Homologs in group_2296

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17405 FBDBKF_17405 90.9 Morganella morganii S1 tgt tRNA guanosine(34) transglycosylase Tgt
EHELCC_17300 EHELCC_17300 90.9 Morganella morganii S2 tgt tRNA guanosine(34) transglycosylase Tgt
NLDBIP_17895 NLDBIP_17895 90.9 Morganella morganii S4 tgt tRNA guanosine(34) transglycosylase Tgt
LHKJJB_17815 LHKJJB_17815 90.9 Morganella morganii S3 tgt tRNA guanosine(34) transglycosylase Tgt
HKOGLL_17825 HKOGLL_17825 90.9 Morganella morganii S5 tgt tRNA guanosine(34) transglycosylase Tgt
F4V73_RS16580 F4V73_RS16580 90.1 Morganella psychrotolerans tgt tRNA guanosine(34) transglycosylase Tgt

Distribution of the homologs in the orthogroup group_2296

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2296

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EU13 0.0 795 100 0 380 3 tgt Queuine tRNA-ribosyltransferase Proteus mirabilis (strain HI4320)
A1JNT0 0.0 726 90 0 377 3 tgt Queuine tRNA-ribosyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JIE9 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66DW5 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPH6 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis (strain Pestoides F)
Q1CLA2 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R351 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZC33 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis
B2K6S6 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C4H4 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FLF5 0.0 722 91 0 373 3 tgt Queuine tRNA-ribosyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GAM5 0.0 717 90 0 374 3 tgt Queuine tRNA-ribosyltransferase Serratia proteamaculans (strain 568)
Q7MB01 0.0 711 90 0 373 3 tgt Queuine tRNA-ribosyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZRD8 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TZI0 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella schwarzengrund (strain CVM19633)
A9MX29 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SWP7 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella newport (strain SL254)
B4T8P5 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella heidelberg (strain SL476)
B5EWT9 0.0 709 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella agona (strain SL483)
B5BDC8 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain AKU_12601)
Q5PFT6 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R6Q7 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTF4 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FKR0 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella dublin (strain CT_02021853)
A8AK48 0.0 708 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MM57 0.0 707 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
C0Q7S9 0.0 707 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella paratyphi C (strain RKS4594)
Q57SF8 0.0 707 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella choleraesuis (strain SC-B67)
Q8Z8Y0 0.0 707 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Salmonella typhi
A6T5D8 0.0 706 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5Y0Y6 0.0 706 89 0 373 3 tgt Queuine tRNA-ribosyltransferase Klebsiella pneumoniae (strain 342)
Q6D855 0.0 705 88 0 372 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DB26 0.0 704 88 0 372 3 tgt Queuine tRNA-ribosyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4W779 0.0 700 88 0 373 3 tgt Queuine tRNA-ribosyltransferase Enterobacter sp. (strain 638)
Q3Z503 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella sonnei (strain Ss046)
Q32JG0 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q325J5 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 4 (strain Sb227)
B2U4K7 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LMI1 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RFD5 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain UTI89 / UPEC)
B1LJF4 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B6HZK6 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain SE11)
B7N8V8 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A847 0.0 697 87 0 373 1 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12)
B1J043 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A848 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKN5 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A876 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O1:K1 / APEC
A7ZX57 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O9:H4 (strain HS)
B1XEZ4 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / DH10B)
C4ZTG3 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M3P5 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O8 (strain IAI1)
B7MPG7 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O81 (strain ED1a)
B7NJ96 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2W2 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A849 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O157:H7
B7L639 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli (strain 55989 / EAEC)
B7MD64 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UJM9 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZIF8 0.0 697 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
C5BCF7 0.0 696 87 0 375 3 tgt Queuine tRNA-ribosyltransferase Edwardsiella ictaluri (strain 93-146)
Q54177 0.0 696 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri
Q0T7I3 0.0 696 87 0 373 3 tgt Queuine tRNA-ribosyltransferase Shigella flexneri serotype 5b (strain 8401)
B2VHQ1 0.0 689 85 0 374 3 tgt Queuine tRNA-ribosyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NVA4 0.0 684 86 0 372 3 tgt Queuine tRNA-ribosyltransferase Sodalis glossinidius (strain morsitans)
B8F3W0 0.0 680 85 1 377 3 tgt Queuine tRNA-ribosyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
P57831 0.0 678 84 1 378 3 tgt Queuine tRNA-ribosyltransferase Pasteurella multocida (strain Pm70)
A5UG47 0.0 676 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittGG)
A5UAP3 0.0 676 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain PittEE)
