Homologs in group_2135

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15790 FBDBKF_15790 75.9 Morganella morganii S1 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
EHELCC_19660 EHELCC_19660 75.9 Morganella morganii S2 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
NLDBIP_19615 NLDBIP_19615 75.9 Morganella morganii S4 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
LHKJJB_19605 LHKJJB_19605 75.9 Morganella morganii S3 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
HKOGLL_19495 HKOGLL_19495 75.9 Morganella morganii S5 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
F4V73_RS16520 F4V73_RS16520 79.0 Morganella psychrotolerans thiI tRNA uracil 4-sulfurtransferase ThiI

Distribution of the homologs in the orthogroup group_2135

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2135

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EU34 0.0 997 100 0 483 3 thiI tRNA sulfurtransferase Proteus mirabilis (strain HI4320)
Q7N0J9 0.0 825 81 0 481 3 thiI tRNA sulfurtransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JID5 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TPF8 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pestis (strain Pestoides F)
Q1CL83 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZR9 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC49 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pestis
Q1C4J3 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLE0 0.0 799 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66DV0 0.0 797 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K6U1 0.0 797 77 1 482 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B4TMA5 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella schwarzengrund (strain CVM19633)
B5BDA7 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella paratyphi A (strain AKU_12601)
Q5PFQ4 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EXG6 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella agona (strain SL483)
B5QTH3 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella enteritidis PT4 (strain P125109)
B5FKT0 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella dublin (strain CT_02021853)
A9MX06 0.0 796 77 0 481 3 thiI tRNA sulfurtransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SWR7 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella newport (strain SL254)
B4T8R6 0.0 796 78 0 481 3 thiI tRNA sulfurtransferase Salmonella heidelberg (strain SL476)
A1JNR2 0.0 795 77 1 482 3 thiI tRNA sulfurtransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5R6S6 0.0 795 77 0 481 3 thiI tRNA sulfurtransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
C6DB40 0.0 795 76 0 481 3 thiI tRNA sulfurtransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P55913 0.0 794 77 0 481 3 thiI tRNA sulfurtransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z8X1 0.0 794 77 0 481 3 thiI tRNA sulfurtransferase Salmonella typhi
C0Q7V0 0.0 794 77 0 481 3 thiI tRNA sulfurtransferase Salmonella paratyphi C (strain RKS4594)
Q57SD9 0.0 793 77 0 481 3 thiI tRNA sulfurtransferase Salmonella choleraesuis (strain SC-B67)
A9MM39 0.0 792 77 0 481 3 thiI tRNA sulfurtransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8AK31 0.0 792 77 0 481 3 thiI tRNA sulfurtransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D841 0.0 790 76 0 481 3 thiI tRNA sulfurtransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5Y0W8 0.0 788 77 0 481 3 thiI tRNA sulfurtransferase Klebsiella pneumoniae (strain 342)
B5Z3S9 0.0 788 76 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE74 0.0 788 76 0 481 1 thiI tRNA sulfurtransferase Escherichia coli O157:H7
A8GAP5 0.0 785 76 0 481 3 thiI tRNA sulfurtransferase Serratia proteamaculans (strain 568)
