Homologs in group_1134

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06470 FBDBKF_06470 76.7 Morganella morganii S1 nhaA Na+/H+ antiporter NhaA
EHELCC_09515 EHELCC_09515 76.7 Morganella morganii S2 nhaA Na+/H+ antiporter NhaA
NLDBIP_09895 NLDBIP_09895 76.7 Morganella morganii S4 nhaA Na+/H+ antiporter NhaA
LHKJJB_07860 LHKJJB_07860 76.7 Morganella morganii S3 nhaA Na+/H+ antiporter NhaA
HKOGLL_07410 HKOGLL_07410 76.7 Morganella morganii S5 nhaA Na+/H+ antiporter NhaA
F4V73_RS15455 F4V73_RS15455 74.9 Morganella psychrotolerans nhaA Na+/H+ antiporter NhaA

Distribution of the homologs in the orthogroup group_1134

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1134

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2T1 0.0 761 100 0 392 3 nhaA Na(+)/H(+) antiporter NhaA Proteus mirabilis (strain HI4320)
Q7N8X6 0.0 547 72 0 388 3 nhaA Na(+)/H(+) antiporter NhaA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJD7 0.0 547 70 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FME1 0.0 526 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JL02 0.0 525 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ES8 0.0 525 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3M2 0.0 525 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TQF7 0.0 524 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis (strain Pestoides F)
Q1CMV5 0.0 524 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG77 0.0 524 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis
Q1C0J7 0.0 524 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Antiqua)
A9R013 0.0 524 71 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Angola)
A8G9L0 0.0 518 70 0 388 3 nhaA Na(+)/H(+) antiporter NhaA Serratia proteamaculans (strain 568)
A4SIW8 1.5e-176 500 62 0 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas salmonicida (strain A449)
A0KG33 2.11e-176 499 61 0 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8EH93 3.66e-164 468 61 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1S3W9 6.86e-164 468 60 0 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KZP4 1.17e-162 464 61 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain ANA-3)
A1RMD9 2.87e-162 463 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain W3-18-1)
A4Y4J2 3.11e-162 463 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3D1U4 2.19e-161 461 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9L5M4 3.14e-161 461 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS195)
A6WKP5 4.03e-161 460 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS185)
B8EBR4 4.03e-161 460 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS223)
Q0HG86 7.19e-161 460 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-4)
Q0HSH9 1.15e-160 459 60 0 386 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-7)
C3LMV3 4.9e-160 457 61 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain M66-2)
O85187 4.9e-160 457 61 3 389 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F7R1 4.9e-160 457 61 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q07YY4 2.92e-159 456 57 0 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella frigidimarina (strain NCIMB 400)
A6T4F6 4.19e-159 456 60 1 379 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7MLJ3 6.14e-159 455 61 3 393 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio vulnificus (strain YJ016)
Q8D8Y2 6.14e-159 455 61 3 393 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Vibrio vulnificus (strain CMCP6)
B0BTX5 1.23e-158 454 59 1 383 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H317 2.04e-158 454 59 1 383 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B6EHQ0 2.39e-158 453 60 3 387 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio salmonicida (strain LFI1238)
Q6LUL9 1.11e-157 451 63 3 392 3 nhaA Na(+)/H(+) antiporter NhaA Photobacterium profundum (strain SS9)
A3N3N9 6.65e-157 450 58 1 383 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A8ALU0 1.05e-156 449 60 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q56725 1.17e-156 449 60 3 391 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B2VH05 4.67e-156 447 59 1 382 3 nhaA Na(+)/H(+) antiporter NhaA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5FCI6 1.24e-155 446 59 3 387 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain MJ11)