P44594 0.0 675 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QNU3 0.0 673 84 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus influenzae (strain 86-028NP)
B7VJR8 0.0 669 82 0 376 3 tgt Queuine tRNA-ribosyltransferase Vibrio atlanticus (strain LGP32)
Q6LU69 0.0 668 83 0 375 3 tgt Queuine tRNA-ribosyltransferase Photobacterium profundum (strain SS9)
C4L7L3 0.0 666 83 0 373 3 tgt Queuine tRNA-ribosyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
B3GXF8 0.0 664 82 1 382 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N087 0.0 664 82 1 382 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A0KJ20 0.0 664 81 0 378 3 tgt Queuine tRNA-ribosyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0BP03 0.0 663 81 1 382 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
C3LSZ4 0.0 662 81 0 377 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTY9 0.0 662 81 0 377 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3H2 0.0 662 81 0 377 3 tgt Queuine tRNA-ribosyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A4SP26 0.0 661 81 0 378 3 tgt Queuine tRNA-ribosyltransferase Aeromonas salmonicida (strain A449)
Q7MNH1 0.0 659 81 0 376 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain YJ016)
Q8DEY0 0.0 659 81 0 376 3 tgt Queuine tRNA-ribosyltransferase Vibrio vulnificus (strain CMCP6)
Q87S36 0.0 656 80 0 375 3 tgt Queuine tRNA-ribosyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MT83 0.0 655 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q0I4R8 0.0 652 81 1 374 3 tgt Queuine tRNA-ribosyltransferase Histophilus somni (strain 129Pt)
B5F9Y3 0.0 650 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain MJ11)
Q5E3D2 0.0 650 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A6VN75 0.0 644 79 1 377 3 tgt Queuine tRNA-ribosyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VLQ4 0.0 644 80 1 377 3 tgt Queuine tRNA-ribosyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B6EK65 0.0 643 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Aliivibrio salmonicida (strain LFI1238)
Q0HWQ9 0.0 639 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-7)
Q0HKF7 0.0 639 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain MR-4)
A0KV50 0.0 639 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain ANA-3)
Q65S94 0.0 639 78 1 379 3 tgt Queuine tRNA-ribosyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3QFF5 0.0 638 80 0 373 3 tgt Queuine tRNA-ribosyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q07ZM2 0.0 638 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella frigidimarina (strain NCIMB 400)
B8CLC5 0.0 638 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
A1RI67 0.0 637 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella sp. (strain W3-18-1)
A4Y8C2 0.0 637 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A8FXC6 0.0 636 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella sediminis (strain HAW-EB3)
B0TND4 0.0 636 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella halifaxensis (strain HAW-EB4)
Q8ECM3 0.0 635 81 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A8H2K8 0.0 634 81 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A9KUN0 0.0 634 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS195)
A6WQ52 0.0 634 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS185)
A3D6B1 0.0 634 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EDJ7 0.0 634 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella baltica (strain OS223)
A1S7P2 0.0 632 80 0 372 3 tgt Queuine tRNA-ribosyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q12PD9 0.0 631 80 0 370 3 tgt Queuine tRNA-ribosyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1SWU0 0.0 629 78 0 373 3 tgt Queuine tRNA-ribosyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C4K8M3 0.0 613 76 0 369 3 tgt Queuine tRNA-ribosyltransferase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q5QVL2 0.0 597 74 1 373 3 tgt Queuine tRNA-ribosyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q15WI4 0.0 597 75 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q1LSP0 0.0 592 74 0 364 3 tgt Queuine tRNA-ribosyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q9HXH9 0.0 573 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RX7 0.0 573 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UVU4 0.0 573 71 1 374 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas aeruginosa (strain LESB58)
Q3ILB8 0.0 572 72 1 372 3 tgt Queuine tRNA-ribosyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q887B0 0.0 568 71 1 373 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
C1DE76 0.0 566 71 1 373 3 tgt Queuine tRNA-ribosyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q88PL7 0.0 563 69 1 373 3 tgt Queuine tRNA-ribosyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q21KW1 0.0 561 69 1 376 3 tgt Queuine tRNA-ribosyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q31FZ5 0.0 556 70 1 372 3 tgt Queuine tRNA-ribosyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1TZN7 0.0 552 68 1 375 3 tgt Queuine tRNA-ribosyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q493H3 0.0 548 66 0 367 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q1QTM9 0.0 547 67 1 374 3 tgt Queuine tRNA-ribosyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0V625 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AYE)
A3M8S3 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VRA8 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain SDF)
B7I976 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB0057)
B7GWL4 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain AB307-0294)
B2HYN7 0.0 543 68 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baumannii (strain ACICU)
Q6FEJ4 0.0 540 67 1 372 3 tgt Queuine tRNA-ribosyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B8GTQ4 0.0 539 66 1 372 3 tgt Queuine tRNA-ribosyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B0TYY3 0.0 532 68 1 363 3 tgt Queuine tRNA-ribosyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q1QA23 0.0 530 65 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FRI6 0.0 528 65 2 381 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A5CW46 0.0 523 65 0 366 3 tgt Queuine tRNA-ribosyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A5WGS6 0.0 523 64 2 380 3 tgt Queuine tRNA-ribosyltransferase Psychrobacter sp. (strain PRwf-1)
