Homologs in group_2097

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15790 FBDBKF_15790 81.0 Morganella morganii S1 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
EHELCC_19660 EHELCC_19660 81.0 Morganella morganii S2 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
NLDBIP_19615 NLDBIP_19615 81.0 Morganella morganii S4 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
LHKJJB_19605 LHKJJB_19605 81.0 Morganella morganii S3 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
HKOGLL_19495 HKOGLL_19495 81.0 Morganella morganii S5 - Sulfurtransferase required for thiamine and 4-thiouridine biosynthesis
PMI_RS00465 PMI_RS00465 79.0 Proteus mirabilis HI4320 thiI tRNA uracil 4-sulfurtransferase ThiI

Distribution of the homologs in the orthogroup group_2097

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2097

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N0J9 0.0 802 79 0 482 3 thiI tRNA sulfurtransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B4EU34 0.0 795 79 0 481 3 thiI tRNA sulfurtransferase Proteus mirabilis (strain HI4320)
A1JNR2 0.0 775 75 1 483 3 thiI tRNA sulfurtransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JID5 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TPF8 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pestis (strain Pestoides F)
Q1CL83 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZR9 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC49 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pestis
Q1C4J3 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLE0 0.0 771 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q66DV0 0.0 770 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K6U1 0.0 770 75 1 483 3 thiI tRNA sulfurtransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B4TMA5 0.0 764 76 0 482 3 thiI tRNA sulfurtransferase Salmonella schwarzengrund (strain CVM19633)
B5BDA7 0.0 764 76 0 482 3 thiI tRNA sulfurtransferase Salmonella paratyphi A (strain AKU_12601)
Q5PFQ4 0.0 764 76 0 482 3 thiI tRNA sulfurtransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5EXG6 0.0 764 76 0 482 3 thiI tRNA sulfurtransferase Salmonella agona (strain SL483)
A9MX06 0.0 763 76 0 482 3 thiI tRNA sulfurtransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q8Z8X1 0.0 762 76 0 482 3 thiI tRNA sulfurtransferase Salmonella typhi
B4SWR7 0.0 761 76 0 482 3 thiI tRNA sulfurtransferase Salmonella newport (strain SL254)
B4T8R6 0.0 761 76 0 482 3 thiI tRNA sulfurtransferase Salmonella heidelberg (strain SL476)
A8GAP5 0.0 761 75 0 482 3 thiI tRNA sulfurtransferase Serratia proteamaculans (strain 568)
A9MM39 0.0 761 76 0 482 3 thiI tRNA sulfurtransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5QTH3 0.0 760 76 0 482 3 thiI tRNA sulfurtransferase Salmonella enteritidis PT4 (strain P125109)
B5FKT0 0.0 760 76 0 482 3 thiI tRNA sulfurtransferase Salmonella dublin (strain CT_02021853)
B5R6S6 0.0 760 76 0 482 3 thiI tRNA sulfurtransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
P55913 0.0 759 76 0 482 3 thiI tRNA sulfurtransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0Q7V0 0.0 759 76 0 482 3 thiI tRNA sulfurtransferase Salmonella paratyphi C (strain RKS4594)
C6DB40 0.0 758 73 0 482 3 thiI tRNA sulfurtransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q57SD9 0.0 758 76 0 482 3 thiI tRNA sulfurtransferase Salmonella choleraesuis (strain SC-B67)
Q6D841 0.0 757 74 0 482 3 thiI tRNA sulfurtransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8AK31 0.0 757 76 0 482 3 thiI tRNA sulfurtransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5Y0W8 0.0 757 75 0 482 3 thiI tRNA sulfurtransferase Klebsiella pneumoniae (strain 342)
B5Z3S9 0.0 755 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE74 0.0 755 75 0 482 1 thiI tRNA sulfurtransferase Escherichia coli O157:H7