Q5E6G4 1.24e-155 446 59 3 387 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q56580 2.29e-155 446 59 3 390 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio alginolyticus
A7MYD3 3.56e-155 446 59 3 387 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio campbellii (strain ATCC BAA-1116)
Q1RGI2 2.61e-154 443 59 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain UTI89 / UPEC)
Q8FLC1 2.61e-154 443 59 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLW9 2.61e-154 443 59 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A771 2.61e-154 443 59 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O1:K1 / APEC
A3QBR5 2.8e-154 443 59 0 391 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
C5B7L9 1.8e-152 439 58 1 389 3 nhaA Na(+)/H(+) antiporter NhaA Edwardsiella ictaluri (strain 93-146)
A5UG30 7.88e-151 435 56 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittGG)
A9MR50 1.17e-150 434 59 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q4QNW1 1.26e-150 434 56 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain 86-028NP)
P44581 2.22e-150 434 55 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UAR0 2.51e-150 433 56 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittEE)
Q8ZRZ3 3.02e-149 430 59 1 381 1 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYF8 3.02e-149 430 59 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57TM1 3.02e-149 430 59 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella choleraesuis (strain SC-B67)
Q8Z9N5 7.08e-149 429 58 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhi
Q5PDL4 7.08e-149 429 58 1 381 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A8H1B5 7.12e-149 429 57 0 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FSC4 7.46e-148 427 56 1 395 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sediminis (strain HAW-EB3)
Q65RK2 1.57e-147 426 55 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A4W6D7 2.29e-147 426 59 1 379 3 nhaA Na(+)/H(+) antiporter NhaA Enterobacter sp. (strain 638)
A7MIL1 2.63e-147 426 59 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Cronobacter sakazakii (strain ATCC BAA-894)
Q3Z5Z4 6.36e-147 424 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella sonnei (strain Ss046)
Q326K4 6.36e-147 424 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella boydii serotype 4 (strain Sb227)
A7ZVW6 6.36e-147 424 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O9:H4 (strain HS)
Q8XA63 6.36e-147 424 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O157:H7
A7ZHA6 6.36e-147 424 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q9CKD8 6.98e-147 424 59 1 379 3 nhaA Na(+)/H(+) antiporter NhaA Pasteurella multocida (strain Pm70)
Q83SR3 5e-146 422 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri
Q32KA0 8.63e-146 421 59 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella dysenteriae serotype 1 (strain Sd197)
P13738 1.35e-145 421 59 1 374 1 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain K12)
Q0I3A2 1.79e-145 421 59 1 377 3 nhaA Na(+)/H(+) antiporter NhaA Histophilus somni (strain 129Pt)
Q0T8H4 2.07e-145 421 60 1 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri serotype 5b (strain 8401)
B8F7T0 1.19e-144 419 54 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Glaesserella parasuis serovar 5 (strain SH0165)
Q3A4S1 3.89e-143 415 57 2 384 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C6DF08 5.22e-141 410 57 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0B9 5.01e-140 407 58 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C4LD18 6.63e-140 407 52 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A6Q6G8 9.41e-139 404 52 4 392 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurovum sp. (strain NBC37-1)
Q7VN39 4.69e-138 402 56 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A6VQU5 1.43e-137 400 56 1 379 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0KUA6 2.84e-135 395 55 1 378 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas putida (strain GB-1)
Q4KH68 3.55e-135 395 54 1 378 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KGX9 1.72e-131 385 54 1 378 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain Pf0-1)
Q88NS2 9.14e-131 384 55 1 376 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VZL9 1.21e-130 383 55 1 376 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A7ZBN0 7.87e-130 382 50 2 379 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter concisus (strain 13826)
