Homologs in group_1196

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_09515 EHELCC_09515 100.0 Morganella morganii S2 nhaA Na+/H+ antiporter NhaA
NLDBIP_09895 NLDBIP_09895 100.0 Morganella morganii S4 nhaA Na+/H+ antiporter NhaA
LHKJJB_07860 LHKJJB_07860 100.0 Morganella morganii S3 nhaA Na+/H+ antiporter NhaA
HKOGLL_07410 HKOGLL_07410 100.0 Morganella morganii S5 nhaA Na+/H+ antiporter NhaA
F4V73_RS15455 F4V73_RS15455 93.6 Morganella psychrotolerans nhaA Na+/H+ antiporter NhaA
PMI_RS00055 PMI_RS00055 76.7 Proteus mirabilis HI4320 nhaA Na+/H+ antiporter NhaA

Distribution of the homologs in the orthogroup group_1196

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1196

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2T1 0.0 587 76 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Proteus mirabilis (strain HI4320)
Q7N8X6 0.0 561 75 1 389 3 nhaA Na(+)/H(+) antiporter NhaA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJD7 0.0 547 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A7FME1 0.0 529 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JL02 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ES8 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3M2 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A4TQF7 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis (strain Pestoides F)
Q1CMV5 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CG77 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis
Q1C0J7 0.0 527 73 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Antiqua)
A8G9L0 0.0 526 73 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Serratia proteamaculans (strain 568)
A9R013 0.0 525 72 2 393 3 nhaA Na(+)/H(+) antiporter NhaA Yersinia pestis bv. Antiqua (strain Angola)
A0KG33 2.53e-171 486 62 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SIW8 3.26e-171 486 63 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Aeromonas salmonicida (strain A449)
Q7MLJ3 6.26e-160 457 62 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio vulnificus (strain YJ016)
Q8D8Y2 6.26e-160 457 62 1 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Vibrio vulnificus (strain CMCP6)
A7MYD3 8.72e-160 457 61 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio campbellii (strain ATCC BAA-1116)
Q56725 5.37e-159 455 62 1 388 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6LUL9 2.84e-158 453 65 3 390 3 nhaA Na(+)/H(+) antiporter NhaA Photobacterium profundum (strain SS9)
Q56580 3.26e-158 453 61 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio alginolyticus
A6T4F6 3.57e-158 453 63 2 380 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C3LMV3 3.33e-157 450 61 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain M66-2)
O85187 3.33e-157 450 61 1 388 1 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F7R1 3.33e-157 450 61 1 388 3 nhaA Na(+)/H(+) antiporter NhaA Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6EHQ0 9.04e-155 444 59 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio salmonicida (strain LFI1238)
A1S3W9 2.54e-154 443 58 1 391 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B2VH05 5.34e-154 442 60 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8EH93 6.2e-154 442 59 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0BTX5 3.83e-153 440 59 2 384 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A1RMD9 5.94e-153 440 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain W3-18-1)
A4Y4J2 6.09e-153 440 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B3H317 7.62e-153 439 59 2 384 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A9L5M4 4.06e-152 437 59 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS195)
A3N3N9 4.93e-152 437 58 3 385 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A3D1U4 5.45e-152 437 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS155 / ATCC BAA-1091)
B5FCI6 6.2e-152 437 59 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain MJ11)
Q5E6G4 6.2e-152 437 59 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Aliivibrio fischeri (strain ATCC 700601 / ES114)
A6WKP5 9.51e-152 437 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS185)
B8EBR4 9.51e-152 437 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella baltica (strain OS223)
A0KZP4 1e-151 437 59 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain ANA-3)
A8ALU0 1.64e-151 436 60 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q07YY4 2.35e-151 436 56 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella frigidimarina (strain NCIMB 400)
C5B7L9 1.39e-150 434 58 2 389 3 nhaA Na(+)/H(+) antiporter NhaA Edwardsiella ictaluri (strain 93-146)
Q1RGI2 1.18e-148 429 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain UTI89 / UPEC)