B2VHS0 0.0 752 74 0 482 3 thiI tRNA sulfurtransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A6T5F6 0.0 747 75 0 482 3 thiI tRNA sulfurtransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C5BCI2 0.0 743 73 0 482 3 thiI tRNA sulfurtransferase Edwardsiella ictaluri (strain 93-146)
Q3Z4Y6 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Shigella sonnei (strain Ss046)
B7LMG4 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LJH3 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NJ74 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UJP6 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N8X6 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P77718 0.0 743 75 0 482 1 thiI tRNA sulfurtransferase Escherichia coli (strain K12)
B1XF11 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain K12 / DH10B)
C4ZTI0 0.0 743 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain K12 / MC4100 / BW2952)
Q83SG1 0.0 742 75 0 482 3 thiI tRNA sulfurtransferase Shigella flexneri
Q0T7G6 0.0 742 75 0 482 3 thiI tRNA sulfurtransferase Shigella flexneri serotype 5b (strain 8401)
Q1RFB7 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain UTI89 / UPEC)
B1J026 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q8FKB7 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A892 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O1:K1 / APEC
B7MQD8 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O81 (strain ED1a)
B7MD81 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZX76 0.0 741 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O9:H4 (strain HS)
B6HZM6 0.0 740 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain SE11)
B7L657 0.0 740 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli (strain 55989 / EAEC)
Q325H8 0.0 739 75 0 482 3 thiI tRNA sulfurtransferase Shigella boydii serotype 4 (strain Sb227)
A7ZIH7 0.0 739 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32JI1 0.0 739 75 0 482 3 thiI tRNA sulfurtransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7M3R2 0.0 738 75 0 482 3 thiI tRNA sulfurtransferase Escherichia coli O8 (strain IAI1)
B2U4M7 0.0 738 75 0 481 3 thiI tRNA sulfurtransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q2NV91 0.0 702 70 2 485 3 thiI tRNA sulfurtransferase Sodalis glossinidius (strain morsitans)
Q65TP1 0.0 697 68 0 480 3 thiI tRNA sulfurtransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57849 0.0 693 68 1 481 3 thiI tRNA sulfurtransferase Pasteurella multocida (strain Pm70)
A6VQ53 0.0 687 68 0 480 3 thiI tRNA sulfurtransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q0I3G4 0.0 682 67 0 479 3 thiI tRNA sulfurtransferase Histophilus somni (strain 129Pt)
B0UUA1 0.0 680 67 0 479 3 thiI tRNA sulfurtransferase Histophilus somni (strain 2336)
A5UEV3 0.0 664 66 0 480 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain PittGG)
A5UC48 0.0 663 66 0 480 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain PittEE)
Q4QKG3 0.0 660 66 0 480 3 thiI tRNA sulfurtransferase Haemophilus influenzae (strain 86-028NP)
Q7VKR6 0.0 658 66 0 480 3 thiI tRNA sulfurtransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q87RT6 0.0 655 65 0 482 3 thiI tRNA sulfurtransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MYC5 0.0 649 64 0 482 3 thiI tRNA sulfurtransferase Vibrio campbellii (strain ATCC BAA-1116)
B7VJ96 0.0 649 64 0 482 3 thiI tRNA sulfurtransferase Vibrio atlanticus (strain LGP32)
Q6LU02 0.0 641 63 0 482 3 thiI tRNA sulfurtransferase Photobacterium profundum (strain SS9)
B6EIB2 0.0 633 63 0 482 3 thiI tRNA sulfurtransferase Aliivibrio salmonicida (strain LFI1238)
Q8DFA8 0.0 632 63 0 482 3 thiI tRNA sulfurtransferase Vibrio vulnificus (strain CMCP6)
Q8EGR4 0.0 632 61 1 484 3 thiI tRNA sulfurtransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7MN44 0.0 632 63 0 482 3 thiI tRNA sulfurtransferase Vibrio vulnificus (strain YJ016)
A1RLU8 0.0 631 61 1 484 3 thiI tRNA sulfurtransferase Shewanella sp. (strain W3-18-1)