Q12KG9 1.89e-129 380 55 1 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0L9Y5 2.79e-129 380 50 2 397 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q21VA4 2.88e-129 380 53 1 378 3 nhaA Na(+)/H(+) antiporter NhaA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q6AQH5 1.39e-127 375 50 1 384 3 nhaA Na(+)/H(+) antiporter NhaA Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q21FL0 1.59e-127 375 50 1 375 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q15N42 4.26e-126 372 49 1 394 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A0RRP1 2.02e-125 370 49 2 386 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter fetus subsp. fetus (strain 82-40)
A6Q0Z0 1.29e-123 365 50 3 357 3 nhaA Na(+)/H(+) antiporter NhaA Nitratiruptor sp. (strain SB155-2)
Q2NVY9 9.77e-123 363 54 2 387 3 nhaA Na(+)/H(+) antiporter NhaA Sodalis glossinidius (strain morsitans)
Q7W1Y0 5.05e-122 361 49 2 389 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQV8 5.05e-122 361 49 2 389 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2RY62 6.71e-122 361 52 3 385 3 nhaA Na(+)/H(+) antiporter NhaA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A7HZF9 1.11e-119 355 47 2 393 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A7GYJ7 4.78e-119 354 49 2 376 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter curvus (strain 525.92)
A5WCD3 1.68e-116 347 50 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter sp. (strain PRwf-1)
Q1Q8V3 3.88e-116 347 50 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q21EC5 1.11e-115 345 48 2 392 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q4FQM2 1.81e-115 345 50 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2GBB8 5.43e-115 344 50 7 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A0L5H1 6.15e-113 338 48 3 396 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5HSD9 1.11e-112 337 43 1 370 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni (strain RM1221)
Q0P7X4 2.1e-112 337 43 1 370 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FNW6 8e-112 335 43 1 370 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A1W1Q6 1.18e-111 335 43 1 370 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A7H5Z9 1.3e-111 335 43 1 370 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q48E39 1.67e-111 334 49 6 382 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZNN2 1.22e-110 332 51 8 384 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. syringae (strain B728a)
A6TJ58 1.79e-110 331 50 4 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q4FLX6 2.3e-109 329 48 2 376 3 nhaA Na(+)/H(+) antiporter NhaA Pelagibacter ubique (strain HTCC1062)
Q87WL3 4.26e-109 328 49 6 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HSD8 1.16e-108 327 43 1 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni (strain RM1221)
Q0P7X3 1.37e-108 327 43 1 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9AAZ2 3.56e-108 327 48 4 374 3 nhaA Na(+)/H(+) antiporter NhaA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A1W1Q7 4.67e-108 325 42 1 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNW7 4.67e-108 325 42 1 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A5FBK7 1.01e-107 325 46 2 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q1QF31 1.13e-107 325 49 4 383 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q1GVK1 2.42e-107 325 51 8 390 3 nhaA Na(+)/H(+) antiporter NhaA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q2W4H6 4.97e-107 323 48 4 379 3 nhaA Na(+)/H(+) antiporter NhaA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A7H600 5.79e-107 322 42 1 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q2NCP2 5.11e-106 321 48 2 390 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Erythrobacter litoralis (strain HTCC2594)
A0RMW2 1.69e-105 319 45 4 393 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter fetus subsp. fetus (strain 82-40)
Q30XM9 2.47e-105 321 43 5 435 3 nhaA Na(+)/H(+) antiporter NhaA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q4ZZI6 2.78e-105 318 49 5 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. syringae (strain B728a)
Q98C38 4.3e-105 318 48 4 380 3 nhaA Na(+)/H(+) antiporter NhaA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2NDA1 1.12e-104 317 46 5 398 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Erythrobacter litoralis (strain HTCC2594)
