossinidius (strain morsitans)
C4K4P2 2.29e-121 345 79 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q6LNW0 3.27e-118 337 79 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Photobacterium profundum (strain SS9)
Q1LTJ9 4.51e-118 337 77 1 199 3 clpP ATP-dependent Clp protease proteolytic subunit Baumannia cicadellinicola subsp. Homalodisca coagulata
B0KJG6 6.73e-118 336 79 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas putida (strain GB-1)
Q7MMG7 8.33e-118 335 78 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio vulnificus (strain YJ016)
Q8DG26 8.33e-118 335 78 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio vulnificus (strain CMCP6)
B1J692 5e-117 334 79 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas putida (strain W619)
A4SM42 7.66e-117 333 72 1 205 3 clpP ATP-dependent Clp protease proteolytic subunit Aeromonas salmonicida (strain A449)
Q21KA9 1.06e-116 333 78 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q88KJ0 1.5e-116 333 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W635 1.5e-116 333 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C3LNM6 6.33e-116 331 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain M66-2)
Q9KQS6 6.33e-116 331 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F6X0 6.33e-116 331 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
C5BTJ0 6.37e-116 331 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Teredinibacter turnerae (strain ATCC 39867 / T7901)
A7MV87 2.1e-115 330 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio campbellii (strain ATCC BAA-1116)
Q87R80 2.36e-115 329 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7VI00 4.06e-115 329 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Vibrio atlanticus (strain LGP32)
B5FBZ8 1.63e-114 327 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio fischeri (strain MJ11)
Q5E6Q5 1.63e-114 327 77 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EHK3 2.34e-114 327 76 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Aliivibrio salmonicida (strain LFI1238)
Q0VQ90 6.82e-114 326 74 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4XTZ5 1.32e-113 325 76 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas mendocina (strain ymp)
Q15R46 2.66e-113 325 74 0 197 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B0BQL3 3.7e-112 321 77 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N1T0 3.7e-112 321 77 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3H252 3.91e-112 321 77 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q31GF1 5.29e-112 321 76 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q12LA1 7.56e-112 321 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q8EG19 1.83e-111 320 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3K9W9 2.15e-111 320 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas fluorescens (strain Pf0-1)
Q3IF46 2.27e-111 320 72 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudoalteromonas translucida (strain TAC 125)
Q4K9J6 2.32e-111 320 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B0TLU9 2.36e-111 319 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella halifaxensis (strain HAW-EB4)
A1RL89 3.35e-111 319 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain W3-18-1)
A4Y5I2 3.35e-111 319 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B8CRF7 3.55e-111 319 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella piezotolerans (strain WP3 / JCM 13877)
B1KLT7 4.14e-111 319 73 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella woodyi (strain ATCC 51908 / MS32)
A3QFX6 4.27e-111 319 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9KWH7 6.33e-111 318 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS195)
A6WLQ1 6.33e-111 318 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS185)
A3D305 6.33e-111 318 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5E9 6.33e-111 318 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella baltica (strain OS223)
Q4ZVM7 6.39e-111 318 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas syringae pv. syringae (strain B728a)
Q87YR6 6.39e-111 318 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48KZ0 6.39e-111 318 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A8H614 1.17e-110 318 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q07ZX8 1.72e-110 317 73 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella frigidimarina (strain NCIMB 400)
A8FTH9 2.09e-110 317 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sediminis (strain HAW-EB3)
A0KYL9 2.84e-110 317 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain ANA-3)
Q0HHA1 3e-110 317 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain MR-4)
Q0HTK7 3.03e-110 317 74 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella sp. (strain MR-7)
Q5H434 6.61e-110 316 74 0 193 1 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SMI3 6.61e-110 316 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P6Z0 6.61e-110 316 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BWQ1 6.61e-110 316 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B0RTF7 6.61e-110 316 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas campestris pv. campestris (strain B100)
Q8PNI5 6.61e-110 316 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas axonopodis pv. citri (strain 306)
A1S4X5 7.05e-110 315 73 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C3JYK0 1.03e-109 315 73 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas fluorescens (strain SBW25)
Q8PBY6 1.25e-109 315 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URL4 1.25e-109 315 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthomonas campestris pv. campestris (strain 8004)