A4Y4X5 0.0 631 61 1 484 3 thiI tRNA sulfurtransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9KTM0 0.0 631 60 1 484 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS195)
A6WL09 0.0 631 60 1 484 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS185)
A3D2B7 0.0 631 60 1 484 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAU2 0.0 631 60 1 484 3 thiI tRNA sulfurtransferase Shewanella baltica (strain OS223)
Q0HSX1 0.0 630 61 1 484 3 thiI tRNA sulfurtransferase Shewanella sp. (strain MR-7)
A3QGN4 0.0 630 61 1 484 3 thiI tRNA sulfurtransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A0KZA4 0.0 629 61 1 484 3 thiI tRNA sulfurtransferase Shewanella sp. (strain ANA-3)
Q0HGM0 0.0 629 61 1 484 3 thiI tRNA sulfurtransferase Shewanella sp. (strain MR-4)
B0TQ31 0.0 629 60 1 484 3 thiI tRNA sulfurtransferase Shewanella halifaxensis (strain HAW-EB4)
A8H6W6 0.0 627 60 1 484 3 thiI tRNA sulfurtransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8CQH4 0.0 624 60 1 484 3 thiI tRNA sulfurtransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q9KTK8 0.0 624 66 1 483 3 thiI tRNA sulfurtransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q07ZD9 0.0 624 61 1 484 3 thiI tRNA sulfurtransferase Shewanella frigidimarina (strain NCIMB 400)
A1S8C9 0.0 623 61 1 484 3 thiI tRNA sulfurtransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C4LAC1 0.0 622 62 1 483 3 thiI tRNA sulfurtransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A4SP64 0.0 621 61 0 482 3 thiI tRNA sulfurtransferase Aeromonas salmonicida (strain A449)
A0KIY0 0.0 620 62 0 482 3 thiI tRNA sulfurtransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B1KQY3 0.0 616 58 1 484 3 thiI tRNA sulfurtransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A8FYK5 0.0 614 58 1 484 3 thiI tRNA sulfurtransferase Shewanella sediminis (strain HAW-EB3)
Q487C7 0.0 606 59 1 484 3 thiI tRNA sulfurtransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q12L31 0.0 600 59 2 486 3 thiI tRNA sulfurtransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1SWV3 0.0 600 60 2 485 3 thiI tRNA sulfurtransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B5FBH1 0.0 597 60 0 482 3 thiI tRNA sulfurtransferase Aliivibrio fischeri (strain MJ11)
Q5E6Y5 0.0 596 60 0 482 3 thiI tRNA sulfurtransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q493G5 0.0 535 51 3 485 3 thiI tRNA sulfurtransferase Blochmanniella pennsylvanica (strain BPEN)
Q21NG2 0.0 523 53 3 484 3 thiI tRNA sulfurtransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
C1DHW2 2.84e-172 496 51 2 484 3 thiI tRNA sulfurtransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q88CY4 3.42e-169 488 50 2 484 3 thiI tRNA sulfurtransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
C3K7D0 1.76e-166 481 49 2 484 3 thiI tRNA sulfurtransferase Pseudomonas fluorescens (strain SBW25)
A6VDN5 8.93e-166 479 50 3 489 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain PA7)
Q02EP8 1.01e-165 479 50 2 484 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HU66 2.26e-165 478 50 2 484 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V3L1 2.26e-165 478 50 2 484 3 thiI tRNA sulfurtransferase Pseudomonas aeruginosa (strain LESB58)
Q4ZLX9 2.41e-165 478 48 2 484 3 thiI tRNA sulfurtransferase Pseudomonas syringae pv. syringae (strain B728a)
Q88AM9 1.14e-164 477 48 2 484 3 thiI tRNA sulfurtransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XZX0 4.09e-164 475 50 2 484 3 thiI tRNA sulfurtransferase Pseudomonas mendocina (strain ymp)
Q3KJG6 5.37e-164 475 48 2 484 3 thiI tRNA sulfurtransferase Pseudomonas fluorescens (strain Pf0-1)
A1U6U9 1.04e-154 451 47 2 483 3 thiI tRNA sulfurtransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B8D4I6 8.23e-64 217 31 9 479 3 thiI tRNA sulfurtransferase Desulfurococcus amylolyticus (strain DSM 18924 / JCM 16383 / VKM B-2413 / 1221n)