Q87UW8 3.55e-104 316 49 5 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48PL9 4.64e-103 313 49 5 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1IJ81 2.87e-101 310 43 5 416 3 nhaA Na(+)/H(+) antiporter NhaA Koribacter versatilis (strain Ellin345)
A6WW92 3.66e-101 308 47 5 390 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A6LXJ5 5.94e-101 308 44 6 394 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A5IF79 1.09e-100 306 47 3 377 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Corby)
Q0AM65 1.62e-99 304 45 3 378 3 nhaA Na(+)/H(+) antiporter NhaA Maricaulis maris (strain MCS10)
A8EVL5 1.32e-97 299 43 8 404 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Aliarcobacter butzleri (strain RM4018)
Q5X2E5 4.98e-97 297 47 4 386 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Paris)
Q1CR54 1.22e-96 298 41 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain HPAG1)
A6H0G8 2.01e-96 295 43 3 392 3 nhaA Na(+)/H(+) antiporter NhaA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q30PM3 4.26e-96 297 41 4 421 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q5WU67 4.57e-96 295 47 3 377 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Lens)
B5Z9I3 5.67e-96 296 41 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain G27)
Q8G2C7 7.66e-96 294 46 6 386 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis biovar 1 (strain 1330)
A5VNX4 7.66e-96 294 46 6 386 3 nhaA Na(+)/H(+) antiporter NhaA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M8H1 7.66e-96 294 46 6 386 3 nhaA Na(+)/H(+) antiporter NhaA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q0BSV4 8.13e-96 294 47 7 374 3 nhaA Na(+)/H(+) antiporter NhaA Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q9ZJ68 3.2e-95 294 41 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain J99 / ATCC 700824)
Q11TX2 3.93e-95 292 44 4 386 3 nhaA Na(+)/H(+) antiporter NhaA Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B0CK83 4.88e-95 292 46 6 386 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8D2Q7 1.05e-94 291 43 4 391 3 nhaA Na(+)/H(+) antiporter NhaA Wigglesworthia glossinidia brevipalpis
Q5LC87 1.13e-93 290 41 5 434 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64T76 3.67e-93 289 41 5 434 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain YCH46)
Q1D5J5 5.22e-93 289 42 4 420 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Myxococcus xanthus (strain DK1622)
Q8YFI5 6.01e-93 297 46 6 390 3 nhaA Na(+)/H(+) antiporter NhaA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YMB3 8.17e-93 296 46 6 390 3 nhaA Na(+)/H(+) antiporter NhaA Brucella abortus (strain 2308)
B6JP50 3.14e-92 286 41 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain P12)
A0Q8N8 3.35e-92 285 45 4 370 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. novicida (strain U112)
O26076 4.29e-92 286 41 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain ATCC 700392 / 26695)
A8I126 5.45e-92 285 45 4 384 3 nhaA Na(+)/H(+) antiporter NhaA Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A6LTE4 1.69e-91 283 43 4 348 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q0BP56 2.22e-91 283 44 4 376 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5W5 2.22e-91 283 44 4 376 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain LVS)
A7N9B9 2.22e-91 283 44 4 376 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SEL7 2.48e-91 283 45 4 370 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5NE91 2.7e-91 282 45 4 370 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FP4 2.7e-91 282 45 4 370 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain FSC 198)
Q17YZ5 3.09e-91 284 40 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter acinonychis (strain Sheeba)
Q2KCN1 5.77e-91 282 46 4 387 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q3SNN8 7.79e-91 283 42 7 418 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7UTY3 9.32e-91 283 40 7 424 3 nhaA Na(+)/H(+) antiporter NhaA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q88FW9 1.02e-90 283 40 7 420 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4IVT5 2.18e-90 280 44 4 370 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain WY96-3418)
Q47I87 2.59e-90 280 44 6 384 3 nhaA Na(+)/H(+) antiporter NhaA Dechloromonas aromatica (strain RCB)
Q1I836 2.61e-90 280 46 5 387 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas entomophila (strain L48)
A9GMF2 3.09e-90 283 43 4 419 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Sorangium cellulosum (strain So ce56)