Q87E51 2.43e-109 315 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8K3 2.43e-109 315 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xylella fastidiosa (strain M23)
B2FQR2 2.63e-109 314 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Stenotrophomonas maltophilia (strain K279a)
B0U5N1 4.12e-109 314 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xylella fastidiosa (strain M12)
Q47FB6 4.76e-109 314 70 1 203 3 clpP ATP-dependent Clp protease proteolytic subunit Dechloromonas aromatica (strain RCB)
P57547 4.96e-109 314 72 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9CJM2 5.94e-109 313 72 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Pasteurella multocida (strain Pm70)
Q3SI98 8.93e-109 313 70 1 203 3 clpP ATP-dependent Clp protease proteolytic subunit Thiobacillus denitrificans (strain ATCC 25259)
Q5QXN8 9.13e-109 313 71 0 195 3 clpP ATP-dependent Clp protease proteolytic subunit Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A5UHJ6 1.01e-108 312 72 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain PittGG)
A5UE11 1.01e-108 312 72 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain PittEE)
Q9PE41 1.17e-108 313 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Xylella fastidiosa (strain 9a5c)
B8F822 1.22e-108 312 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Glaesserella parasuis serovar 5 (strain SH0165)
Q47XL8 2.15e-108 313 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7VP78 4.55e-108 311 73 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P43867 5.74e-108 310 72 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QMK5 5.74e-108 310 72 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Haemophilus influenzae (strain 86-028NP)
B0UW20 8.52e-108 310 73 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Histophilus somni (strain 2336)
A1SUW7 8.94e-108 310 72 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6VW20 1.26e-107 310 71 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Marinomonas sp. (strain MWYL1)
Q1ICA8 1.78e-107 310 78 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudomonas entomophila (strain L48)
Q5P161 2.17e-107 310 69 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3JAJ8 2.49e-107 309 71 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q6FEP8 3.37e-107 309 72 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1K783 3.67e-107 309 70 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Azoarcus sp. (strain BH72)
Q3AF96 3.67e-107 308 74 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A0LDT4 3.97e-107 308 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q89AA1 8.06e-107 308 70 0 200 3 clpP ATP-dependent Clp protease proteolytic subunit Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
C1D539 5.86e-106 306 69 1 200 3 clpP ATP-dependent Clp protease proteolytic subunit Laribacter hongkongensis (strain HLHK9)
Q0A6A7 6.71e-106 306 66 1 206 3 clpP ATP-dependent Clp protease proteolytic subunit Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A6VME1 1.13e-105 305 74 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q82Y57 1.15e-105 305 70 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q2SK36 6.51e-105 303 72 1 193 3 clpP ATP-dependent Clp protease proteolytic subunit Hahella chejuensis (strain KCTC 2396)
Q65RF6 1.25e-104 302 74 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q493F8 1.54e-104 302 70 0 197 3 clpP ATP-dependent Clp protease proteolytic subunit Blochmanniella pennsylvanica (strain BPEN)
Q2Y6J0 5.12e-104 301 66 1 205 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1WUM7 6.21e-104 301 66 2 206 3 clpP ATP-dependent Clp protease proteolytic subunit Halorhodospira halophila (strain DSM 244 / SL1)
Q5PBD0 1.54e-103 300 70 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain St. Maries)
B9KHZ4 1.54e-103 300 70 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma marginale (strain Florida)
B9M0Y1 1.55e-103 300 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q1H1G0 1.93e-103 300 66 1 203 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A5N2K8 2.06e-103 299 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E685 2.06e-103 299 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium kluyveri (strain NBRC 12016)
Q9I2U1 2.86e-103 299 73 0 192 1 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5GFA0 4.89e-103 298 68 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Geotalea uraniireducens (strain Rf4)
Q39UH2 5.7e-103 298 69 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q4FQB9 7.31e-103 299 70 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1Q8J2 1.02e-102 298 68 0 198 3 clpP ATP-dependent Clp protease proteolytic subunit Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0AJI2 1.23e-102 298 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q74C82 1.43e-102 297 71 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A6SY74 1.47e-102 297 68 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Janthinobacterium sp. (strain Marseille)
B2UX13 1.58e-102 297 70 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Alaska E43 / Type E3)
A1WR17 1.75e-102 297 68 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Verminephrobacter eiseniae (strain EF01-2)
A1TM62 2.04e-102 296 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Paracidovorax citrulli (strain AAC00-1)
B5EI27 2.42e-102 296 70 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q5ZUD9 2.77e-102 297 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X451 2.77e-102 297 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Legionella pneumophila (strain Paris)