A0Q6X1 0.0 523 67 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. novicida (strain U112)
B2SHD4 0.0 522 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
B8D738 0.0 522 64 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A4IYF8 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NFU8 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HA0 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
B8D8T4 0.0 521 64 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q0BMC7 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Y7 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7NBL6 0.0 521 66 1 361 3 tgt Queuine tRNA-ribosyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
P57233 0.0 520 64 0 367 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q2Y6A3 0.0 518 65 0 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0AG55 0.0 518 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q82VF0 0.0 514 65 1 361 3 tgt Queuine tRNA-ribosyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7VQB1 0.0 514 64 1 362 3 tgt Queuine tRNA-ribosyltransferase Blochmanniella floridana
Q1H403 0.0 513 68 1 363 3 tgt Queuine tRNA-ribosyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q1LJ59 0.0 512 67 1 368 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8KA09 0.0 512 64 1 366 3 tgt Queuine tRNA-ribosyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q5P720 0.0 511 66 0 361 3 tgt Queuine tRNA-ribosyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1K3W9 0.0 511 65 0 361 3 tgt Queuine tRNA-ribosyltransferase Azoarcus sp. (strain BH72)
Q47AX3 1.41e-180 508 65 0 361 3 tgt Queuine tRNA-ribosyltransferase Dechloromonas aromatica (strain RCB)
B3R6J4 2.99e-180 508 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46XG4 3.26e-180 508 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
C1DDA7 1.95e-179 506 65 0 364 3 tgt Queuine tRNA-ribosyltransferase Laribacter hongkongensis (strain HLHK9)
B0RRR1 1.32e-178 504 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain B100)
A6SUU4 3.79e-178 503 65 1 367 3 tgt Queuine tRNA-ribosyltransferase Janthinobacterium sp. (strain Marseille)
Q8P868 5.07e-178 503 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UVX2 5.07e-178 503 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q8PJL7 6.04e-178 502 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q0K733 6.36e-178 502 65 1 366 3 tgt Queuine tRNA-ribosyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q3BS37 1.18e-177 501 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GZY3 9.78e-176 497 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SIN8 9.78e-176 497 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P2X0 9.78e-176 497 61 1 378 3 tgt Queuine tRNA-ribosyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3SH61 1.07e-175 496 63 1 362 3 tgt Queuine tRNA-ribosyltransferase Thiobacillus denitrificans (strain ATCC 25259)
A4G1Z3 1.47e-175 496 65 1 367 3 tgt Queuine tRNA-ribosyltransferase Herminiimonas arsenicoxydans
A5EW66 4.12e-174 492 62 2 363 3 tgt Queuine tRNA-ribosyltransferase Dichelobacter nodosus (strain VCS1703A)
B4SSS1 9.58e-173 489 60 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain R551-3)
B2UC75 1.4e-172 489 66 2 363 3 tgt Queuine tRNA-ribosyltransferase Ralstonia pickettii (strain 12J)
Q7NYC7 2.1e-172 488 62 0 369 3 tgt Queuine tRNA-ribosyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B2FN00 2.86e-172 488 60 1 373 3 tgt Queuine tRNA-ribosyltransferase Stenotrophomonas maltophilia (strain K279a)
Q8XVW4 9.13e-171 484 64 2 366 3 tgt Queuine tRNA-ribosyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A2SM97 4.63e-169 479 60 1 366 3 tgt Queuine tRNA-ribosyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B1XWG6 4.81e-169 480 60 3 384 3 tgt Queuine tRNA-ribosyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q12GB2 2.31e-166 474 59 3 389 3 tgt Queuine tRNA-ribosyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
B5EK08 5.13e-166 472 60 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J4R9 5.13e-166 472 60 1 362 3 tgt Queuine tRNA-ribosyltransferase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q9JVA4 6.52e-166 471 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1VJ15 3.9e-165 470 59 2 378 3 tgt Queuine tRNA-ribosyltransferase Polaromonas naphthalenivorans (strain CJ2)
Q5F9U5 4.72e-165 469 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KSY1 5.68e-165 469 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B4RJY2 6.14e-165 469 59 0 369 3 tgt Queuine tRNA-ribosyltransferase Neisseria gonorrhoeae (strain NCCP11945)
A9M374 1.21e-164 468 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup C (strain 053442)
Q9PGS5 6.72e-164 467 59 1 377 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain 9a5c)
Q9K096 9.86e-164 466 60 0 363 3 tgt Queuine tRNA-ribosyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B0U1P6 1.54e-163 466 59 1 378 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M12)
A1WCK2 7.01e-162 462 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax sp. (strain JS42)
B9MGI1 1.72e-161 461 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Acidovorax ebreus (strain TPSY)
Q87EW6 1.94e-161 460 58 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I6T4 1.94e-161 460 58 1 373 3 tgt Queuine tRNA-ribosyltransferase Xylella fastidiosa (strain M23)
A9BRD7 7.93e-161 459 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1TVN0 6.82e-160 457 58 3 381 3 tgt Queuine tRNA-ribosyltransferase Paracidovorax citrulli (strain AAC00-1)
A1WFH2 1.66e-158 453 58 3 377 3 tgt Queuine tRNA-ribosyltransferase Verminephrobacter eiseniae (strain EF01-2)