A6T5F6 0.0 777 77 0 481 3 thiI tRNA sulfurtransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VHS0 0.0 777 76 0 481 3 thiI tRNA sulfurtransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1LJH3 0.0 777 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NJ74 0.0 777 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UJP6 0.0 777 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LMG4 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RFB7 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain UTI89 / UPEC)
Q8FKB7 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A892 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O1:K1 / APEC
B7MQD8 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O81 (strain ED1a)
B7MD81 0.0 776 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7N8X6 0.0 775 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P77718 0.0 775 77 0 481 1 thiI tRNA sulfurtransferase Escherichia coli (strain K12)
B1XF11 0.0 775 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain K12 / DH10B)
C4ZTI0 0.0 775 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain K12 / MC4100 / BW2952)
Q3Z4Y6 0.0 774 77 0 481 3 thiI tRNA sulfurtransferase Shigella sonnei (strain Ss046)
Q83SG1 0.0 774 77 0 481 3 thiI tRNA sulfurtransferase Shigella flexneri
Q0T7G6 0.0 774 77 0 481 3 thiI tRNA sulfurtransferase Shigella flexneri serotype 5b (strain 8401)
B1J026 0.0 774 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B2U4M7 0.0 773 77 0 481 3 thiI tRNA sulfurtransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6HZM6 0.0 773 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain SE11)
A7ZX76 0.0 773 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O9:H4 (strain HS)
B7L657 0.0 773 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli (strain 55989 / EAEC)
Q325H8 0.0 772 77 0 481 3 thiI tRNA sulfurtransferase Shigella boydii serotype 4 (strain Sb227)
B7M3R2 0.0 771 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O8 (strain IAI1)
A7ZIH7 0.0 771 77 0 481 3 thiI tRNA sulfurtransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32JI1 0.0 768 76 0 481 3 thiI tRNA sulfurtransferase Shigella dysenteriae serotype 1 (strain Sd197)
C5BCI2 0.0 762 74 0 481 3 thiI tRNA sulfurtransferase Edwardsiella ictaluri (strain 93-146)
A6VQ53 0.0 717 70 0 482 3 thiI tRNA sulfurtransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65TP1 0.0 717 69 0 480 3 thiI tRNA sulfurtransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57849 0.0 708 67 1 482 3 thiI tRNA sulfurtransferase Pasteurella multocida (strain Pm70)
Q2NV91 0.0 704 69 1 482 3 thiI tRNA sulfurtransferase Sodalis glossinidius (strain morsitans)
Q0I3G4 0.0 701 67 0 482 3 thiI tRNA sulfurtransferase Histophilus somni (strain 129Pt)
B0UUA1 0.0 699 67 0 482 3 thiI tRNA sulfurtransferase Histophilus somni (strain 2336)
A5UC48 0.0 686 67 0 483 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain PittEE)
A5UEV3 0.0 685 67 0 482 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain PittGG)
Q7VKR6 0.0 681 66 0 480 3 thiI tRNA sulfurtransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q4QKG3 0.0 679 67 0 482 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain 86-028NP)
Q87RT6 0.0 677 67 0 481 3 thiI tRNA sulfurtransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MYC5 0.0 672 65 0 481 3 thiI tRNA sulfurtransferase Vibrio campbellii (strain ATCC BAA-1116)
B7VJ96 0.0 665 65 0 481 3 thiI tRNA sulfurtransferase Vibrio atlanticus (strain LGP32)
Q6LU02 0.0 662 64 0 481 3 thiI tRNA sulfurtransferase Photobacterium profundum (strain SS9)
C4LAC1 0.0 659 64 1 484 3 thiI tRNA sulfurtransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q7MN44 0.0 654 65 0 481 3 thiI tRNA sulfurtransferase Vibrio vulnificus (strain YJ016)
Q8DFA8 0.0 654 65 0 481 3 thiI tRNA sulfurtransferase Vibrio vulnificus (strain CMCP6)