Q8FLC1 1.18e-148 429 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLW9 1.18e-148 429 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A771 1.18e-148 429 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O1:K1 / APEC
Q0HG86 2.18e-148 428 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-4)
Q0HSH9 2.84e-148 428 58 1 390 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sp. (strain MR-7)
A7MIL1 8.95e-147 424 60 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Cronobacter sakazakii (strain ATCC BAA-894)
A3QBR5 1.24e-146 424 57 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9MR50 6.79e-146 422 59 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q9CKD8 2.32e-145 420 61 2 375 3 nhaA Na(+)/H(+) antiporter NhaA Pasteurella multocida (strain Pm70)
Q65RK2 4.14e-145 420 57 3 383 3 nhaA Na(+)/H(+) antiporter NhaA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8ZRZ3 1.1e-144 419 59 2 382 1 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MYF8 1.1e-144 419 59 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57TM1 1.1e-144 419 59 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella choleraesuis (strain SC-B67)
Q8Z9N5 1.2e-144 419 59 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella typhi
Q5PDL4 1.2e-144 419 59 2 382 3 nhaA Na(+)/H(+) antiporter NhaA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4W6D7 1.22e-144 419 60 2 379 3 nhaA Na(+)/H(+) antiporter NhaA Enterobacter sp. (strain 638)
C6DF08 1.58e-144 419 60 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0B9 3.71e-144 417 60 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P44581 5.86e-144 417 56 2 381 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UG30 1.02e-143 417 55 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittGG)
Q4QNW1 1.19e-143 416 55 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain 86-028NP)
A8H1B5 2.03e-143 416 57 1 391 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B8F7T0 2.05e-143 416 57 3 385 3 nhaA Na(+)/H(+) antiporter NhaA Glaesserella parasuis serovar 5 (strain SH0165)
A5UAR0 4.04e-143 415 55 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus influenzae (strain PittEE)
Q3A4S1 1.36e-142 414 57 2 388 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A8FSC4 2.63e-142 413 56 1 392 3 nhaA Na(+)/H(+) antiporter NhaA Shewanella sediminis (strain HAW-EB3)
Q3Z5Z4 9.5e-142 411 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella sonnei (strain Ss046)
Q326K4 9.5e-142 411 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella boydii serotype 4 (strain Sb227)
A7ZVW6 9.5e-142 411 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O9:H4 (strain HS)
Q8XA63 9.5e-142 411 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O157:H7
A7ZHA6 9.5e-142 411 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83SR3 7.88e-141 409 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri
Q32KA0 1.53e-140 408 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella dysenteriae serotype 1 (strain Sd197)
P13738 2.04e-140 408 60 2 374 1 nhaA Na(+)/H(+) antiporter NhaA Escherichia coli (strain K12)
Q0T8H4 3.55e-140 407 60 2 374 3 nhaA Na(+)/H(+) antiporter NhaA Shigella flexneri serotype 5b (strain 8401)
A6Q6G8 5.9e-140 407 54 2 381 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurovum sp. (strain NBC37-1)
Q0I3A2 6.25e-140 407 57 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Histophilus somni (strain 129Pt)
B0KUA6 1.9e-135 395 56 0 377 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas putida (strain GB-1)
Q7VN39 4.49e-134 392 57 2 393 3 nhaA Na(+)/H(+) antiporter NhaA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4LD18 5.02e-134 392 54 2 383 3 nhaA Na(+)/H(+) antiporter NhaA Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A0L9Y5 1.09e-131 386 52 3 396 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A6VQU5 1.38e-131 385 55 2 380 3 nhaA Na(+)/H(+) antiporter NhaA Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4KH68 4.03e-131 384 53 0 377 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A5VZL9 6.31e-131 384 55 1 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q88NS2 2.44e-130 382 55 1 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q12KG9 5e-130 382 56 0 385 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q15N42 1.31e-128 378 52 1 392 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A6Q0Z0 2.06e-128 377 54 3 355 3 nhaA Na(+)/H(+) antiporter NhaA Nitratiruptor sp. (strain SB155-2)
Q3KGX9 4.79e-128 377 53 0 389 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas fluorescens (strain Pf0-1)
Q21VA4 1.56e-126 373 53 2 379 3 nhaA Na(+)/H(+) antiporter NhaA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21FL0 1.92e-125 369 50 1 373 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A7ZBN0 2.13e-124 368 48 2 388 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter concisus (strain 13826)