A5ID17 2.8e-102 297 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Legionella pneumophila (strain Corby)
Q6AK59 4.17e-102 296 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C6E2T0 4.37e-102 296 70 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacter sp. (strain M21)
Q5WVJ0 4.43e-102 296 75 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Legionella pneumophila (strain Lens)
Q2GJB4 6.83e-102 295 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Anaplasma phagocytophilum (strain HZ)
B2TPB9 7.56e-102 295 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Eklund 17B / Type B)
A4XHW0 7.77e-102 295 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A5CXJ8 8.52e-102 295 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
B1Y6H3 1.13e-101 295 67 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q2RL31 1.23e-101 295 68 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A1AVN6 1.25e-101 295 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Ruthia magnifica subsp. Calyptogena magnifica
B1L1D7 1.31e-101 294 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Loch Maree / Type A3)
Q8D346 1.33e-101 294 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Wigglesworthia glossinidia brevipalpis
A5D447 1.48e-101 294 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q13Z15 1.52e-101 295 68 0 196 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Paraburkholderia xenovorans (strain LB400)
A4J7L9 1.57e-101 294 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A4JF05 1.83e-101 295 64 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia vietnamiensis (strain G4 / LMG 22486)
A8EYM5 1.97e-101 294 68 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia canadensis (strain McKiel)
Q39FE8 1.99e-101 295 64 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
P58278 2.29e-101 294 68 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium meliloti (strain 1021)
A7GIH2 2.76e-101 293 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IND7 2.76e-101 293 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Okra / Type B1)
C1FLA6 2.76e-101 293 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Kyoto / Type A2)
A5I6W1 2.76e-101 293 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYI2 2.76e-101 293 70 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium botulinum (strain ATCC 19397 / Type A)
Q8K990 2.84e-101 293 72 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1RJH2 3.46e-101 295 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia bellii (strain RML369-C)
Q1BH85 3.98e-101 294 64 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia orbicola (strain AU 1054)
Q0BEF6 3.98e-101 294 64 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K847 3.98e-101 294 64 0 206 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia cenocepacia (strain HI2424)
A0Q2L1 4.63e-101 293 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium novyi (strain NT)
Q891J7 5.7e-101 293 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium tetani (strain Massachusetts / E88)
Q7NUY9 6.3e-101 293 68 1 196 3 clpP ATP-dependent Clp protease proteolytic subunit Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1LM62 6.43e-101 293 60 1 216 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q5HBX5 6.98e-101 293 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Welgevonden)
A2SFB5 9.34e-101 293 67 0 195 3 clpP ATP-dependent Clp protease proteolytic subunit Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q0ST53 1.15e-100 292 68 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain SM101 / Type A)
Q8XKK1 1.15e-100 292 68 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain 13 / Type A)
Q0TQK2 1.15e-100 292 68 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1MIM7 1.2e-100 292 67 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q472D3 1.46e-100 293 60 1 216 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P58276 1.66e-100 291 69 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2SWQ6 2.03e-100 292 66 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7VRH1 2.73e-100 291 68 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Blochmanniella floridana
B3R4W1 3.01e-100 292 60 1 215 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q0KBK4 3.01e-100 292 60 1 215 3 clpP ATP-dependent Clp protease proteolytic subunit Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2K9U7 3.88e-100 291 67 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
A3DJ10 4.18e-100 291 67 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8ENM5 4.27e-100 290 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C5CJT4 4.38e-100 291 67 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Variovorax paradoxus (strain S110)
Q9JU33 4.54e-100 291 68 1 194 3 clpP ATP-dependent Clp protease proteolytic subunit Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F914 4.74e-100 291 68 1 194 3 clpP ATP-dependent Clp protease proteolytic subunit Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q3JRC9 5.8e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1710b)
Q62JK7 5.8e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain ATCC 23344)
Q63V41 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain K96243)
A3NAI5 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 668)
A3NWA6 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia pseudomallei (strain 1106a)
A1V4X1 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain SAVP1)
A2SBG3 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10229)