Q96YE5 1.07e-54 190 32 6 367 3 thiI Probable tRNA sulfurtransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8ZT61 5.8e-52 186 32 10 406 3 thiI tRNA sulfurtransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
C3MZC6 5.46e-50 177 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.16.27)
C3MR91 6e-50 177 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3N7E8 9.11e-50 177 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NG28 9.11e-50 177 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q4J6G3 1.2e-49 177 33 8 374 3 thiI Probable tRNA sulfurtransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
C3MXI0 1.81e-49 176 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KIK6 4.49e-49 175 33 8 368 3 thiI Probable tRNA sulfurtransferase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
A5N6D9 6.25e-48 172 31 9 375 3 thiI Probable tRNA sulfurtransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZV9 6.25e-48 172 31 9 375 3 thiI Probable tRNA sulfurtransferase Clostridium kluyveri (strain NBRC 12016)
Q8R9F0 2.83e-47 171 32 11 367 3 thiI Probable tRNA sulfurtransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9HKT9 3.64e-47 173 28 9 478 3 thiI tRNA sulfurtransferase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q980G6 4.28e-46 167 32 5 364 3 thiI Probable tRNA sulfurtransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O29382 8.99e-46 166 35 9 323 3 thiI Probable tRNA sulfurtransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q2RM06 1.33e-44 164 33 8 378 3 thiI Probable tRNA sulfurtransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9YEW8 1.65e-44 164 33 4 360 3 thiI Probable tRNA sulfurtransferase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
B0K8J2 1.69e-43 160 32 10 336 3 thiI Probable tRNA sulfurtransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K3I5 3.04e-43 160 32 10 336 3 thiI Probable tRNA sulfurtransferase Thermoanaerobacter sp. (strain X514)
Q58341 1.44e-42 158 31 10 357 3 thiI Probable tRNA sulfurtransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4L756 1.79e-42 158 32 8 389 3 thiI Probable tRNA sulfurtransferase Staphylococcus haemolyticus (strain JCSC1435)
Q97AK6 2.53e-42 159 27 12 477 3 thiI tRNA sulfurtransferase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q9K804 3.08e-42 157 32 9 366 3 thiI Probable tRNA sulfurtransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1WT71 3.52e-42 157 30 11 388 3 thiI Probable tRNA sulfurtransferase Ligilactobacillus salivarius (strain UCC118)
Q88UX4 7.65e-42 157 32 13 360 3 thiI Probable tRNA sulfurtransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C0ZH32 1.14e-41 156 29 15 407 3 thiI Probable tRNA sulfurtransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q0ST36 7.92e-41 153 29 13 382 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain SM101 / Type A)
B2GAZ4 8.01e-41 154 29 9 362 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
A8MHS1 8.36e-41 154 30 12 395 3 thiI Probable tRNA sulfurtransferase Alkaliphilus oremlandii (strain OhILAs)
Q8TQS4 9.49e-41 154 28 7 389 3 thiI Probable tRNA sulfurtransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q03EN8 1.14e-40 153 30 10 363 3 thiI Probable tRNA sulfurtransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B1HX36 1.33e-40 153 29 8 382 3 thiI Probable tRNA sulfurtransferase Lysinibacillus sphaericus (strain C3-41)
O27720 1.41e-40 153 30 9 379 3 thiI Probable tRNA sulfurtransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q03R12 1.87e-40 153 30 7 352 3 thiI Probable tRNA sulfurtransferase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A8YUL5 4.96e-40 152 30 8 388 3 thiI Probable tRNA sulfurtransferase Lactobacillus helveticus (strain DPC 4571)
Q6GFZ2 5e-40 152 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MRSA252)
Q6G8L2 5.11e-40 152 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MSSA476)