Q8EGR4 0.0 650 63 2 483 3 thiI tRNA sulfurtransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A0KIY0 0.0 650 65 0 481 3 thiI tRNA sulfurtransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B6EIB2 0.0 648 64 0 481 3 thiI tRNA sulfurtransferase Aliivibrio salmonicida (strain LFI1238)
A4SP64 0.0 645 62 0 481 3 thiI tRNA sulfurtransferase Aeromonas salmonicida (strain A449)
Q0HSX1 0.0 644 62 2 483 3 thiI tRNA sulfurtransferase Shewanella sp. (strain MR-7)
A0KZA4 0.0 644 62 2 483 3 thiI tRNA sulfurtransferase Shewanella sp. (strain ANA-3)
Q0HGM0 0.0 643 62 2 483 3 thiI tRNA sulfurtransferase Shewanella sp. (strain MR-4)
Q9KTK8 0.0 640 66 1 482 3 thiI tRNA sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B0TQ31 0.0 640 60 1 483 3 thiI tRNA sulfurtransferase Shewanella halifaxensis (strain HAW-EB4)
A8H6W6 0.0 637 60 1 483 3 thiI tRNA sulfurtransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1RLU8 0.0 635 61 2 483 3 thiI tRNA sulfurtransferase Shewanella sp. (strain W3-18-1)
A4Y4X5 0.0 635 61 2 483 3 thiI tRNA sulfurtransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9KTM0 0.0 634 60 2 483 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS195)
A6WL09 0.0 634 60 2 483 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS185)
A3D2B7 0.0 634 60 2 483 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAU2 0.0 634 60 2 483 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS223)
Q487C7 0.0 634 62 1 483 3 thiI tRNA sulfurtransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8CQH4 0.0 633 59 1 483 3 thiI tRNA sulfurtransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1S8C9 0.0 633 62 2 483 3 thiI tRNA sulfurtransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QGN4 0.0 631 61 2 483 3 thiI tRNA sulfurtransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KQY3 0.0 629 60 1 483 3 thiI tRNA sulfurtransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A8FYK5 0.0 629 60 1 483 3 thiI tRNA sulfurtransferase Shewanella sediminis (strain HAW-EB3)
A1SWV3 0.0 624 61 1 483 3 thiI tRNA sulfurtransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q07ZD9 0.0 622 60 2 483 3 thiI tRNA sulfurtransferase Shewanella frigidimarina (strain NCIMB 400)
B5FBH1 0.0 620 62 0 481 3 thiI tRNA sulfurtransferase Aliivibrio fischeri (strain MJ11)
Q5E6Y5 0.0 619 62 0 481 3 thiI tRNA sulfurtransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q12L31 0.0 590 59 3 485 3 thiI tRNA sulfurtransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q493G5 0.0 538 51 3 484 3 thiI tRNA sulfurtransferase Blochmanniella pennsylvanica (strain BPEN)
Q21NG2 0.0 535 52 2 483 3 thiI tRNA sulfurtransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9HU66 3.7e-177 508 51 2 483 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V3L1 3.7e-177 508 51 2 483 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain LESB58)
Q02EP8 1.37e-176 507 51 2 483 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6VDN5 3.2e-176 506 51 2 483 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain PA7)
Q88CY4 9.01e-175 503 49 2 483 3 thiI tRNA sulfurtransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C1DHW2 4.62e-174 501 50 2 483 3 thiI tRNA sulfurtransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C3K7D0 3.79e-173 498 49 3 483 3 thiI tRNA sulfurtransferase Pseudomonas fluorescens (strain SBW25)
A4XZX0 1.09e-171 494 50 3 483 3 thiI tRNA sulfurtransferase Pseudomonas mendocina (strain ymp)
Q4ZLX9 3.06e-170 491 48 2 483 3 thiI tRNA sulfurtransferase Pseudomonas syringae pv. syringae (strain B728a)
Q88AM9 2.3e-169 489 47 2 483 3 thiI tRNA sulfurtransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3KJG6 2.4e-169 489 47 2 483 3 thiI tRNA sulfurtransferase Pseudomonas fluorescens (strain Pf0-1)
A1U6U9 5.36e-155 452 45 2 481 3 thiI tRNA sulfurtransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B8D4I6 9.54e-66 222 31 8 480 3 thiI tRNA sulfurtransferase Desulfurococcus amylolyticus (strain DSM 18924 / JCM 16383 / VKM B-2413 / 1221n)