A3MKJ8 7.01e-100 291 65 0 196 3 clpP ATP-dependent Clp protease proteolytic subunit Burkholderia mallei (strain NCTC 10247)
A1KUD9 8.56e-100 290 68 1 194 3 clpP ATP-dependent Clp protease proteolytic subunit Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9LZN9 8.56e-100 290 68 1 194 3 clpP ATP-dependent Clp protease proteolytic subunit Neisseria meningitidis serogroup C (strain 053442)
A8ZXB7 1.43e-99 290 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q5FFG7 1.52e-99 289 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia ruminantium (strain Gardel)
Q8UFY6 1.92e-99 290 65 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q5GS83 2.33e-99 289 67 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q3YSQ3 2.41e-99 289 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia canis (strain Jake)
B3CLB1 2.46e-99 289 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis subsp. Culex pipiens (strain wPip)
B9MG14 2.91e-99 289 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax ebreus (strain TPSY)
A1W5B6 3.32e-99 288 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Acidovorax sp. (strain JS42)
Q2G3T3 4e-99 290 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8XYP7 4.04e-99 289 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q4ULF0 4.13e-99 288 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
C0QGT0 5.05e-99 288 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q4FM94 6.34e-99 288 64 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Pelagibacter ubique (strain HTCC1062)
A8GNZ4 8.79e-99 288 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia akari (strain Hartford)
Q24S49 8.9e-99 288 71 1 190 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Desulfitobacterium hafniense (strain Y51)
Q9JZ38 9.53e-99 288 67 1 194 1 clpP ATP-dependent Clp protease proteolytic subunit Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B8GX16 1.01e-98 288 66 0 193 1 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain NA1000 / CB15N)
P0CAU1 1.01e-98 288 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A1AN85 1.07e-98 287 68 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q60C68 1.11e-98 287 68 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A9IR54 2.02e-98 287 67 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
C0R2W3 2.04e-98 287 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q2GFT8 2.15e-98 286 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q7VIN7 2.16e-98 286 68 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7VXI7 3.31e-98 286 66 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8X2 3.31e-98 286 66 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK83 3.31e-98 286 66 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q982V6 3.73e-98 286 66 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q21Y67 3.78e-98 286 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q73I59 3.93e-98 286 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Wolbachia pipientis wMel
Q89KG1 6.12e-98 286 65 0 194 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q92HM5 8.03e-98 285 67 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GSH5 9.88e-98 285 67 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia rickettsii (strain Sheila Smith)
C4K1D4 1.23e-97 285 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia peacockii (strain Rustic)
B7GL34 1.36e-97 284 67 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q3A3X5 1.47e-97 284 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5WDK0 1.98e-97 284 68 0 189 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Shouchella clausii (strain KSM-K16)
A6Q1C1 2e-97 284 69 0 186 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratiruptor sp. (strain SB155-2)
A6Q675 2.13e-97 284 66 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Sulfurovum sp. (strain NBC37-1)
Q6G178 2.83e-97 284 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella quintana (strain Toulouse)
B0CGR1 3.37e-97 284 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M5C2 3.37e-97 284 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q9L7X6 3.37e-97 284 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus biovar 1 (strain 9-941)
Q2YPX1 3.37e-97 284 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain 2308)
B2S5W1 3.37e-97 284 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella abortus (strain S19)
Q2L256 3.64e-97 283 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Bordetella avium (strain 197N)
A8HYF2 4.34e-97 283 66 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q8G0I4 4.89e-97 283 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella suis biovar 1 (strain 1330)
Q30NX1 5.54e-97 283 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q60BE8 5.59e-97 283 68 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A7Z939 6e-97 283 67 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q9X6W8 6.51e-97 283 66 1 198 3 clpP ATP-dependent Clp protease proteolytic subunit Azospirillum brasilense
Q2W3H9 6.59e-97 283 65 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q9ZD29 6.65e-97 283 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia prowazekii (strain Madrid E)
Q2IEW1 6.96e-97 283 66 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Anaeromyxobacter dehalogenans (strain 2CP-C)
B8J5G7 6.96e-97 283 66 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q68WL5 7.5e-97 283 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B9KDZ6 8.13e-97 282 69 0 186 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
B4UAX9 8.21e-97 283 66 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Anaeromyxobacter sp. (strain K)