Q2YTF0 5.32e-40 152 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q931P5 6.2e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X3E5 6.2e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8XKI3 6.7e-40 151 29 13 382 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain 13 / Type A)
A8Z2N1 9.5e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHP9 9.5e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain Newman)
Q5HF59 9.5e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain COL)
Q2FXL1 9.5e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG23 9.5e-40 151 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain USA300)
Q0TQI5 1.02e-39 150 29 14 385 3 thiI Probable tRNA sulfurtransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A9NHG7 1.29e-39 150 27 12 400 3 thiI Probable tRNA sulfurtransferase Acholeplasma laidlawii (strain PG-8A)
A5ITN8 1.44e-39 150 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain JH9)
A6U2I2 1.44e-39 150 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain JH1)
Q04B89 3.56e-39 149 31 8 361 3 thiI Probable tRNA sulfurtransferase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
C4Z0P7 4.31e-39 149 30 7 360 3 thiI Probable tRNA sulfurtransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q8PU39 9.15e-39 148 28 9 390 3 thiI Probable tRNA sulfurtransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q97EY4 1.01e-38 147 29 11 390 3 thiI Probable tRNA sulfurtransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8NW49 1.01e-38 148 30 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain MW2)
A4IRT9 1.13e-38 148 30 8 379 3 thiI Probable tRNA sulfurtransferase Geobacillus thermodenitrificans (strain NG80-2)
Q5KW56 1.16e-38 148 29 7 374 3 thiI Probable tRNA sulfurtransferase Geobacillus kaustophilus (strain HTA426)
Q99TE8 1.43e-38 148 31 11 394 3 thiI Probable tRNA sulfurtransferase Staphylococcus aureus (strain N315)
Q5JCY1 1.93e-38 147 30 9 366 3 thiI Probable tRNA sulfurtransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A8FG94 1.1e-37 145 28 9 402 3 thiI Probable tRNA sulfurtransferase Bacillus pumilus (strain SAFR-032)
Q65G52 3.85e-37 144 31 14 393 3 thiI Probable tRNA sulfurtransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q49YE8 6.98e-37 143 30 6 375 3 thiI Probable tRNA sulfurtransferase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8EPB3 8.3e-37 143 28 9 387 3 thiI Probable tRNA sulfurtransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A5UKU4 9.67e-37 142 28 8 372 3 thiI Probable tRNA sulfurtransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B7H703 1.1e-36 142 30 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain B4264)
C5D693 1.7e-36 142 29 8 367 3 thiI Probable tRNA sulfurtransferase Geobacillus sp. (strain WCH70)
Q72Z85 4.05e-36 141 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q189U8 4.4e-36 140 30 14 393 3 thiI Probable tRNA sulfurtransferase Clostridioides difficile (strain 630)
C1EUZ5 5.76e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain 03BB102)
B7JS23 5.76e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain AH820)
A0RJN9 5.76e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus thuringiensis (strain Al Hakam)
C3L9V4 5.76e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PBB3 5.76e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus anthracis (strain A0248)
Q81KU0 5.88e-36 140 29 8 381 1 thiI Probable tRNA sulfurtransferase Bacillus anthracis
Q5WEC6 6.54e-36 140 32 9 354 3 thiI Probable tRNA sulfurtransferase Shouchella clausii (strain KSM-K16)
Q6HCN0 8.96e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B9J151 8.96e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain Q1)
B7HSI4 8.96e-36 140 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain AH187)
Q5FKW9 9.78e-36 140 29 8 388 3 thiI Probable tRNA sulfurtransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B7GGQ4 1.09e-35 140 30 9 349 3 thiI Probable tRNA sulfurtransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q8EVH8 1.6e-35 139 29 11 340 3 thiI Probable tRNA sulfurtransferase Malacoplasma penetrans (strain HF-2)