Q96YE5 6.78e-54 188 33 9 369 3 thiI Probable tRNA sulfurtransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8ZT61 2.86e-53 189 30 10 431 3 thiI tRNA sulfurtransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q980G6 6.34e-53 185 34 6 365 3 thiI Probable tRNA sulfurtransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
C3MZC6 1.35e-52 184 33 9 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.16.27)
C3MXI0 6.74e-52 182 33 9 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
Q9HKT9 8.53e-52 185 29 9 476 3 thiI tRNA sulfurtransferase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
C4KIK6 1.69e-51 182 33 9 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MR91 1.8e-51 182 33 8 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3N7E8 2.06e-51 181 33 8 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NG28 2.06e-51 181 33 8 387 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q97AK6 2.26e-51 184 28 6 473 3 thiI tRNA sulfurtransferase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q4J6G3 4.52e-49 175 32 8 370 3 thiI Probable tRNA sulfurtransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9YEW8 1.62e-46 169 32 4 360 3 thiI Probable tRNA sulfurtransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8R9F0 3.86e-44 162 32 12 368 3 thiI Probable tRNA sulfurtransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B1HX36 2.55e-43 160 31 11 393 3 thiI Probable tRNA sulfurtransferase Lysinibacillus sphaericus (strain C3-41)
Q58341 3e-42 157 31 7 354 3 thiI Probable tRNA sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TQS4 3.3e-42 158 28 5 379 3 thiI Probable tRNA sulfurtransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8PU39 3.77e-42 157 29 6 376 3 thiI Probable tRNA sulfurtransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
B0K8J2 4.76e-42 157 30 10 357 3 thiI Probable tRNA sulfurtransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K3I5 5.33e-42 156 30 10 357 3 thiI Probable tRNA sulfurtransferase Thermoanaerobacter sp. (strain X514)
O29382 8.31e-42 156 36 9 301 3 thiI Probable tRNA sulfurtransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q03R12 1.71e-41 155 30 7 352 3 thiI Probable tRNA sulfurtransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q9K804 5.65e-41 154 30 11 392 3 thiI Probable tRNA sulfurtransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5N6D9 1.22e-40 153 29 10 377 3 thiI Probable tRNA sulfurtransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZV9 1.22e-40 153 29 10 377 3 thiI Probable tRNA sulfurtransferase Clostridium kluyveri (strain NBRC 12016)
C0ZH32 2.61e-40 152 30 14 387 3 thiI Probable tRNA sulfurtransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A8FG94 1.23e-39 150 30 12 397 3 thiI Probable tRNA sulfurtransferase Bacillus pumilus (strain SAFR-032)
Q042N0 1.53e-39 150 29 4 317 3 thiI Probable tRNA sulfurtransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A8YUL5 1.56e-39 150 30 8 367 3 thiI Probable tRNA sulfurtransferase Lactobacillus helveticus (strain DPC 4571)
Q8EVH8 1.99e-39 149 32 12 354 3 thiI Probable tRNA sulfurtransferase Malacoplasma penetrans (strain HF-2)
Q6GFZ2 2.25e-39 150 30 11 402 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MRSA252)
Q5JCY1 3.24e-39 149 31 10 365 3 thiI Probable tRNA sulfurtransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8NW49 5.54e-39 149 31 13 405 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MW2)
Q2RM06 5.72e-39 149 30 9 385 3 thiI Probable tRNA sulfurtransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q5KW56 1.18e-38 148 30 11 397 3 thiI Probable tRNA sulfurtransferase Geobacillus kaustophilus (strain HTA426)
Q2YTF0 2.07e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L756 2.09e-38 147 31 9 380 3 thiI Probable tRNA sulfurtransferase Staphylococcus haemolyticus (strain JCSC1435)
Q6G8L2 2.2e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MSSA476)