Q1CT76 8.21e-97 282 68 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain HPAG1)
B5Z7F6 8.21e-97 282 68 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain G27)
B2UT37 8.3e-97 282 68 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain Shi470)
P56156 8.97e-97 282 68 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZL50 9.46e-97 282 68 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter pylori (strain J99 / ATCC 700824)
C4ZGF4 9.75e-97 282 68 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B0SZQ2 1.15e-96 282 63 0 199 3 clpP ATP-dependent Clp protease proteolytic subunit Caulobacter sp. (strain K31)
C4Z1T6 1.15e-96 282 67 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A9ISA4 1.31e-96 282 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q6G3Z3 1.33e-96 282 65 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A6TM61 1.34e-96 281 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus metalliredigens (strain QYMF)
A8FHN9 1.35e-96 282 67 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bacillus pumilus (strain SAFR-032)
Q07NN6 1.43e-96 282 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisA53)
A4ISQ2 1.45e-96 281 67 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus thermodenitrificans (strain NG80-2)
Q1DAT0 1.61e-96 282 66 0 190 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Myxococcus xanthus (strain DK1622)
A8MIS8 1.73e-96 281 66 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Alkaliphilus oremlandii (strain OhILAs)
A5EKA8 1.82e-96 282 66 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A9KDS6 2.1e-96 281 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Coxiella burnetii (strain Dugway 5J108-111)
B6J0W0 2.1e-96 281 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Coxiella burnetii (strain CbuG_Q212)
B6J8W4 2.1e-96 281 69 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Coxiella burnetii (strain CbuK_Q154)
B2A158 2.23e-96 281 65 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q2JV68 2.26e-96 281 67 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-3-3Ab)
Q1QVW1 2.52e-96 281 68 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q7M7M3 2.8e-96 281 68 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
B0TZA5 3.36e-96 281 64 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B6JGU7 3.88e-96 281 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q1GPH5 4.7e-96 281 64 0 195 3 clpP ATP-dependent Clp protease proteolytic subunit Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q0AWF0 5.09e-96 280 65 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q135W7 7.68e-96 280 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB5)
Q5KVD9 8.11e-96 280 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus kaustophilus (strain HTA426)
C5D7M9 9.45e-96 280 66 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Geobacillus sp. (strain WCH70)
A7ILC6 9.63e-96 280 64 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q83DJ2 1.37e-95 279 68 0 192 1 clpP ATP-dependent Clp protease proteolytic subunit Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDG0 1.37e-95 279 68 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Coxiella burnetii (strain RSA 331 / Henzerling II)
Q2IWZ4 1.46e-95 280 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain HaA2)
A8EVH5 1.7e-95 279 66 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Aliarcobacter butzleri (strain RM4018)
Q8YHC8 1.85e-95 279 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJ81 1.85e-95 279 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Brucella melitensis biotype 2 (strain ATCC 23457)
A4IYB6 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NH47 1.88e-95 279 63 0 191 1 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BM92 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. holarctica (strain OSU18)
A0Q6S9 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. novicida (strain U112)
B2SG18 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A3U1 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. holarctica (strain LVS)
A7NBR6 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q14IJ9 1.88e-95 279 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Francisella tularensis subsp. tularensis (strain FSC 198)
B3Q7P5 2.03e-95 279 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain TIE-1)
Q6N5L3 2.03e-95 279 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0AQ07 2.97e-95 279 63 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Maricaulis maris (strain MCS10)
Q9X5N0 2.99e-95 279 66 0 190 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus
Q65EI5 3.13e-95 278 67 0 192 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B3E1Z4 3.26e-95 278 66 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A0LEF1 3.28e-95 278 60 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q2JIP1 3.31e-95 278 65 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
A7HFV9 3.33e-95 278 62 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Anaeromyxobacter sp. (strain Fw109-5)
A7HZE8 4.01e-95 278 66 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q5HWX6 4.09e-95 278 68 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter jejuni (strain RM1221)
P54413 4.09e-95 278 68 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H1R0 4.09e-95 278 68 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FJZ3 4.09e-95 278 68 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9K709 4.13e-95 278 66 0 189 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B8I8F5 5.56e-95 278 63 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q215J2 6.05e-95 278 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodopseudomonas palustris (strain BisB18)