A5W1K7 3.74e-90 282 41 8 421 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8AA31 8.91e-90 280 39 4 435 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A7HH11 1.09e-89 281 40 5 426 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter sp. (strain Fw109-5)
Q7M922 1.73e-89 280 40 8 440 3 nhaA Na(+)/H(+) antiporter NhaA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A5FLP0 2.46e-89 277 46 3 352 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A7I1I1 6.39e-89 277 42 1 378 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B7J5J3 1.01e-88 278 39 4 433 3 nhaA Na(+)/H(+) antiporter NhaA Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q0K437 1.19e-88 278 42 8 422 3 nhaA Na(+)/H(+) antiporter NhaA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A5FT18 2.95e-88 277 38 6 430 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Acidiphilium cryptum (strain JF-5)
Q21JV7 3.1e-88 277 41 4 424 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5FNE6 3.52e-88 275 40 1 379 3 nhaA Na(+)/H(+) antiporter NhaA Gluconobacter oxydans (strain 621H)
A9IQG4 6.52e-88 276 39 6 433 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella tribocorum (strain CIP 105476 / IBS 506)
A5V7M2 1.49e-87 273 49 4 381 3 nhaA Na(+)/H(+) antiporter NhaA Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q6G5K1 1.79e-87 275 40 8 416 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1IY26 2.66e-87 273 44 6 389 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A8EUK5 4e-87 273 40 7 425 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Aliarcobacter butzleri (strain RM4018)
A9EYV6 1.67e-86 273 40 5 430 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Sorangium cellulosum (strain So ce56)
Q2G4Z2 2.45e-86 270 45 6 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A8F302 3.47e-86 270 37 4 378 3 nhaA Na(+)/H(+) antiporter NhaA Rickettsia massiliae (strain Mtu5)
Q7VFN0 3.7e-86 271 39 8 430 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A5FT52 1.15e-85 270 38 6 426 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Acidiphilium cryptum (strain JF-5)
A5FTA4 1.31e-85 270 38 6 426 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Acidiphilium cryptum (strain JF-5)
A8M393 1.87e-84 267 42 8 388 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora arenicola (strain CNS-205)
B2RLS8 2.26e-84 267 38 5 431 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A1URT7 2.43e-84 267 40 7 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A4X422 3e-84 266 41 8 391 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q8D666 3.99e-84 266 37 5 428 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Vibrio vulnificus (strain CMCP6)
Q7MTR7 7.6e-84 265 38 5 431 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A6X1P0 8.16e-84 263 47 7 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q47MI6 8.43e-84 264 42 8 401 3 nhaA Na(+)/H(+) antiporter NhaA Thermobifida fusca (strain YX)
A6L743 9.46e-84 265 39 8 432 3 nhaA Na(+)/H(+) antiporter NhaA Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q6G0H9 5.12e-83 263 39 7 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella quintana (strain Toulouse)
A0LLE6 1.08e-82 263 37 6 419 3 nhaA Na(+)/H(+) antiporter NhaA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A9IMX7 5.64e-82 261 40 6 419 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q3A1R2 8.57e-82 260 41 4 421 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6LAI2 9.12e-82 260 37 6 440 3 nhaA Na(+)/H(+) antiporter NhaA Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q1J2Y8 1.12e-81 259 41 4 391 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q5NRB1 1.74e-81 257 43 4 379 3 nhaA Na(+)/H(+) antiporter NhaA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q0S8L7 5.68e-81 257 42 5 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Rhodococcus jostii (strain RHA1)
A1SDK4 8.88e-81 257 41 7 378 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Nocardioides sp. (strain ATCC BAA-499 / JS614)
A5EUT7 2.16e-80 257 37 7 429 3 nhaA Na(+)/H(+) antiporter NhaA Dichelobacter nodosus (strain VCS1703A)
A6SWX0 1.34e-75 244 38 8 424 3 nhaA Na(+)/H(+) antiporter NhaA Janthinobacterium sp. (strain Marseille)