Q817B1 1.86e-35 139 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5IXS0 2e-35 139 32 5 258 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q633E8 2.99e-35 139 29 8 381 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain ZK / E33L)
Q38XD3 3.16e-35 139 29 13 361 3 thiI Probable tRNA sulfurtransferase Latilactobacillus sakei subsp. sakei (strain 23K)
Q042N0 5.38e-35 138 28 8 363 3 thiI Probable tRNA sulfurtransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
C4ZAY9 6.48e-35 137 27 5 374 3 thiI Probable tRNA sulfurtransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A7Z7N3 9.72e-35 137 29 10 382 3 thiI Probable tRNA sulfurtransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B7IK47 1.07e-34 137 29 8 375 3 thiI Probable tRNA sulfurtransferase Bacillus cereus (strain G9842)
B9E7C5 1.08e-34 137 28 7 386 3 thiI Probable tRNA sulfurtransferase Macrococcus caseolyticus (strain JCSC5402)
A7GTS8 1.17e-34 137 29 10 396 3 thiI Probable tRNA sulfurtransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
O34595 2.25e-34 136 29 9 372 3 thiI Probable tRNA sulfurtransferase Bacillus subtilis (strain 168)
Q9CII1 3.03e-34 136 30 11 356 3 thiI Probable tRNA sulfurtransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q74K02 3.07e-34 136 28 8 363 3 thiI Probable tRNA sulfurtransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A6TQ96 4.64e-34 135 29 7 341 3 thiI Probable tRNA sulfurtransferase Alkaliphilus metalliredigens (strain QYMF)
A2RIA6 5.09e-34 135 29 11 356 3 thiI Probable tRNA sulfurtransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q92BB6 1.34e-33 134 28 10 382 3 thiI Probable tRNA sulfurtransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8CNW7 1.36e-33 134 29 8 389 3 thiI Probable tRNA sulfurtransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNJ0 1.36e-33 134 29 8 389 3 thiI Probable tRNA sulfurtransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B5ZBR5 2.12e-33 133 27 13 398 3 thiI Probable tRNA sulfurtransferase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
B8DHE9 2.34e-33 133 28 9 376 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4a (strain HCC23)
A3DEB6 2.39e-33 133 29 4 289 3 thiI Probable tRNA sulfurtransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q5YY71 3.58e-33 133 32 11 331 3 thiI Probable tRNA sulfurtransferase Nocardia farcinica (strain IFM 10152)
Q9PQ71 8.43e-33 131 28 16 411 3 thiI Probable tRNA sulfurtransferase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AJ58 8.43e-33 131 28 16 411 3 thiI Probable tRNA sulfurtransferase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
Q82ZW3 8.85e-33 132 27 10 414 3 thiI Probable tRNA sulfurtransferase Enterococcus faecalis (strain ATCC 700802 / V583)
A4VUF4 9e-33 132 27 11 365 3 thiI Probable tRNA sulfurtransferase Streptococcus suis (strain 05ZYH33)
A4W0P5 9e-33 132 27 11 365 3 thiI Probable tRNA sulfurtransferase Streptococcus suis (strain 98HAH33)
Q8DQ92 9.97e-33 132 27 12 405 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04L36 9.97e-33 132 27 12 405 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1CS14 1.18e-32 131 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain Taiwan19F-14)
B2IP11 1.18e-32 131 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain CGSP14)
Q97RE1 1.18e-32 131 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B5E3Y2 1.18e-32 131 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae serotype 19F (strain G54)
B2UX29 1.32e-32 131 27 9 373 3 thiI Probable tRNA sulfurtransferase Clostridium botulinum (strain Alaska E43 / Type E3)
B1IB49 1.81e-32 131 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain Hungary19A-6)