P80244 6.65e-95 278 67 0 192 1 clpP ATP-dependent Clp protease proteolytic subunit Bacillus subtilis (strain 168)
Q6HBD8 8.32e-95 277 64 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q631K2 8.32e-95 277 64 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ZK / E33L)
Q815J6 8.32e-95 277 64 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B8IN26 1.02e-94 278 63 0 195 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q1GGF6 1.23e-94 277 65 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria sp. (strain TM1040)
Q72XW9 1.29e-94 276 64 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1QL76 1.85e-94 277 63 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q5NNY8 1.87e-94 277 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A1VXS0 1.91e-94 276 67 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q3SRD2 1.94e-94 277 63 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q17XD3 2.16e-94 276 67 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Helicobacter acinonychis (strain Sheeba)
B0K533 2.78e-94 276 65 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Thermoanaerobacter sp. (strain X514)
B0KBA4 2.78e-94 276 65 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q11J60 3.3e-94 276 64 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Chelativorans sp. (strain BNC1)
B5YI38 3.99e-94 275 62 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q81X63 5.97e-94 275 64 0 193 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Bacillus anthracis
C4XH03 6.31e-94 275 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B8FA62 8.47e-94 275 63 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfatibacillum aliphaticivorans
Q8YXH5 8.98e-94 275 68 0 186 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O30612 9.9e-94 275 68 0 186 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Myxococcus xanthus (strain DK1622)
P54416 1.25e-93 274 66 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O67357 1.31e-93 275 65 0 191 1 clpP ATP-dependent Clp protease proteolytic subunit Aquifex aeolicus (strain VF5)
Q2RU45 1.74e-93 275 63 0 195 3 clpP ATP-dependent Clp protease proteolytic subunit Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B9KJU9 1.74e-93 275 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J1G6 1.74e-93 275 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PKS1 1.74e-93 275 65 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q317Y6 2.55e-93 274 65 0 195 3 clpP4 ATP-dependent Clp protease proteolytic subunit 4 Prochlorococcus marinus (strain MIT 9312)
A1USA7 2.56e-93 274 62 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B1LW28 2.58e-93 274 63 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q3MFR5 2.8e-93 274 68 0 186 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q165F9 3.18e-93 274 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q7UK66 3.27e-93 273 64 0 189 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B1L812 3.41e-93 273 63 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga sp. (strain RQ2)
A5IJ91 3.41e-93 273 63 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZF9 3.41e-93 273 63 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q49VZ2 3.53e-93 273 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5N1P6 4.91e-93 275 64 0 198 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
O34125 4.91e-93 275 64 0 198 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q928C4 6.26e-93 273 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A5EWF5 7.02e-93 273 68 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Dichelobacter nodosus (strain VCS1703A)
Q9RQI6 7.79e-93 272 64 0 194 1 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71WV9 7.79e-93 272 64 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Listeria monocytogenes serotype 4b (strain F2365)
C1F6W4 1.53e-92 271 65 1 190 3 clpP ATP-dependent Clp protease proteolytic subunit Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q1MK43 1.67e-92 271 63 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B1Z9C7 1.79e-92 272 63 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A4WSH8 1.9e-92 272 64 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A9W5F5 2.07e-92 271 63 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain PA1)
B7KNT0 2.07e-92 271 63 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Methylorubrum extorquens (strain CM4 / NCIMB 13688)
B9DJL4 2.12e-92 271 65 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus carnosus (strain TM300)
A1VE85 2.64e-92 271 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratidesulfovibrio vulgaris (strain DP4)
Q72CE8 2.64e-92 271 63 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A8LJA8 3.31e-92 271 62 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q8DLI2 1.19e-91 270 64 1 198 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7V9L6 1.37e-91 270 65 0 188 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B9EAG5 1.38e-91 269 65 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Macrococcus caseolyticus (strain JCSC5402)
P58277 1.56e-91 269 61 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium meliloti (strain 1021)
P63786 1.96e-91 269 64 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MW2)
A8Z045 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300 / TCH1516)
Q6GB62 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MSSA476)
Q6GIM3 1.96e-91 269 64 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain MRSA252)