Q15N95 1.83e-75 244 36 6 434 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q0RG46 5.76e-75 243 36 5 410 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A9H2L4 7.8e-75 240 38 4 387 3 nhaA Na(+)/H(+) antiporter NhaA Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A8M1G0 4.4e-74 240 41 7 372 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora arenicola (strain CNS-205)
A3PYK5 7.67e-74 239 41 8 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain JLS)
Q1B9W9 1.21e-73 239 41 8 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain MCS)
A1UF43 1.3e-73 239 41 8 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain KMS)
Q5Z2Z5 2.11e-73 238 41 5 378 3 nhaA Na(+)/H(+) antiporter NhaA Nocardia farcinica (strain IFM 10152)
A1WCI8 3.35e-73 237 43 4 361 3 nhaA Na(+)/H(+) antiporter NhaA Acidovorax sp. (strain JS42)
Q1CZI3 7.93e-73 238 41 2 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Myxococcus xanthus (strain DK1622)
A1SRG6 1.04e-72 236 38 8 434 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6W9V1 3.34e-72 236 37 8 407 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A4X6R9 4.07e-72 234 43 8 394 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A4F6L1 5.77e-71 231 42 3 349 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A4FCM4 8.55e-71 230 40 9 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
A9WU27 2.22e-70 230 40 9 400 3 nhaA Na(+)/H(+) antiporter NhaA Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q2Y8T1 7.15e-70 234 36 6 427 3 nhaA Na(+)/H(+) antiporter NhaA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q12P61 1.08e-69 229 35 6 428 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A1SRH4 1.27e-69 229 35 6 427 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q93F90 2.86e-69 229 40 7 379 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces antibioticus
A4TCS6 4.63e-69 227 40 7 409 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium gilvum (strain PYR-GCK)
A4G6P0 2.04e-68 230 35 5 418 3 nhaA Na(+)/H(+) antiporter NhaA Herminiimonas arsenicoxydans
Q6AB77 1.27e-67 223 37 8 390 3 nhaA Na(+)/H(+) antiporter NhaA Cutibacterium acnes (strain DSM 16379 / KPA171202)
A1R4H0 1.43e-67 223 41 8 394 3 nhaA Na(+)/H(+) antiporter NhaA Paenarthrobacter aurescens (strain TC1)
Q2J9U7 2.29e-67 223 41 10 378 3 nhaA Na(+)/H(+) antiporter NhaA Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A0QW18 3.07e-67 222 40 11 400 3 nhaA Na(+)/H(+) antiporter NhaA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A1T7Y9 1.29e-66 221 38 6 409 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0JR38 9.25e-66 219 42 8 379 3 nhaA Na(+)/H(+) antiporter NhaA Arthrobacter sp. (strain FB24)
Q92Y37 1.81e-65 218 36 4 421 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium meliloti (strain 1021)
Q4UJQ7 8e-65 211 38 3 287 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A1SHU2 1.51e-64 219 35 7 411 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0M0N2 1.13e-63 213 39 4 391 3 nhaA Na(+)/H(+) antiporter NhaA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A5CM04 1.51e-63 212 39 8 399 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q9X929 3.55e-62 210 41 8 379 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A6W4F5 1.78e-61 207 37 9 400 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q8G5R2 2.18e-61 208 33 10 414 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium longum (strain NCC 2705)
A1A0Y8 2.19e-60 204 35 8 412 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q2IE76 2.23e-60 209 39 6 418 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter dehalogenans (strain 2CP-C)
Q82EL6 2.87e-60 204 41 9 384 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2VPW7 2.28e-58 199 34 8 403 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium breve (strain NCIMB 8807 / UCC2003)
A1T2V5 1.95e-56 198 33 6 404 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A8GU51 3.99e-56 188 40 2 261 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Sheila Smith)
B0BVP1 3.99e-56 188 40 2 261 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Iowa)
Q0RHS2 4.35e-56 194 42 6 350 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q9S1X8 1.16e-55 191 40 8 358 3 nhaA1 Na(+)/H(+) antiporter NhaA 1/4 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4T134 2.35e-54 192 32 5 403 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium gilvum (strain PYR-GCK)
Q0SG15 6.03e-54 191 35 8 413 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Rhodococcus jostii (strain RHA1)