A0AIX9 2.51e-157 450 58 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92BI4 4.9e-157 449 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DHL8 1.65e-156 448 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4a (strain HCC23)
Q8Y700 5.91e-156 446 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71ZE0 5.91e-156 446 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain F2365)
C1KVH7 5.91e-156 446 57 2 368 3 tgt Queuine tRNA-ribosyltransferase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q65GP9 2.62e-155 445 56 2 376 3 tgt Queuine tRNA-ribosyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O32053 7.57e-155 444 58 1 363 3 tgt Queuine tRNA-ribosyltransferase Bacillus subtilis (strain 168)
B0K0M1 2.28e-154 442 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter sp. (strain X514)
Q8CXC4 5.44e-154 441 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
A7Z766 1.46e-152 438 57 1 363 3 tgt Queuine tRNA-ribosyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8FFQ9 2.85e-152 437 57 3 371 3 tgt Queuine tRNA-ribosyltransferase Bacillus pumilus (strain SAFR-032)
Q9KDI5 6.23e-152 436 56 2 372 3 tgt Queuine tRNA-ribosyltransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8RAM9 1.33e-151 435 56 2 366 3 tgt Queuine tRNA-ribosyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B0K959 2.15e-151 435 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B8FQV2 4.74e-151 434 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B5YHX4 5.52e-151 434 54 0 361 3 tgt Queuine tRNA-ribosyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
B1HVA1 8.6e-151 433 56 2 368 3 tgt Queuine tRNA-ribosyltransferase Lysinibacillus sphaericus (strain C3-41)
B9E716 1.48e-150 433 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Macrococcus caseolyticus (strain JCSC5402)
P66906 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MW2)
A8Z2G7 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T0 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MSSA476)
Q6GG65 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain MRSA252)
P66905 2.76e-150 432 59 2 358 1 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain N315)
P66904 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI1 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Newman)
Q5HFC4 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain COL)
A5ITG3 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH9)
Q2FXT6 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG88 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain USA300)
A6U2A7 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain JH1)
A7X354 2.76e-150 432 59 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P28720 8.51e-150 431 56 1 366 1 tgt Queuine tRNA-ribosyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2YT91 1.65e-149 430 58 2 358 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q4L6Y4 3.47e-149 429 58 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
Q5WHR2 3.95e-149 429 57 1 357 3 tgt Queuine tRNA-ribosyltransferase Shouchella clausii (strain KSM-K16)
B7GFN1 6.4e-149 429 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A4IRA9 3.26e-148 427 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q817W6 3.56e-148 427 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HE51 3.56e-148 427 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain B4264)
B7IIS9 3.56e-148 427 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain G9842)
B8CXG0 5.44e-148 426 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
A9VIP3 7.07e-148 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus mycoides (strain KBAB4)
Q6HDA9 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634C7 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ZK / E33L)
B7HQH6 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH187)
C1ESW1 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain 03BB102)
Q730B4 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JQ03 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain AH820)
Q81LH2 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis
A0RJ24 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus thuringiensis (strain Al Hakam)
C3L6U6 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9A4 1.06e-147 426 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus anthracis (strain A0248)
B9IYZ1 1.35e-147 425 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Bacillus cereus (strain Q1)
Q8CML7 2.51e-147 424 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNR2 2.51e-147 424 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5KWR4 3.38e-147 424 55 2 368 3 tgt Queuine tRNA-ribosyltransferase Geobacillus kaustophilus (strain HTA426)
B8I6M0 1.21e-146 422 54 2 368 3 tgt Queuine tRNA-ribosyltransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A4J541 7.61e-146 421 57 2 354 3 tgt Queuine tRNA-ribosyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A7GT99 7.82e-146 421 56 2 362 3 tgt Queuine tRNA-ribosyltransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9DNG7 8.1e-146 421 57 1 355 3 tgt Queuine tRNA-ribosyltransferase Staphylococcus carnosus (strain TM300)
A3DE13 2.66e-145 419 55 3 370 3 tgt Queuine tRNA-ribosyltransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q67Q92 2e-144 418 54 2 366 3 tgt Queuine tRNA-ribosyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A5D3G6 2.37e-144 417 55 2 359 3 tgt Queuine tRNA-ribosyltransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q2G639 6.11e-144 416 57 1 363 3 tgt Queuine tRNA-ribosyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B2A5K8 9.7e-144 415 55 2 365 3 tgt Queuine tRNA-ribosyltransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q837E7 3.51e-142 412 53 2 368 3 tgt Queuine tRNA-ribosyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
C0QKY2 8.43e-142 410 53 0 356 3 tgt Queuine tRNA-ribosyltransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q3J2H4 5.1e-141 408 55 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PJT9 6.34e-141 408 55 1 361 3 tgt Queuine tRNA-ribosyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q8RDN0 1.78e-140 407 53 2 366 3 tgt Queuine tRNA-ribosyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A0LFR2 1.92e-140 407 55 1 352 3 tgt Queuine tRNA-ribosyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q1GIL3 3.26e-140 406 54 2 371 3 tgt Queuine tRNA-ribosyltransferase Ruegeria sp. (strain TM1040)