A0AJ41 2.78e-32 130 26 11 405 3 thiI Probable tRNA sulfurtransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71Z75 2.95e-32 130 28 10 381 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVN9 2.95e-32 130 28 10 381 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y6U0 2.98e-32 130 27 9 376 3 thiI Probable tRNA sulfurtransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
C1C6L4 3.06e-32 130 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain 70585)
Q039U0 6.1e-32 129 27 13 395 3 thiI Probable tRNA sulfurtransferase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
C0M8U4 6.63e-32 129 26 13 394 3 thiI Probable tRNA sulfurtransferase Streptococcus equi subsp. equi (strain 4047)
Q9HQ72 8.01e-32 129 27 4 380 3 thiI Probable tRNA sulfurtransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5A9 8.01e-32 129 27 4 380 3 thiI Probable tRNA sulfurtransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
C1CJW9 8.33e-32 129 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain P1031)
C1CDN0 8.33e-32 129 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain JJA)
B8ZNS6 8.33e-32 129 27 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B2A8M8 8.36e-32 129 27 15 417 3 thiI Probable tRNA sulfurtransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C0MGK8 1e-31 129 26 13 394 3 thiI Probable tRNA sulfurtransferase Streptococcus equi subsp. zooepidemicus (strain H70)
Q3K0E0 1.29e-31 129 27 11 361 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q48U81 1.43e-31 128 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JCG0 1.43e-31 128 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P47612 1.48e-31 128 27 12 383 3 thiI Probable tRNA sulfurtransferase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8E4F9 2.09e-31 128 27 11 361 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype III (strain NEM316)
Q1J7A5 2.73e-31 127 27 13 392 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
B3WDV9 3.25e-31 127 27 13 395 3 thiI Probable tRNA sulfurtransferase Lacticaseibacillus casei (strain BL23)
B5XKV0 3.53e-31 127 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JMD8 3.74e-31 127 27 11 370 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
A2RF72 3.89e-31 127 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JHI4 4.74e-31 127 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
P0DF95 5.13e-31 127 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF94 5.13e-31 127 27 12 389 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8P1G9 5.44e-31 127 27 13 392 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XCT0 5.44e-31 127 27 13 392 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B0RZV0 6.63e-31 126 33 11 296 3 thiI Probable tRNA sulfurtransferase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8DUR1 7.36e-31 126 25 14 408 3 thiI Probable tRNA sulfurtransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5SHD4 9.19e-31 126 33 12 360 3 thiI Probable tRNA sulfurtransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72HP1 9.19e-31 126 33 12 360 3 thiI Probable tRNA sulfurtransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A8AWF4 9.55e-31 126 26 10 363 3 thiI Probable tRNA sulfurtransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q9A0D8 1.06e-30 126 27 10 387 3 thiI Probable tRNA sulfurtransferase Streptococcus pyogenes serotype M1
A3CMR7 1.17e-30 126 26 10 360 3 thiI Probable tRNA sulfurtransferase Streptococcus sanguinis (strain SK36)
B9DU51 1.94e-30 125 27 14 405 3 thiI Probable tRNA sulfurtransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8DYV1 3.08e-30 125 27 11 361 3 thiI Probable tRNA sulfurtransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q98PK4 3.19e-30 124 28 11 354 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis pulmonis (strain UAB CTIP)
B2G6C3 6.97e-30 124 29 12 390 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIU7 6.97e-30 124 29 12 390 3 thiI Probable tRNA sulfurtransferase Limosilactobacillus reuteri (strain DSM 20016)