A8LVS8 1.68e-52 188 32 9 424 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora arenicola (strain CNS-205)
A3PTR0 9.89e-52 185 34 5 391 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain JLS)
Q1BES7 2.64e-51 184 34 5 391 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain MCS)
A1UA55 2.64e-51 184 34 5 391 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain KMS)
Q0RPD5 5.91e-49 174 38 8 373 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q7VFN1 1.07e-48 175 39 1 238 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7VFN1 9.34e-25 108 41 3 151 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9S2C8 1.77e-48 177 33 7 396 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A5CTB2 2.63e-47 169 38 10 369 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
A4X5I0 4.85e-46 170 32 8 415 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q83MP1 4.39e-38 144 35 12 383 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain Twist)
Q83N58 4.62e-38 144 35 12 383 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain TW08/27)
Q28L40 2.47e-31 126 33 21 429 3 nhaA Na(+)/H(+) antiporter NhaA Jannaschia sp. (strain CCS1)
A8GYC5 1.12e-30 118 37 2 164 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain OSU 85-389)
Q24V86 4.75e-28 117 32 20 400 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain Y51)
B8FPI3 4.75e-28 117 32 20 400 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q74AP9 1.02e-24 107 30 13 363 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1ATB4 1.12e-24 107 29 16 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q39WP5 3.14e-24 106 30 13 363 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A5G6V8 8.17e-23 102 33 10 309 3 nhaA Na(+)/H(+) antiporter NhaA Geotalea uraniireducens (strain Rf4)
Q92FX2 1.13e-21 93 38 2 135 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A1AK41 1.19e-19 93 30 16 386 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q1RGL5 1.64e-19 87 39 1 106 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain RML369-C)
A8GQA2 2.2e-11 62 43 0 60 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia akari (strain Hartford)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00055
Feature type CDS
Gene nhaA
Product Na+/H+ antiporter NhaA
Location 21812 - 22990 (strand: 1)
Length 1179 (nucleotides) / 392 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1134
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06965 Na+/H+ antiporter 1

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3004 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)		 CP Na+/H+ antiporter NhaA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03313 Na+:H+ antiporter, NhaA family - -

Protein Sequence

MTAIIRQFLRLEASGGILLIVAAIIALIMANTPLSALYNEFLSIPIMIKFGALELDKPLILWVNDALMAIFFLVVGLEVKRELKEGSLAQRDRAIFPAIAAVGGMLAPALIYLFFNHGDAIGQQGWAIPAATDIAFALGVMALLGRRVPVELKVFLLALAIIDDLGVIVIIALFYSKSVALVPLLLAALITIMLFILNWRKVSNTAVYLVLGFILWVCILKSGIHATIAGVIVGFLIPLRDKEGASPSEELEHVLHPWVAYLILPLFAFSNAGVSLNGVTLDGMLSTLPVGIALGLFLGKPIGIFLFSWVSVKLGIAKLPDAINLKQIFAVSVLCGIGFTMSIFIAGLAFEGAIEAYNTYSKLGILVGSTMAAVVGYLLLNSVLPKLKQKQK

Flanking regions ( +/- flanking 50bp)

TTCATAATTAGCATATTATTAACACAAATAGACATTTTTAGGTTAACAATATGACAGCAATTATTAGACAATTTTTAAGATTAGAGGCATCAGGCGGTATTCTTCTGATTGTTGCTGCTATTATCGCATTAATAATGGCGAATACACCTCTTAGTGCTTTGTATAATGAGTTTTTATCTATCCCAATAATGATTAAATTTGGGGCATTAGAGCTAGATAAACCGTTGATCTTATGGGTTAACGATGCACTCATGGCCATCTTTTTCTTAGTGGTAGGATTAGAAGTCAAACGGGAGCTAAAAGAAGGTTCATTAGCGCAACGTGATCGCGCTATTTTTCCTGCAATTGCTGCAGTAGGAGGAATGTTAGCACCTGCTTTGATTTATCTATTTTTTAATCATGGCGATGCGATTGGTCAGCAAGGATGGGCTATTCCGGCAGCAACAGATATTGCTTTTGCTCTAGGTGTAATGGCGTTACTAGGGCGTCGCGTTCCTGTGGAATTGAAAGTCTTTTTATTAGCGCTAGCCATTATTGATGATCTTGGTGTCATTGTGATTATTGCTCTCTTTTATTCTAAGAGTGTGGCATTAGTCCCGTTATTATTGGCAGCGCTAATCACCATCATGTTGTTTATTCTTAATTGGCGTAAAGTGAGTAATACAGCAGTTTACTTAGTCCTAGGCTTTATTTTGTGGGTGTGTATTTTGAAATCAGGTATACATGCCACAATAGCGGGAGTGATTGTTGGATTCCTGATCCCATTAAGAGATAAAGAGGGGGCTTCACCGTCGGAAGAGTTAGAGCATGTTTTACACCCGTGGGTTGCCTACTTAATATTACCGCTATTTGCTTTTAGTAATGCGGGGGTTTCTTTAAATGGCGTTACCCTTGATGGCATGTTATCGACCTTACCCGTTGGTATTGCATTAGGGCTTTTCTTAGGTAAGCCGATTGGGATTTTTCTCTTTAGTTGGGTTTCGGTAAAACTAGGGATTGCAAAATTGCCAGATGCGATTAATCTTAAGCAAATATTTGCCGTTTCTGTTTTATGTGGTATCGGTTTTACTATGTCTATCTTTATCGCAGGTCTTGCGTTTGAAGGTGCTATAGAAGCCTATAATACATACTCTAAACTGGGTATTTTAGTTGGCTCCACCATGGCTGCTGTTGTGGGATATTTATTGCTTAACTCTGTTTTACCGAAGTTGAAGCAGAAGCAAAAATAGCGAAATTGAGTAGGGAACTCGTTTTCTAAACACAATAAAAACCGAGCTAT