Q03ER2 4.12e-140 406 52 2 368 3 tgt Queuine tRNA-ribosyltransferase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q28PC5 4.19e-140 406 55 2 372 3 tgt Queuine tRNA-ribosyltransferase Jannaschia sp. (strain CCS1)
Q1GR26 3.79e-139 404 55 1 365 3 tgt Queuine tRNA-ribosyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
C4XSI9 9.55e-139 402 52 0 358 3 tgt Queuine tRNA-ribosyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A8F2K6 2.24e-138 401 57 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia massiliae (strain Mtu5)
Q30XF7 2.83e-138 401 52 0 356 3 tgt Queuine tRNA-ribosyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A8GUA5 9.17e-138 400 55 1 347 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain OSU 85-389)
Q5LQ80 1.37e-137 400 54 1 361 3 tgt Queuine tRNA-ribosyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q68W26 3.96e-137 398 56 1 348 3 tgt Queuine tRNA-ribosyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8GTF4 8.97e-137 397 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Sheila Smith)
B0BUZ2 8.97e-137 397 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia rickettsii (strain Iowa)
A8GPN2 1.33e-136 397 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia akari (strain Hartford)
Q2RHU3 3.46e-136 396 53 3 362 3 tgt Queuine tRNA-ribosyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A8LRQ1 3.91e-136 396 56 1 353 3 tgt Queuine tRNA-ribosyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q4UN16 4.13e-136 395 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
C4K0T2 5.14e-136 395 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia peacockii (strain Rustic)
Q92GM6 7.29e-136 395 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
C3PLJ4 7.29e-136 395 56 1 346 3 tgt Queuine tRNA-ribosyltransferase Rickettsia africae (strain ESF-5)
Q1RH25 1.3e-135 394 56 3 348 3 tgt Queuine tRNA-ribosyltransferase Rickettsia bellii (strain RML369-C)
Q9ZCK8 2.82e-135 393 56 1 348 3 tgt Queuine tRNA-ribosyltransferase Rickettsia prowazekii (strain Madrid E)
P0DF87 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48VG9 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RCC9 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JIT0 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JNN4 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDS0 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M12 (strain MGAS2096)
P66910 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DF86 6.07e-135 393 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B1I4K8 8.62e-135 392 53 2 369 3 tgt Queuine tRNA-ribosyltransferase Desulforudis audaxviator (strain MP104C)
Q72E53 9.34e-135 392 52 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q5XE18 9.71e-135 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B5XJL3 1.09e-134 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1J8P1 1.09e-134 392 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M4 (strain MGAS10750)
O67331 1.57e-134 392 50 5 380 3 tgt Queuine tRNA-ribosyltransferase Aquifex aeolicus (strain VF5)
A1VFP3 3.1e-134 391 52 0 340 3 tgt Queuine tRNA-ribosyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q9A1L6 3.37e-134 391 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pyogenes serotype M1
Q92PY4 3.9e-134 391 53 1 362 3 tgt Queuine tRNA-ribosyltransferase Rhizobium meliloti (strain 1021)
B9DVZ9 9.28e-134 390 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A5N204 1.53e-133 389 50 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E5Q6 1.53e-133 389 50 2 375 3 tgt Queuine tRNA-ribosyltransferase Clostridium kluyveri (strain NBRC 12016)
A9AW42 3.12e-133 389 50 3 380 3 tgt Queuine tRNA-ribosyltransferase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
A4VW51 6.12e-133 388 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 05ZYH33)
A4W2F8 6.12e-133 388 51 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus suis (strain 98HAH33)
A3CK60 1.74e-132 387 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus sanguinis (strain SK36)
Q1MPU5 1.74e-132 387 49 0 355 3 tgt Queuine tRNA-ribosyltransferase Lawsonia intracellularis (strain PHE/MN1-00)
Q88V05 1.76e-132 387 49 2 368 3 tgt Queuine tRNA-ribosyltransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A8AUL3 1.9e-132 387 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q0SRN5 2.12e-132 387 51 2 364 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain SM101 / Type A)
Q0TP15 2.12e-132 387 51 2 364 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8XJ16 3.04e-132 386 51 2 364 3 tgt Queuine tRNA-ribosyltransferase Clostridium perfringens (strain 13 / Type A)
Q8E1F9 1.38e-131 385 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E6X6 1.38e-131 385 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype III (strain NEM316)
Q3K2Y7 1.38e-131 385 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q9A7Y1 1.86e-131 384 52 2 363 3 tgt Queuine tRNA-ribosyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8EZT7 2.52e-131 383 54 1 347 3 tgt Queuine tRNA-ribosyltransferase Rickettsia canadensis (strain McKiel)
Q5M2K9 2.6e-131 384 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q032U4 2.67e-131 384 50 3 373 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain SK11)
A2RHN5 2.72e-131 384 50 3 373 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. cremoris (strain MG1363)
Q98M57 2.92e-131 384 53 1 362 3 tgt Queuine tRNA-ribosyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q03IQ5 3.9e-131 384 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LY05 4.25e-131 383 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus thermophilus (strain CNRZ 1066)
C0MAH5 5.17e-131 383 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. equi (strain 4047)