P99089 1.96e-91 269 64 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain N315)
P63785 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QF76 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Newman)
Q5HHQ0 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain COL)
Q2YSF8 1.96e-91 269 64 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQX2 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH9)
Q2G036 1.96e-91 269 64 0 189 1 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIM5 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain USA300)
A6TZP7 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain JH1)
A7WZR9 1.96e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4L4J5 2.03e-91 269 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus haemolyticus (strain JCSC1435)
Q8RC25 2.12e-91 268 60 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5FUR3 2.63e-91 269 63 0 188 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gluconobacter oxydans (strain 621H)
Q8CTE0 4.61e-91 268 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQW0 4.61e-91 268 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q46ID4 4.81e-91 268 64 0 189 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain NATL2A)
Q7UZK7 7.13e-91 268 66 0 186 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A4SDA4 7.6e-91 268 59 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3ANI8 1.46e-90 267 65 0 186 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9605)
Q3B5V8 2.29e-90 267 59 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q30Z79 2.39e-90 266 63 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A8F754 2.5e-90 266 62 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q13UT1 2.65e-90 266 61 0 195 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Paraburkholderia xenovorans (strain LB400)
B8DNL4 2.89e-90 266 62 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q3M726 3.84e-90 266 63 0 192 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQX8 5.01e-90 266 63 0 192 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q59993 5.75e-90 266 63 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3B0U1 6.18e-90 265 63 0 186 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9902)
Q98M38 6.56e-90 265 60 0 192 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5FL55 7.28e-90 265 62 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A8YUD9 8.47e-90 265 62 0 191 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus helveticus (strain DPC 4571)
Q1IRD8 9.77e-90 264 65 1 188 3 clpP ATP-dependent Clp protease proteolytic subunit Koribacter versatilis (strain Ellin345)
A1BI15 1.29e-89 265 58 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8RHJ8 2.15e-89 263 64 1 188 3 clpP ATP-dependent Clp protease proteolytic subunit Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q2KAB9 2.58e-89 263 62 1 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q837R0 2.6e-89 263 60 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Enterococcus faecalis (strain ATCC 700802 / V583)
Q2GD19 2.69e-89 263 64 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
B2GAL4 3.64e-89 263 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8UEX6 3.74e-89 263 60 0 194 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8KC73 3.86e-89 264 59 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8CY74 4.44e-89 263 63 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q11I48 6.65e-89 263 58 0 195 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Chelativorans sp. (strain BNC1)
Q3ATL3 6.74e-89 263 59 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Chlorobium chlorochromatii (strain CaD3)
Q7UA36 9.15e-89 263 64 0 186 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Parasynechococcus marenigrum (strain WH8102)
B1HVR0 1.05e-88 262 64 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Lysinibacillus sphaericus (strain C3-41)
Q1MQ79 1.86e-88 261 61 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Lawsonia intracellularis (strain PHE/MN1-00)
Q7V992 2.47e-88 262 63 0 188 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain MIT 9313)
Q89WR7 3.19e-88 261 59 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B8IYM2 3.2e-88 261 59 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q38Y96 3.82e-88 260 61 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Latilactobacillus sakei subsp. sakei (strain 23K)
Q5N665 5.04e-88 260 61 0 192 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
P54415 5.04e-88 260 61 0 192 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q03AL0 6e-88 260 59 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WCR2 6e-88 260 59 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Lacticaseibacillus casei (strain BL23)
Q74K84 6.06e-88 260 62 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q042E8 6.06e-88 260 62 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5SKM8 8.05e-88 259 60 0 190 1 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72L15 8.05e-88 259 60 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5LUQ0 1.32e-87 259 60 0 192 3 clpP ATP-dependent Clp protease proteolytic subunit Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
B2G613 4.31e-87 258 62 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VII4 4.31e-87 258 62 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Limosilactobacillus reuteri (strain DSM 20016)
Q73M38 5.02e-87 258 62 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q2RZ59 7.06e-87 258 62 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Salinibacter ruber (strain DSM 13855 / M31)