A4IRT9 2.33e-38 147 30 8 378 3 thiI Probable tRNA sulfurtransferase Geobacillus thermodenitrificans (strain NG80-2)
Q9CII1 2.81e-38 147 29 12 410 3 thiI Probable tRNA sulfurtransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q1WT71 3.24e-38 147 29 11 384 3 thiI Probable tRNA sulfurtransferase Ligilactobacillus salivarius (strain UCC118)
Q931P5 3.26e-38 147 30 13 405 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X3E5 3.26e-38 147 30 13 405 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8Z2N1 3.36e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHP9 3.36e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Newman)
Q5HF59 3.36e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain COL)
Q2FXL1 3.36e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG23 3.36e-38 147 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain USA300)
B7H703 3.66e-38 147 31 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain B4264)
Q74K02 4.3e-38 146 29 4 317 3 thiI Probable tRNA sulfurtransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q04B89 4.39e-38 146 30 9 380 3 thiI Probable tRNA sulfurtransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
A7Z7N3 4.93e-38 146 30 12 411 3 thiI Probable tRNA sulfurtransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A5ITN8 7.18e-38 146 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain JH9)
A6U2I2 7.18e-38 146 30 12 404 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain JH1)
Q6HCN0 9.47e-38 145 31 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9J151 9.47e-38 145 31 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain Q1)
B7HSI4 9.47e-38 145 31 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain AH187)
Q65G52 1.18e-37 145 30 12 397 3 thiI Probable tRNA sulfurtransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O27720 1.2e-37 145 32 12 375 3 thiI Probable tRNA sulfurtransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A8MHS1 1.56e-37 144 30 12 397 3 thiI Probable tRNA sulfurtransferase Alkaliphilus oremlandii (strain OhILAs)
B2GAZ4 1.56e-37 145 28 8 362 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q81KU0 1.59e-37 145 30 10 408 1 thiI Probable tRNA sulfurtransferase Bacillus anthracis
C1EUZ5 1.63e-37 145 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain 03BB102)
B7JS23 1.63e-37 145 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain AH820)
A0RJN9 1.63e-37 145 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus thuringiensis (strain Al Hakam)
C3L9V4 1.63e-37 145 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBB3 1.63e-37 145 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus anthracis (strain A0248)
C4Z0P7 2.15e-37 144 28 9 401 3 thiI Probable tRNA sulfurtransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
A5UKU4 2.17e-37 144 28 8 369 3 thiI Probable tRNA sulfurtransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A7GTS8 2.35e-37 144 31 11 399 3 thiI Probable tRNA sulfurtransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A4VUF4 2.4e-37 144 30 12 370 3 thiI Probable tRNA sulfurtransferase Streptococcus suis (strain 05ZYH33)
A4W0P5 2.4e-37 144 30 12 370 3 thiI Probable tRNA sulfurtransferase Streptococcus suis (strain 98HAH33)
A5IXS0 2.69e-37 144 34 7 270 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
A2RIA6 2.73e-37 144 28 9 399 3 thiI Probable tRNA sulfurtransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q03EN8 4.57e-37 144 29 9 361 3 thiI Probable tRNA sulfurtransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q817B1 5.17e-37 143 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q99TE8 7.77e-37 143 30 13 405 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain N315)