Q7W1Y0 2.89e-123 365 50 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQV8 2.89e-123 365 50 2 391 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q2NVY9 5e-122 361 55 1 387 3 nhaA Na(+)/H(+) antiporter NhaA Sodalis glossinidius (strain morsitans)
A5WCD3 2.8e-120 357 53 1 360 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter sp. (strain PRwf-1)
A7GYJ7 1.37e-119 355 47 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Campylobacter curvus (strain 525.92)
A0RRP1 1.51e-118 352 49 2 375 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter fetus subsp. fetus (strain 82-40)
Q1Q8V3 8.17e-118 351 50 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A6TJ58 1.41e-117 349 51 4 383 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q4FQM2 3.83e-117 349 49 2 385 3 nhaA Na(+)/H(+) antiporter NhaA Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q2GBB8 1.59e-116 348 50 4 384 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q6AQH5 3.12e-116 347 50 1 379 3 nhaA Na(+)/H(+) antiporter NhaA Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A7HZF9 3.49e-114 341 44 4 395 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q2RY62 3.6e-114 342 51 3 385 3 nhaA Na(+)/H(+) antiporter NhaA Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q0P7X3 9.71e-114 340 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5HSD8 1.6e-113 339 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni (strain RM1221)
A1W1Q7 2.53e-113 338 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNW7 2.53e-113 338 46 2 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q48E39 2.61e-113 339 50 4 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q0P7X4 2.97e-113 339 45 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A0L5H1 3.94e-113 338 49 3 397 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q21EC5 1.4e-112 337 48 3 390 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5HSD9 2.1e-112 337 45 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni (strain RM1221)
Q4ZNN2 2.22e-112 337 50 4 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. syringae (strain B728a)
A7H600 7.19e-112 335 46 2 373 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1W1Q6 7.75e-112 335 45 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A8FNW6 8e-112 335 45 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A7H5Z9 1.99e-111 334 45 2 371 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q87WL3 9.52e-111 332 50 4 381 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2W4H6 5.43e-110 330 48 4 380 3 nhaA Na(+)/H(+) antiporter NhaA Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q4ZZI6 8.17e-109 327 50 3 386 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas syringae pv. syringae (strain B728a)
Q4FLX6 8.45e-109 327 47 1 376 3 nhaA Na(+)/H(+) antiporter NhaA Pelagibacter ubique (strain HTCC1062)
Q98C38 2.28e-108 327 49 4 383 3 nhaA Na(+)/H(+) antiporter NhaA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2NDA1 6.23e-108 326 47 5 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Erythrobacter litoralis (strain HTCC2594)
Q2NCP2 1.95e-107 324 51 3 377 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Erythrobacter litoralis (strain HTCC2594)
A6WW92 3.38e-107 323 48 6 392 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q87UW8 3.57e-107 323 50 3 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1QF31 3.52e-106 321 47 5 394 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q9AAZ2 6.92e-106 321 49 4 373 3 nhaA Na(+)/H(+) antiporter NhaA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A5FBK7 1.62e-105 320 45 2 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A0RMW2 1.78e-105 319 45 3 383 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Campylobacter fetus subsp. fetus (strain 82-40)
Q1GVK1 2.59e-105 320 51 7 390 3 nhaA Na(+)/H(+) antiporter NhaA Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q48PL9 3.2e-105 318 48 3 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q30XM9 1.46e-104 318 43 4 434 3 nhaA Na(+)/H(+) antiporter NhaA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q0AM65 6.11e-102 310 44 3 377 3 nhaA Na(+)/H(+) antiporter NhaA Maricaulis maris (strain MCS10)
Q1CR54 3.06e-100 307 42 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain HPAG1)
B5Z9I3 4.47e-100 307 43 5 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain G27)
A5IF79 1.43e-99 303 46 3 384 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Corby)
Q1I836 2.11e-99 304 48 3 390 3 nhaA Na(+)/H(+) antiporter NhaA Pseudomonas entomophila (strain L48)
A6LXJ5 2.12e-99 304 44 5 376 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A6LTE4 2.18e-99 304 45 3 349 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A8EVL5 3.04e-99 303 43 7 399 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Aliarcobacter butzleri (strain RM4018)