Q8UES8 6.34e-131 383 53 1 361 3 tgt Queuine tRNA-ribosyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q97GT3 6.48e-131 383 50 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C4Z563 1.28e-130 382 50 2 366 3 tgt Queuine tRNA-ribosyltransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
B1I9B4 1.34e-130 382 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Hungary19A-6)
Q9CJ54 2.84e-130 381 50 3 373 3 tgt Queuine tRNA-ribosyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q38YP9 2.86e-130 381 49 2 368 3 tgt Queuine tRNA-ribosyltransferase Latilactobacillus sakei subsp. sakei (strain 23K)
C1CGY8 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain JJA)
P66908 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IMN3 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain CGSP14)
P66907 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZPB8 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E2X9 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 19F (strain G54)
Q04IB3 3.34e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q892A0 3.47e-130 381 49 2 366 3 tgt Queuine tRNA-ribosyltransferase Clostridium tetani (strain Massachusetts / E88)
C1CTW4 4.15e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CAA6 4.15e-130 381 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain 70585)
A9HBJ2 6.25e-130 380 55 1 340 3 tgt Queuine tRNA-ribosyltransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q8DVZ3 6.28e-130 380 49 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q72H19 6.45e-130 380 50 2 372 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SLI7 8.37e-130 380 50 2 372 3 tgt Queuine tRNA-ribosyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C0MEV8 1.55e-129 379 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus equi subsp. zooepidemicus (strain H70)
Q8YHB2 2.12e-129 379 53 1 361 3 tgt Queuine tRNA-ribosyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C1CN05 2.98e-129 379 50 2 368 3 tgt Queuine tRNA-ribosyltransferase Streptococcus pneumoniae (strain P1031)
Q8G0K1 5.48e-129 378 53 1 361 3 tgt Queuine tRNA-ribosyltransferase Brucella suis biovar 1 (strain 1330)
B5YFK5 6.03e-129 378 50 3 367 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B8E2N5 2.07e-128 377 51 2 354 3 tgt Queuine tRNA-ribosyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B9K8N7 2e-127 374 50 2 357 3 tgt Queuine tRNA-ribosyltransferase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q1IVF1 2.01e-127 374 50 1 359 3 tgt Queuine tRNA-ribosyltransferase Koribacter versatilis (strain Ellin345)
A5IM22 2.33e-127 374 50 2 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1P7 2.33e-127 374 50 2 363 1 tgt Queuine tRNA-ribosyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1LB70 4.25e-127 373 50 2 363 3 tgt Queuine tRNA-ribosyltransferase Thermotoga sp. (strain RQ2)
Q7UWK9 6.31e-127 372 52 2 356 3 tgt Queuine tRNA-ribosyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9RRB5 7.55e-127 373 47 1 364 3 tgt Queuine tRNA-ribosyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A7GHT6 9.9e-127 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IMF1 9.9e-127 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Okra / Type B1)
A5I6E9 1.02e-126 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY17 1.02e-126 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
B1L0B0 1.56e-126 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
C1FKF9 1.56e-126 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain Kyoto / Type A2)
C3KTD0 1.56e-126 372 49 2 363 3 tgt Queuine tRNA-ribosyltransferase Clostridium botulinum (strain 657 / Type Ba4)
C0R0X6 2.23e-126 371 47 2 363 3 tgt Queuine tRNA-ribosyltransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
B9L8E1 3.75e-126 371 49 2 368 3 tgt Queuine tRNA-ribosyltransferase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B8HX02 1.08e-125 370 49 2 360 3 tgt Queuine tRNA-ribosyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q0BVG4 1.78e-125 369 52 2 355 3 tgt Queuine tRNA-ribosyltransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q8GAA6 3.38e-124 366 48 4 374 3 tgt Queuine tRNA-ribosyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A8ZRX7 2.94e-122 361 51 1 336 3 tgt Queuine tRNA-ribosyltransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q17YB5 3.59e-122 360 47 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter acinonychis (strain Sheeba)
O08314 7.28e-122 360 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain ATCC 700392 / 26695)
B5ZA47 7.36e-122 360 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain G27)
A7I2I6 8.77e-122 359 47 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B6JKL0 9.56e-122 359 47 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain P12)
A9KHU4 1.13e-121 359 47 2 363 3 tgt Queuine tRNA-ribosyltransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q8YVT9 1.51e-121 359 50 3 352 3 tgt Queuine tRNA-ribosyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7IDU1 1.54e-121 358 48 1 357 3 tgt Queuine tRNA-ribosyltransferase Thermosipho africanus (strain TCF52B)
Q30S46 2.75e-121 358 47 2 372 3 tgt Queuine tRNA-ribosyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
B2USB2 3.9e-121 358 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain Shi470)
Q1CUM2 4.07e-121 358 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain HPAG1)
Q9ZMF4 6.02e-121 357 46 3 366 3 tgt Queuine tRNA-ribosyltransferase Helicobacter pylori (strain J99 / ATCC 700824)
A6Q906 1.75e-120 356 47 3 374 3 tgt Queuine tRNA-ribosyltransferase Sulfurovum sp. (strain NBC37-1)
A6LMW2 2.37e-120 355 48 1 355 3 tgt Queuine tRNA-ribosyltransferase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5FSU3 1.61e-119 354 48 3 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3ZAE2 3.8e-119 353 47 3 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q029K6 9.66e-119 352 48 2 352 3 tgt Queuine tRNA-ribosyltransferase Solibacter usitatus (strain Ellin6076)
A8ERD1 1.73e-118 351 44 2 373 3 tgt Queuine tRNA-ribosyltransferase Aliarcobacter butzleri (strain RM4018)