Q9PQ71 7.8e-37 142 29 16 401 3 thiI Probable tRNA sulfurtransferase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ58 7.8e-37 142 29 16 401 3 thiI Probable tRNA sulfurtransferase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q5WEC6 8.27e-37 143 30 9 357 3 thiI Probable tRNA sulfurtransferase Shouchella clausii (strain KSM-K16)
Q633E8 8.38e-37 143 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ZK / E33L)
Q49YE8 9.6e-37 143 29 7 377 3 thiI Probable tRNA sulfurtransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q72Z85 1.13e-36 142 30 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
C0M8U4 1.24e-36 142 29 10 377 3 thiI Probable tRNA sulfurtransferase Streptococcus equi subsp. equi (strain 4047)
B7IK47 1.27e-36 142 29 10 408 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain G9842)
O34595 1.41e-36 142 30 11 391 3 thiI Probable tRNA sulfurtransferase Bacillus subtilis (strain 168)
C0MGK8 1.52e-36 142 29 10 377 3 thiI Probable tRNA sulfurtransferase Streptococcus equi subsp. zooepidemicus (strain H70)
B5ZBR5 2.92e-36 141 29 14 398 3 thiI Probable tRNA sulfurtransferase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q8EPB3 3.6e-36 141 27 9 390 3 thiI Probable tRNA sulfurtransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A9NHG7 3.77e-36 141 27 15 397 3 thiI Probable tRNA sulfurtransferase Acholeplasma laidlawii (strain PG-8A)
C4ZAY9 6.99e-36 140 28 10 386 3 thiI Probable tRNA sulfurtransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
C5D693 1.06e-35 140 28 11 393 3 thiI Probable tRNA sulfurtransferase Geobacillus sp. (strain WCH70)
Q88UX4 2.48e-35 139 28 10 358 3 thiI Probable tRNA sulfurtransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B1IB49 2.86e-35 139 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain Hungary19A-6)
C1C6L4 3.06e-35 139 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain 70585)
Q8DQ92 3.13e-35 139 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04L36 3.13e-35 139 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q38XD3 3.41e-35 139 31 10 309 3 thiI Probable tRNA sulfurtransferase Latilactobacillus sakei subsp. sakei (strain 23K)
C1CJW9 5.59e-35 138 28 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain P1031)
C1CDN0 5.59e-35 138 28 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain JJA)
B8ZNS6 5.59e-35 138 28 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CS14 5.76e-35 138 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain Taiwan19F-14)
B2IP11 5.76e-35 138 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain CGSP14)
Q97RE1 5.76e-35 138 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E3Y2 5.76e-35 138 29 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q0ST36 6.16e-35 137 28 12 376 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain SM101 / Type A)
Q97EY4 6.89e-35 137 29 10 372 3 thiI Probable tRNA sulfurtransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A2RF72 7.7e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
B5XKV0 7.86e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1J7A5 8.6e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHI4 9.32e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
P0DF95 9.79e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF94 9.79e-35 137 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5FKW9 1.01e-34 137 31 4 264 3 thiI Probable tRNA sulfurtransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q48U81 1.02e-34 137 28 10 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JCG0 1.02e-34 137 28 10 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JMD8 1.06e-34 137 28 10 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q3K0E0 1.3e-34 137 28 12 385 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q189U8 1.6e-34 136 29 13 387 3 thiI Probable tRNA sulfurtransferase Clostridioides difficile (strain 630)