Q9ZJ68 2.66e-98 302 41 4 431 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain J99 / ATCC 700824)
Q8G2C7 1.24e-97 299 47 5 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis biovar 1 (strain 1330)
A5VNX4 1.24e-97 299 47 5 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A9M8H1 1.24e-97 299 47 5 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q1IJ81 8.81e-97 299 43 5 409 3 nhaA Na(+)/H(+) antiporter NhaA Koribacter versatilis (strain Ellin345)
B0CK83 9.38e-97 296 47 5 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella suis (strain ATCC 23445 / NCTC 10510)
Q5X2E5 6.48e-96 294 47 3 377 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Paris)
Q2KCN1 9.31e-96 294 48 5 375 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B6JP50 1.94e-95 295 41 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain P12)
Q8YFI5 3.58e-95 303 47 4 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
O26076 4.61e-95 294 42 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter pylori (strain ATCC 700392 / 26695)
A8I126 6.11e-95 292 45 4 387 3 nhaA Na(+)/H(+) antiporter NhaA Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2YMB3 7.21e-95 302 47 4 393 3 nhaA Na(+)/H(+) antiporter NhaA Brucella abortus (strain 2308)
Q5WU67 7.63e-95 291 46 3 384 3 nhaA Na(+)/H(+) antiporter NhaA Legionella pneumophila (strain Lens)
A0Q8N8 1.31e-94 291 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. novicida (strain U112)
Q17YZ5 1.34e-94 293 41 4 427 3 nhaA Na(+)/H(+) antiporter NhaA Helicobacter acinonychis (strain Sheeba)
Q11TX2 3.1e-94 290 43 4 392 3 nhaA Na(+)/H(+) antiporter NhaA Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B2SEL7 6.59e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. mediasiatica (strain FSC147)
Q5NE91 7.5e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FP4 7.5e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BP56 8.18e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5W5 8.18e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain LVS)
A7N9B9 8.18e-94 289 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q0BSV4 2.75e-93 288 46 6 376 3 nhaA Na(+)/H(+) antiporter NhaA Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q30PM3 3.16e-93 289 41 5 422 3 nhaA Na(+)/H(+) antiporter NhaA Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q1D5J5 3.46e-93 290 43 5 421 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Myxococcus xanthus (strain DK1622)
A4IVT5 7.44e-93 286 45 5 381 3 nhaA Na(+)/H(+) antiporter NhaA Francisella tularensis subsp. tularensis (strain WY96-3418)
Q2G4Z2 8.83e-93 286 45 5 381 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B7J5J3 1.36e-92 288 40 5 434 3 nhaA Na(+)/H(+) antiporter NhaA Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q7M922 1.73e-92 288 42 8 426 3 nhaA Na(+)/H(+) antiporter NhaA Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A6H0G8 2.84e-92 285 42 4 392 3 nhaA Na(+)/H(+) antiporter NhaA Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q21JV7 1.07e-91 286 41 5 429 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q47I87 1.57e-91 283 45 6 383 3 nhaA Na(+)/H(+) antiporter NhaA Dechloromonas aromatica (strain RCB)
Q3SNN8 2.71e-91 285 41 5 417 3 nhaA Na(+)/H(+) antiporter NhaA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q7VFN0 3.72e-91 284 40 8 426 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A7HH11 8.7e-91 283 40 4 426 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter sp. (strain Fw109-5)
Q5FNE6 9.58e-91 281 40 3 389 3 nhaA Na(+)/H(+) antiporter NhaA Gluconobacter oxydans (strain 621H)
Q0K437 1.81e-90 283 41 8 420 3 nhaA Na(+)/H(+) antiporter NhaA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A5V7M2 2.65e-90 280 49 5 382 3 nhaA Na(+)/H(+) antiporter NhaA Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A9IQG4 3.7e-90 282 39 6 417 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella tribocorum (strain CIP 105476 / IBS 506)
A9GMF2 1.59e-89 281 43 5 419 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Sorangium cellulosum (strain So ce56)
A8EUK5 2.39e-89 279 40 5 422 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Aliarcobacter butzleri (strain RM4018)
Q6G5K1 2.9e-89 280 38 5 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q1IY26 2.18e-88 276 45 5 387 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A9EYV6 3.36e-88 277 41 6 416 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Sorangium cellulosum (strain So ce56)
Q88FW9 4.93e-88 276 40 6 419 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W1K7 4.29e-87 274 40 7 420 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5FLP0 2.79e-86 270 43 5 388 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q8D2Q7 2.97e-86 270 40 5 357 3 nhaA Na(+)/H(+) antiporter NhaA Wigglesworthia glossinidia brevipalpis