Q7M8N8 2.51e-118 351 47 3 373 3 tgt Queuine tRNA-ribosyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A6Q3Y5 1.36e-117 349 45 3 371 3 tgt Queuine tRNA-ribosyltransferase Nitratiruptor sp. (strain SB155-2)
Q8CWM7 1.6e-117 349 47 2 358 3 tgt Queuine tRNA-ribosyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3ZWC1 2.45e-117 349 47 2 365 3 tgt Queuine tRNA-ribosyltransferase Dehalococcoides mccartyi (strain CBDB1)
B3DYE4 2.47e-117 348 45 2 374 3 tgt Queuine tRNA-ribosyltransferase Methylacidiphilum infernorum (isolate V4)
Q0IDF3 9.01e-117 347 47 4 363 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9311)
Q7NMG4 2.18e-116 346 46 4 364 3 tgt Queuine tRNA-ribosyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
A0RPL5 1.62e-114 341 44 2 372 3 tgt Queuine tRNA-ribosyltransferase Campylobacter fetus subsp. fetus (strain 82-40)
A7GYD5 2.98e-113 338 46 4 382 3 tgt Queuine tRNA-ribosyltransferase Campylobacter curvus (strain 525.92)
A7ZD89 4.23e-113 337 45 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter concisus (strain 13826)
A9FI06 4.18e-112 335 48 2 354 3 tgt Queuine tRNA-ribosyltransferase Sorangium cellulosum (strain So ce56)
Q7VHX2 1.5e-111 333 45 3 377 3 tgt Queuine tRNA-ribosyltransferase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B9KFT3 2.52e-111 333 43 2 370 3 tgt Queuine tRNA-ribosyltransferase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A2BUQ2 2.22e-110 330 45 1 347 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9515)
Q55983 3.99e-110 330 46 2 350 3 tgt Queuine tRNA-ribosyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A8G2T1 4.26e-110 330 44 1 349 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9215)
A5USV3 4.5e-110 330 43 5 396 3 tgt Queuine tRNA-ribosyltransferase Roseiflexus sp. (strain RS-1)
Q7TUG0 5.91e-110 329 45 1 347 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A9BDP3 9.74e-110 328 47 3 350 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9211)
Q31CR1 1.24e-109 328 45 1 343 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9312)
A2BP70 1.41e-109 328 44 1 345 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain AS9601)
A3PAZ2 1.73e-109 328 44 1 351 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9301)
Q7TUM6 1.31e-108 326 46 2 348 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9313)
Q3AN18 1.63e-108 325 46 2 348 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9605)
B0SKS9 2.77e-107 322 43 0 350 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SCA8 2.77e-107 322 43 0 350 3 tgt Queuine tRNA-ribosyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A2CCL1 3.93e-107 322 46 3 348 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain MIT 9303)
Q73QK5 2.45e-106 320 43 1 355 3 tgt Queuine tRNA-ribosyltransferase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q04Z48 1.84e-105 318 42 0 357 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04UC6 1.84e-105 318 42 0 357 3 tgt Queuine tRNA-ribosyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q3B088 3.23e-105 317 45 2 347 3 tgt Queuine tRNA-ribosyltransferase Synechococcus sp. (strain CC9902)
Q8CXS3 5.87e-105 317 41 0 357 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72TL3 5.87e-105 317 41 0 357 3 tgt Queuine tRNA-ribosyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7VDR5 2.57e-104 315 46 2 353 3 tgt Queuine tRNA-ribosyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q9PNT0 3.37e-103 312 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
O28787 7.47e-103 312 40 4 402 3 tgt Putative queuine tRNA-ribosyltransferase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q5HUF2 9.35e-103 311 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni (strain RM1221)
A1VZZ8 1.61e-102 310 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H331 5.25e-102 309 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8FM59 6.74e-102 309 41 2 373 3 tgt Queuine tRNA-ribosyltransferase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9VPY8 3.06e-101 309 44 3 361 2 Tgt Queuine tRNA-ribosyltransferase catalytic subunit Drosophila melanogaster
Q9JMA2 4.91e-101 308 42 1 361 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Mus musculus
Q7TTX7 1.2e-100 305 46 3 349 3 tgt Queuine tRNA-ribosyltransferase Parasynechococcus marenigrum (strain WH8102)
Q4QR99 1.97e-100 306 42 1 361 1 Qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Rattus norvegicus
B5RN03 2.66e-100 305 41 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia duttonii (strain Ly)
Q9BXR0 1.04e-99 304 43 2 364 1 QTRT1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Homo sapiens
B2S1F3 6.26e-99 301 41 2 353 3 tgt Queuine tRNA-ribosyltransferase Borrelia hermsii (strain HS1 / DAH)
B5RQE7 1.19e-98 300 41 1 351 3 tgt Queuine tRNA-ribosyltransferase Borrelia recurrentis (strain A1)
A1R0N4 1.89e-97 297 41 2 353 3 tgt Queuine tRNA-ribosyltransferase Borrelia turicatae (strain 91E135)
Q28HC6 4.31e-97 297 44 2 350 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus tropicalis
Q23623 3.58e-96 295 41 3 376 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis elegans
Q4QQY7 3.6e-96 295 43 2 354 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Xenopus laevis
Q65ZW4 1.09e-95 293 39 3 369 3 tgt Queuine tRNA-ribosyltransferase Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
A8X0P0 7.41e-95 291 41 3 376 3 tgt-1 Queuine tRNA-ribosyltransferase catalytic subunit Caenorhabditis briggsae
Q7SYK1 4.03e-91 282 42 2 354 2 qtrt1 Queuine tRNA-ribosyltransferase catalytic subunit 1 Danio rerio
O94460 5.23e-91 282 42 3 358 3 SPAC1687.19c Queuine tRNA-ribosyltransferase catalytic subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O51749 1.34e-88 275 39 3 361 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
B7J0Q4 2.32e-88 274 39 3 361 3 tgt Queuine tRNA-ribosyltransferase Borreliella burgdorferi (strain ZS7)
Q6MD31 1.73e-83 262 39 2 358 3 tgt Queuine tRNA-ribosyltransferase Protochlamydia amoebophila (strain UWE25)
Q822U8 2.55e-75 241 36 4 357 3 tgt Queuine tRNA-ribosyltransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
Q9Z8W5 2.97e-75 240 37 4 357 3 tgt Queuine tRNA-ribosyltransferase Chlamydia pneumoniae