Q9HQ72 1.61e-34 136 30 5 330 3 thiI Probable tRNA sulfurtransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5A9 1.61e-34 136 30 5 330 3 thiI Probable tRNA sulfurtransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q8E4F9 2.07e-34 136 28 12 385 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype III (strain NEM316)
Q98PK4 2.89e-34 135 29 13 361 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9A0D8 4.57e-34 135 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M1
A6TQ96 5e-34 135 31 7 291 3 thiI Probable tRNA sulfurtransferase Alkaliphilus metalliredigens (strain QYMF)
Q8P1G9 5e-34 135 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCT0 5e-34 135 29 11 377 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q82ZW3 7.08e-34 135 27 8 407 3 thiI Probable tRNA sulfurtransferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8XKI3 7.27e-34 134 27 12 376 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain 13 / Type A)
Q0TQI5 7.72e-34 134 27 12 376 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q4A5Q7 8.57e-34 134 29 14 371 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis synoviae (strain 53)
A8AWF4 1.05e-33 134 28 11 368 3 thiI Probable tRNA sulfurtransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B7GGQ4 2.21e-33 133 28 9 356 3 thiI Probable tRNA sulfurtransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q8DYV1 3.22e-33 133 28 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A3CMR7 4.89e-33 132 27 11 386 3 thiI Probable tRNA sulfurtransferase Streptococcus sanguinis (strain SK36)
B9DU51 6.09e-33 132 28 15 397 3 thiI Probable tRNA sulfurtransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B2UX29 8.4e-33 131 28 5 283 3 thiI Probable tRNA sulfurtransferase Clostridium botulinum (strain Alaska E43 / Type E3)
B9E7C5 1.71e-32 131 28 7 392 3 thiI Probable tRNA sulfurtransferase Macrococcus caseolyticus (strain JCSC5402)
Q8DUR1 4.37e-32 130 28 11 364 3 thiI Probable tRNA sulfurtransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P47612 5.57e-32 129 27 13 385 3 thiI Probable tRNA sulfurtransferase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B8DHE9 5.93e-32 129 30 6 305 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4a (strain HCC23)
A3DEB6 1.44e-31 128 26 9 393 3 thiI Probable tRNA sulfurtransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8CNW7 2.31e-31 128 28 10 398 3 thiI Probable tRNA sulfurtransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNJ0 2.31e-31 128 28 10 398 3 thiI Probable tRNA sulfurtransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8Y6U0 2.39e-31 128 31 5 283 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92BB6 2.67e-31 127 30 4 279 3 thiI Probable tRNA sulfurtransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71Z75 3.38e-31 127 31 5 283 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVN9 3.38e-31 127 31 5 283 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0AJ41 8.38e-31 126 30 5 281 3 thiI Probable tRNA sulfurtransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A9KKT0 1.48e-30 125 28 9 379 3 thiI Probable tRNA sulfurtransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B0RZV0 2.26e-30 125 32 6 297 3 thiI Probable tRNA sulfurtransferase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
P75228 1.58e-29 122 27 11 375 3 thiI Probable tRNA sulfurtransferase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q039U0 1.62e-29 122 30 8 282 3 thiI Probable tRNA sulfurtransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WDV9 1.95e-29 122 30 8 282 3 thiI Probable tRNA sulfurtransferase Lacticaseibacillus casei (strain BL23)
Q5YY71 3.47e-28 119 32 9 283 3 thiI Probable tRNA sulfurtransferase Nocardia farcinica (strain IFM 10152)
Q5SHD4 5.95e-28 118 31 13 365 3 thiI Probable tRNA sulfurtransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72HP1 5.95e-28 118 31 13 365 3 thiI Probable tRNA sulfurtransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B2G6C3 1.41e-27 117 32 8 255 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIU7 1.41e-27 117 32 8 255 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus reuteri (strain DSM 20016)