Q1AVS9 8.14e-87 257 56 2 203 3 clpP ATP-dependent Clp protease proteolytic subunit Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q88YH9 9.56e-87 257 61 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03SM3 2.15e-86 256 59 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q1WTA8 4.53e-86 255 58 0 193 3 clpP ATP-dependent Clp protease proteolytic subunit Ligilactobacillus salivarius (strain UCC118)
Q03GX1 1.02e-85 254 60 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q2LTK5 1.03e-85 254 57 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Syntrophus aciditrophicus (strain SB)
O83520 1.27e-85 254 61 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Treponema pallidum (strain Nichols)
Q1GB31 3.13e-85 253 62 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q04BH7 3.86e-85 253 62 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q3AJN8 4.44e-84 250 61 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Synechococcus sp. (strain CC9605)
Q2S2L8 4.47e-84 251 58 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Salinibacter ruber (strain DSM 13855 / M31)
Q7U6N7 6.43e-84 249 61 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Parasynechococcus marenigrum (strain WH8102)
Q8F352 1.4e-83 249 61 0 189 3 clpP ATP-dependent Clp protease proteolytic subunit Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72SG6 1.4e-83 249 61 0 189 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7V7R2 1.8e-83 248 61 0 191 3 clpP3 ATP-dependent Clp protease proteolytic subunit 3 Prochlorococcus marinus (strain MIT 9313)
Q81CH1 5.07e-83 247 60 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6MBE9 5.65e-83 248 58 0 191 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Protochlamydia amoebophila (strain UWE25)
Q6HHU9 7.36e-83 247 60 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81PL4 7.36e-83 247 60 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus anthracis
Q3AY04 1.13e-82 246 60 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Synechococcus sp. (strain CC9902)
Q63AG0 1.6e-82 246 60 0 193 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Bacillus cereus (strain ZK / E33L)
Q46L44 1.83e-82 246 58 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain NATL2A)
C0QW91 3.09e-82 245 60 0 194 3 clpP ATP-dependent Clp protease proteolytic subunit Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q9FN42 3.94e-82 247 55 0 192 1 CLPP2 ATP-dependent Clp protease proteolytic subunit 2, mitochondrial Arabidopsis thaliana
Q05FR8 4.15e-82 245 54 1 193 3 clpP ATP-dependent Clp protease proteolytic subunit Carsonella ruddii (strain PV)
Q8DJZ9 7.51e-82 244 64 0 176 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7VC22 2.05e-81 243 58 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9K888 3.78e-81 243 59 0 188 3 clpP2 ATP-dependent Clp protease proteolytic subunit 2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q6MH11 7.67e-81 243 57 1 196 3 clpP ATP-dependent Clp protease proteolytic subunit Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q3ZX82 2.96e-80 241 57 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain CBDB1)
A5FRE5 2.96e-80 241 57 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q7NEW2 3.23e-80 240 57 1 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7V1W0 4.11e-80 240 58 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q660R2 4.15e-80 240 58 0 190 3 clpP ATP-dependent Clp protease proteolytic subunit Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0SMP6 7.26e-80 239 59 0 187 3 clpP ATP-dependent Clp protease proteolytic subunit Borreliella afzelii (strain PKo)
Q31BD5 9.02e-80 239 57 0 191 3 clpP1 ATP-dependent Clp protease proteolytic subunit 1 Prochlorococcus marinus (strain MIT 9312)
O88696 1.06e-79 242 57 0 187 1 Clpp ATP-dependent Clp protease proteolytic subunit, mitochondrial Mus musculus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00555
Feature type CDS
Gene clpP
Product ATP-dependent Clp endopeptidase proteolytic subunit ClpP
Location 143003 - 143626 (strand: 1)
Length 624 (nucleotides) / 207 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2111
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00574 Clp protease

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0740 Posttranslational modification, protein turnover, chaperones (O) O ATP-dependent protease ClpP, protease subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01358 ATP-dependent Clp protease, protease subunit [EC:3.4.21.92] Cell cycle - Caulobacter
Longevity regulating pathway - worm		 -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG000077 ATP-dependent Clp protease proteolytic subunit VF0074 Stress survival

Protein Sequence

MSFNDTQEQFAPNMALVPMVIEQTSRGERSYDIYSRLLKERIIFLTGQVEDHMANLIVAQMLFLEAENPEKDINLYINSPGGVITAGMSIYDTMQYIKADVSTICMGQACSMGAFLLSAGAKGKRICLPNSRVMIHQPLGGYQGQATDIQIHAQEILKVKSRMNELMAQHTGKSIEEIERDTERDRFLSANEALEYGLVDKVYTQRS

Flanking regions ( +/- flanking 50bp)

AAGTAAAATTGTTGTCATTGGCACCAATAAGAATGCAATAGGAGACAGATATGTCATTTAACGACACCCAGGAACAATTCGCACCTAATATGGCTTTGGTGCCGATGGTTATAGAGCAGACTTCACGAGGTGAGCGCTCTTACGATATTTATTCACGTTTATTAAAAGAACGTATCATTTTCCTGACTGGCCAAGTTGAAGATCATATGGCCAATCTCATTGTTGCTCAGATGTTGTTTTTAGAAGCTGAGAACCCAGAAAAAGATATTAACCTGTACATTAATTCACCGGGTGGTGTGATCACTGCAGGTATGTCGATTTATGACACAATGCAATATATCAAAGCGGATGTTAGCACTATTTGTATGGGACAAGCTTGTTCAATGGGTGCATTTTTATTATCTGCAGGTGCAAAAGGTAAACGTATTTGTCTACCTAACTCACGTGTCATGATCCACCAGCCTTTAGGTGGATACCAAGGCCAAGCGACAGATATTCAAATCCACGCTCAAGAAATTTTGAAAGTGAAATCGCGTATGAATGAGTTAATGGCTCAACATACGGGGAAATCTATTGAAGAAATAGAAAGAGATACTGAGCGTGATCGTTTCTTATCCGCTAACGAAGCGTTAGAATATGGTTTAGTTGATAAAGTTTATACACAACGCAGCTAGTCATATTCCGTTGTAATAGCTATGGAGTTAACAGGTTTTCTTTGTTATAG