Q254U7 5.85e-74 237 36 4 357 3 tgt Queuine tRNA-ribosyltransferase Chlamydia felis (strain Fe/C-56)
O84196 6.94e-74 237 34 4 362 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
B0BBH3 6.94e-74 237 34 4 362 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B9U3 6.94e-74 237 34 4 362 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q5L5T1 9.28e-74 236 35 4 362 3 tgt Queuine tRNA-ribosyltransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q3KMG9 1.83e-73 236 34 4 362 3 tgt Queuine tRNA-ribosyltransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q9PKK0 3.48e-72 233 34 4 357 3 tgt Queuine tRNA-ribosyltransferase Chlamydia muridarum (strain MoPn / Nigg)
Q8PXW5 5.78e-31 126 26 9 365 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q46DI6 6.13e-31 126 26 9 365 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q8THU2 4.16e-30 124 26 9 365 3 tgtA tRNA-guanine(15) transglycosylase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A6UVD8 7.71e-30 124 26 6 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
O26278 8.43e-30 124 27 9 366 3 tgtA tRNA-guanine(15) transglycosylase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B7Q5K1 1.74e-28 117 33 2 193 3 ISCW021855 Queuine tRNA-ribosyltransferase accessory subunit 2 Ixodes scapularis
Q9YAC2 5.37e-27 115 28 11 367 3 tgtA tRNA-guanine(15) transglycosylase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q6LZL5 5.29e-25 110 25 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
O58843 5.75e-25 109 25 8 370 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q57878 7.21e-25 109 26 7 364 1 tgtA tRNA-guanine(15) transglycosylase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6VJR4 1.02e-24 109 25 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q9UZN0 1.57e-24 108 26 8 370 3 tgtA tRNA-guanine(15) transglycosylase Pyrococcus abyssi (strain GE5 / Orsay)
B6YUR8 1.89e-24 108 25 9 366 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus onnurineus (strain NA1)
Q2NGY4 2.19e-24 108 25 9 353 3 tgtA tRNA-guanine(15) transglycosylase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q5JHC0 2.2e-24 108 24 7 366 3 tgtA tRNA-guanine(15) transglycosylase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A4FYL8 2.21e-24 108 26 8 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q8ZYH2 2.67e-24 107 26 10 364 3 tgtA tRNA-guanine(15) transglycosylase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
A9A6B5 4.36e-24 107 25 7 364 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q8TH08 3.68e-23 104 23 7 366 1 tgtA tRNA-guanine(15) transglycosylase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O29667 1.33e-22 102 24 10 363 3 tgtA tRNA-guanine(15) transglycosylase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5UNI4 2.15e-22 102 25 9 367 3 tgtA tRNA-guanine(15) transglycosylase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A6USA4 2.8e-22 102 24 5 363 3 tgtA tRNA-guanine(15) transglycosylase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q3IR98 1.21e-21 99 26 12 367 3 tgtA tRNA-guanine(15) transglycosylase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q28DX0 1.61e-21 98 25 5 279 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus tropicalis
Q9C4M3 5.87e-21 97 26 12 370 1 tgtA tRNA-guanine(15) transglycosylase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
B8ZXI1 1.1e-20 96 25 7 282 1 Qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Mus musculus
Q6DF96 1.13e-20 96 25 5 281 2 qtrt2 Queuine tRNA-ribosyltransferase accessory subunit 2 Xenopus laevis
Q8TYV3 2.18e-20 95 25 8 353 3 tgtA tRNA-guanine(15) transglycosylase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q74N90 2.62e-20 95 25 13 362 3 tgtA tRNA-guanine(15) transglycosylase Nanoarchaeum equitans (strain Kin4-M)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00365
Feature type CDS
Gene tgt
Product tRNA guanosine(34) transglycosylase Tgt
Location 104365 - 105507 (strand: 1)
Length 1143 (nucleotides) / 380 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2296
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01702 Queuine tRNA-ribosyltransferase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0343 Translation, ribosomal structure and biogenesis (J) J Queuine/archaeosine tRNA-ribosyltransferase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00773 queuine tRNA-ribosyltransferase [EC:2.4.2.29] - -

Protein Sequence

MKYELDKTDGHARRGRLKFERGVVETPAFMPVGTYGTVKGMTPEEVEATGAQILLGNTFHLWLRPGQEIMKLHGDLHDFMQWKGPILTDSGGFQVFSLGAMRKIKEEGVHFRNPINGEKIFLSPEKSMEIQYDLGSDIVMIFDECTPYPSDWDYAKNSMEMSLRWAKRSRQRFDELNNKNALFGIIQGGVYEDLRDISVKGLVEIGFDGYAVGGLAVGEPKEDMHRILEHVCPQIPADKPRYLMGVGKPEDLVEGVRRGIDMFDCVMPTRNARNGHLFVTNGVIKIRNAKHRSDTSTLDEHCDCYTCKNYSRAYLHHLDRCNEILGARLNTIHNLRYYQRLMAEIRQAIDESRFEDFVHEFYERIGKPVPPLNSSASKCD

Flanking regions ( +/- flanking 50bp)

GTGCTGTTTTTATTATGCATTGGACTGTTTTTCTGATGCTTGGAGGATGAGTGAAATACGAATTAGATAAAACAGATGGTCATGCCCGTCGTGGTCGTCTTAAGTTTGAACGCGGTGTCGTTGAAACACCTGCATTTATGCCTGTAGGGACATACGGTACAGTTAAAGGGATGACACCTGAAGAAGTTGAAGCCACAGGTGCACAAATCCTTTTAGGCAATACTTTCCATTTATGGTTACGTCCTGGTCAAGAGATCATGAAATTACACGGTGATTTGCATGACTTTATGCAGTGGAAAGGGCCAATTTTAACCGATTCAGGTGGTTTCCAAGTCTTTAGTTTAGGCGCAATGCGTAAAATTAAAGAAGAAGGTGTGCATTTCCGTAACCCAATTAATGGTGAAAAGATTTTCTTAAGCCCAGAAAAATCAATGGAAATTCAGTACGATCTTGGATCAGATATTGTGATGATCTTCGATGAGTGTACGCCATATCCATCAGATTGGGATTATGCTAAAAATTCCATGGAGATGTCATTACGCTGGGCTAAACGTAGTCGTCAACGCTTTGATGAATTAAACAACAAAAATGCATTATTCGGTATTATTCAAGGCGGCGTTTACGAAGATTTACGTGATATCTCAGTGAAAGGGCTAGTGGAAATCGGCTTTGACGGTTACGCTGTTGGGGGCCTAGCTGTTGGTGAACCTAAAGAAGATATGCACCGTATTTTAGAACATGTTTGTCCACAAATCCCTGCGGATAAACCTCGTTATTTAATGGGTGTAGGTAAACCTGAAGATTTAGTTGAAGGTGTTCGTCGTGGTATCGATATGTTTGACTGTGTGATGCCAACACGAAATGCACGTAATGGACATCTGTTTGTAACAAATGGTGTCATTAAAATTCGTAATGCTAAACATCGTTCAGATACATCAACTCTGGATGAACATTGTGATTGCTACACCTGTAAAAATTATAGTCGCGCTTACCTACATCATCTTGATCGCTGTAACGAAATTTTAGGTGCAAGGCTGAATACCATCCATAACTTACGCTATTATCAGCGTCTAATGGCTGAAATTCGTCAAGCAATTGATGAGTCACGTTTCGAAGATTTCGTGCATGAGTTCTACGAACGTATTGGTAAACCAGTTCCACCGCTAAATAGCAGTGCGAGTAAGTGCGATTAATGTATACGAGAAAGCCCAATTCTGTGTATGATATTGGGCTTATAACTTGA