A9KKT0 2.91e-29 122 28 9 368 3 thiI Probable tRNA sulfurtransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
P75228 1.09e-28 120 29 13 373 3 thiI Probable tRNA sulfurtransferase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
B3PLZ2 2.5e-28 119 28 6 288 3 thiI Probable tRNA sulfurtransferase Metamycoplasma arthritidis (strain 158L3-1)
Q4A5Q7 2.52e-28 119 27 12 360 3 thiI Probable tRNA sulfurtransferase Mycoplasmopsis synoviae (strain 53)
B8D0L5 3.59e-28 119 27 9 400 3 thiI Probable tRNA sulfurtransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9X220 9.33e-28 117 31 4 248 1 thiI Probable tRNA sulfurtransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q83CD9 1.17e-23 105 31 9 297 3 thiI Probable tRNA sulfurtransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
O83570 6.08e-23 103 30 6 274 3 thiI Probable tRNA sulfurtransferase Treponema pallidum (strain Nichols)
B2S3F1 4.34e-22 101 29 6 274 3 thiI Probable tRNA sulfurtransferase Treponema pallidum subsp. pallidum (strain SS14)
Q57864 7.23e-08 58 31 2 123 4 MJ0421 Uncharacterized protein MJ0421 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16520
Feature type CDS
Gene thiI
Product tRNA uracil 4-sulfurtransferase ThiI
Location 123370 - 124818 (strand: -1)
Length 1449 (nucleotides) / 482 (amino acids)

Contig

Accession term accessions NZ_VXKB01000006 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2097
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00581 Rhodanese-like domain
PF02568 Thiamine biosynthesis protein (ThiI)
PF02926 THUMP domain
PF22025 ThiI ferredoxin-like domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0301 Coenzyme transport and metabolism (H)
Translation, ribosomal structure and biogenesis (J)		 HJ Adenylyl- and sulfurtransferase ThiI (thiamine and tRNA 4-thiouridine biosynthesis)

Kegg Ortholog Annotation(s)

Protein Sequence

MKFIIKLFPEITIKSQSVRLRFIKILNSNIRNVLKDIADDVAVVRHWDFIEVRVKKEELGEGVADRLTRIPGIHHILQVEDRAFTDLHNIYEQAFEMYGASLENKTFCVRVKRRGKHPFTSSEVERYVGGGLNQHIASAKVKLTHPDVTVNLEVEDDKLILVVRRLEGIGGFPIGTQEEVLSLISGGYDSGVSSYMLMRRGCRVHYCFFNLGGAAHETGVKQVAYYLWNRFGSSHKVRFVAVNFEPVVAEILENVDDGQMGVVLKRMMVRAASAVAQRYGVQAIVTGEALGQVSSQTLTNLRMIDNATDTLVLRPLISHDKETIINVAREIGTEDFARVMPEFCGVISKNPTVKAIKEKIEAEEEKFNFAILNDVVAAAQNIDIREITKNPPQQVTEVEMVSVLSAADVVLDIRSPEEQESHPLVIEGVDVRLLPFYKLSSQFGDLPKETDYLLYCDRGVMSRLQALYLLEQGFTNVKVYRP

Flanking regions ( +/- flanking 50bp)

TACCGGCCGCTCTGTCCCTTGCAAATCAATATGATAGCCATTAAACCGTTATGAAGTTTATCATTAAATTATTTCCTGAAATTACCATCAAAAGCCAGAGTGTACGCCTGCGCTTTATTAAAATTCTGAACAGTAATATCCGCAATGTGCTGAAAGATATTGCAGACGATGTGGCTGTTGTCCGTCACTGGGATTTTATTGAAGTCCGCGTGAAGAAAGAAGAGCTGGGCGAAGGGGTTGCTGACCGCCTGACCCGCATTCCGGGCATCCACCATATTTTACAGGTGGAAGATCGCGCATTTACAGACCTGCACAATATTTATGAACAGGCTTTTGAGATGTATGGCGCGTCACTGGAAAACAAAACATTTTGTGTTCGTGTGAAGCGCCGGGGCAAACATCCGTTTACCTCCAGTGAGGTTGAGCGTTATGTCGGCGGTGGTCTGAACCAGCATATTGCATCAGCAAAAGTGAAACTGACCCATCCGGATGTCACTGTGAATCTGGAAGTGGAAGACGATAAGCTGATCCTGGTGGTTCGTCGTCTGGAAGGTATCGGCGGTTTCCCTATCGGGACACAGGAAGAGGTATTGTCGCTGATTTCCGGCGGGTACGATTCCGGGGTTTCCAGCTACATGCTGATGCGCCGTGGCTGTCGTGTGCATTACTGCTTCTTTAATTTAGGCGGTGCCGCACATGAAACGGGCGTGAAACAGGTGGCTTATTACCTGTGGAACCGTTTCGGCAGCTCGCATAAAGTCCGTTTTGTGGCGGTGAATTTCGAGCCGGTCGTGGCAGAGATTCTGGAAAACGTAGATGACGGTCAGATGGGCGTGGTACTCAAACGCATGATGGTGCGCGCGGCATCTGCTGTGGCACAGCGCTACGGCGTGCAGGCGATTGTTACCGGTGAGGCACTGGGGCAGGTATCCAGCCAGACCTTAACCAATCTGCGCATGATTGATAACGCGACAGACACCCTGGTGCTGCGTCCGCTTATCTCTCATGATAAAGAAACCATTATTAATGTTGCCCGCGAAATCGGTACGGAAGATTTTGCCCGCGTCATGCCGGAATTCTGTGGCGTTATCTCGAAAAACCCGACAGTCAAAGCCATTAAAGAAAAAATCGAAGCGGAAGAAGAAAAATTCAACTTTGCGATCCTTAATGATGTTGTCGCTGCCGCGCAAAATATTGATATCCGGGAAATTACAAAAAATCCGCCGCAGCAGGTAACAGAAGTTGAGATGGTTTCAGTGCTGTCTGCCGCTGACGTGGTTCTGGATATCCGCTCGCCGGAGGAACAAGAGTCACATCCGCTGGTAATTGAGGGCGTGGATGTCAGATTACTGCCATTCTATAAACTCAGCTCACAGTTTGGTGATTTACCAAAAGAGACAGATTACCTGTTGTACTGTGACCGGGGTGTGATGAGCCGCCTGCAGGCACTTTATTTGCTGGAGCAGGGTTTCACGAATGTGAAAGTATATCGTCCCTGAACCGTGAATAAATGAAATATCTGACCCTGTGCGTGAAAACACGGGGTTTT