B3PLZ2 3.63e-27 115 29 7 275 3 thiI Probable tRNA sulfurtransferase Metamycoplasma arthritidis (strain 158L3-1)
B2A8M8 5.3e-27 115 27 15 418 3 thiI Probable tRNA sulfurtransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q9X220 2.47e-26 113 26 11 393 1 thiI Probable tRNA sulfurtransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B8D0L5 6.18e-25 109 26 11 390 3 thiI Probable tRNA sulfurtransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
O83570 6.04e-24 107 30 6 280 3 thiI Probable tRNA sulfurtransferase Treponema pallidum (strain Nichols)
B2S3F1 8.59e-24 106 30 6 280 3 thiI Probable tRNA sulfurtransferase Treponema pallidum subsp. pallidum (strain SS14)
Q83CD9 3.74e-21 98 30 11 315 3 thiI Probable tRNA sulfurtransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q57864 6.84e-07 55 27 5 154 4 MJ0421 Uncharacterized protein MJ0421 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O28105 0.000566 45 24 5 166 3 trm14 tRNA (guanine(6)-N2)-methyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00465
Feature type CDS
Gene thiI
Product tRNA uracil 4-sulfurtransferase ThiI
Location 123898 - 125349 (strand: 1)
Length 1452 (nucleotides) / 483 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2135
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00581 Rhodanese-like domain
PF02568 Thiamine biosynthesis protein (ThiI)
PF02926 THUMP domain
PF22025 ThiI ferredoxin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0301 Coenzyme transport and metabolism (H)
Translation, ribosomal structure and biogenesis (J)
HJ Adenylyl- and sulfurtransferase ThiI (thiamine and tRNA 4-thiouridine biosynthesis)

Kegg Ortholog Annotation(s)

Protein Sequence

MKFIIKLFPEITIKSQSVRIRFIKILTSNIRNVLSTLGDDITVVRHWDNIVVVSKDESKSEAVCDALTRIPGIHHFLQVEEHSYTDLHNIFEQTFAAFGHLVENKTFCVRAKRRGKHSFTSNEVERYVGGGFNQHVESAKVKLTRPDVTINLEIEDDKLILVNARYEGIGGFPIGTQEDVLSLISGGYDSGVSSYMLMRRGSRVHYCFFNLGGSAHEIGVKQVAHYLWNRFGRSHKVHFVAVDFEPVVAEILEKIDDGQMGVVLKRMMVRAASRVAERYGVQAIVTGEALGQVSSQTLTNLRLIDNATDTLILRPLITHDKENIINIARQIGTEDFARTMPEFCGVISKNPTVKAVKAKIEAEEEKFDFSILDSVVENAKNMDIRRIAEETVQQVTEVEMVSEFATNDVVLDIRSPEEQENSPLKLEGVDVKELPFYKLSTQFGDLDNSKTYLLYCERGMMSRLQALYLREQGFNNVKVYRKK

Flanking regions ( +/- flanking 50bp)

TAATATCACTGTAGTTTATGTCTCTACTTAATAACCTATGACCATTGACTATGAAGTTTATTATTAAATTATTCCCCGAAATCACGATCAAAAGCCAATCTGTTCGTATACGTTTTATCAAAATTCTGACCAGTAATATTCGCAATGTATTAAGTACATTAGGTGATGATATCACGGTTGTTCGCCACTGGGACAACATTGTGGTTGTCAGTAAAGACGAAAGTAAAAGCGAAGCGGTGTGTGATGCGCTAACTCGTATCCCAGGTATTCATCACTTTTTACAAGTTGAAGAGCATAGCTATACCGATTTACATAATATTTTTGAACAGACCTTTGCTGCCTTTGGTCATTTAGTTGAAAACAAAACGTTTTGCGTAAGAGCTAAACGCCGTGGTAAACACAGTTTTACTTCTAATGAAGTAGAGCGTTATGTGGGTGGTGGTTTTAACCAACACGTTGAAAGTGCAAAAGTAAAATTAACTCGTCCGGATGTGACCATTAATCTAGAAATTGAAGATGATAAGCTGATCCTAGTTAATGCTCGCTATGAAGGTATTGGTGGTTTCCCTATTGGTACACAAGAAGATGTATTATCACTTATCTCTGGTGGTTATGATTCTGGTGTATCAAGTTATATGTTGATGCGCCGCGGTAGTCGTGTTCATTACTGCTTTTTTAATCTTGGTGGTTCAGCCCACGAAATTGGCGTTAAACAAGTTGCACATTATCTTTGGAACCGCTTTGGACGCTCTCATAAAGTACATTTTGTTGCCGTTGATTTTGAACCCGTTGTGGCAGAAATTTTAGAGAAAATTGATGATGGCCAGATGGGGGTTGTTCTGAAACGTATGATGGTGCGTGCGGCATCTCGTGTTGCTGAGCGTTATGGCGTACAAGCTATTGTAACAGGTGAAGCATTAGGGCAGGTTTCTAGCCAAACATTAACCAATCTACGTTTAATTGATAATGCGACGGATACCTTAATTCTGCGTCCTCTTATCACACACGATAAAGAAAATATCATTAATATCGCTCGCCAAATTGGTACGGAAGATTTTGCTCGTACTATGCCAGAGTTTTGTGGTGTTATCTCCAAGAATCCTACAGTAAAAGCGGTTAAAGCCAAAATCGAAGCTGAAGAAGAAAAATTTGATTTTTCTATTCTCGATAGTGTTGTTGAAAATGCTAAGAATATGGATATTCGCCGTATTGCTGAAGAGACGGTACAGCAAGTAACAGAAGTTGAAATGGTCTCTGAGTTTGCAACGAATGACGTTGTACTGGATATCCGCTCTCCAGAAGAACAAGAAAACTCACCTCTAAAATTAGAGGGTGTAGATGTTAAAGAATTACCATTTTATAAATTAAGTACACAATTTGGTGATTTAGATAACAGCAAAACTTATTTGCTCTATTGTGAGCGAGGTATGATGAGTCGTTTACAAGCACTATATTTACGTGAACAAGGCTTTAATAACGTAAAAGTGTATCGTAAGAAGTAATATAGTTATTTTTTATGAAAGTCGTATTAATAATATAATAGAGATACCCC