A6X1P0 4e-86 270 47 6 388 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q7UTY3 6.24e-86 270 40 8 425 3 nhaA Na(+)/H(+) antiporter NhaA Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A1SDK4 9.7e-86 270 41 6 397 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q6G0H9 2.11e-85 270 37 5 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella quintana (strain Toulouse)
Q5LC87 9.2e-85 267 37 3 432 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64T76 2.88e-84 266 37 3 432 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides fragilis (strain YCH46)
A1URT7 3.78e-84 266 38 6 415 3 nhaA Na(+)/H(+) antiporter NhaA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
A6SWX0 6.17e-84 266 40 7 420 3 nhaA Na(+)/H(+) antiporter NhaA Janthinobacterium sp. (strain Marseille)
A6L743 1.38e-83 265 38 4 426 3 nhaA Na(+)/H(+) antiporter NhaA Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A5FT18 1.45e-83 265 37 6 427 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Acidiphilium cryptum (strain JF-5)
Q5NRB1 7.55e-83 261 42 4 388 3 nhaA Na(+)/H(+) antiporter NhaA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1J2Y8 1.38e-81 259 41 5 391 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A5FTA4 1.87e-81 259 36 6 427 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Acidiphilium cryptum (strain JF-5)
A5FT52 1.99e-81 259 36 6 427 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Acidiphilium cryptum (strain JF-5)
A9IMX7 2.28e-81 259 39 4 420 3 nhaA Na(+)/H(+) antiporter NhaA Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A8F302 3.93e-81 257 34 4 390 3 nhaA Na(+)/H(+) antiporter NhaA Rickettsia massiliae (strain Mtu5)
A7I1I1 4.01e-81 257 40 2 379 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A9H2L4 4.68e-81 256 40 3 384 3 nhaA Na(+)/H(+) antiporter NhaA Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q0RG46 2.9e-80 256 38 5 410 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8AA31 3.47e-80 256 37 4 435 3 nhaA Na(+)/H(+) antiporter NhaA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A5EUT7 7.92e-80 255 37 5 422 3 nhaA Na(+)/H(+) antiporter NhaA Dichelobacter nodosus (strain VCS1703A)
B2RLS8 9.07e-80 255 37 6 440 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q47MI6 1.53e-79 253 40 6 386 3 nhaA Na(+)/H(+) antiporter NhaA Thermobifida fusca (strain YX)
A4X422 1.89e-79 254 40 8 395 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q7MTR7 2.98e-79 254 37 6 440 3 nhaA Na(+)/H(+) antiporter NhaA Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A0LLE6 4.84e-79 254 37 4 423 3 nhaA Na(+)/H(+) antiporter NhaA Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A8M393 5.03e-78 250 40 8 393 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora arenicola (strain CNS-205)
Q0S8L7 2.19e-77 248 40 6 382 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Rhodococcus jostii (strain RHA1)
Q3A1R2 3.36e-77 248 40 7 431 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6LAI2 1.35e-76 247 37 7 442 3 nhaA Na(+)/H(+) antiporter NhaA Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8D666 1.41e-76 246 36 6 427 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Vibrio vulnificus (strain CMCP6)
A3PYK5 3.52e-76 246 41 9 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain JLS)
A1UF43 7.95e-76 244 41 9 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain KMS)
Q1B9W9 8.98e-76 244 41 9 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycobacterium sp. (strain MCS)
Q2Y8T1 3.5e-75 248 37 5 428 3 nhaA Na(+)/H(+) antiporter NhaA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1SRG6 1.35e-74 241 40 7 415 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1SRH4 4.21e-74 241 36 8 430 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A6W9V1 1.48e-73 239 40 8 380 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A1WCI8 1.6e-73 238 44 4 356 3 nhaA Na(+)/H(+) antiporter NhaA Acidovorax sp. (strain JS42)
Q12P61 1.69e-73 239 36 5 427 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q1CZI3 2.53e-73 239 41 3 389 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Myxococcus xanthus (strain DK1622)
Q15N95 4.9e-73 238 35 10 439 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
A1T7Y9 3.06e-72 236 40 6 387 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A8M1G0 5.61e-72 234 41 8 367 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Salinispora arenicola (strain CNS-205)
Q93F90 1.76e-71 234 41 6 377 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces antibioticus
A4X6R9 3.2e-71 232 43 7 359 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A4FCM4 7.59e-70 228 38 5 378 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q5Z2Z5 2.22e-69 227 39 7 383 3 nhaA Na(+)/H(+) antiporter NhaA Nocardia farcinica (strain IFM 10152)
A4TCS6 4.07e-69 227 39 8 389 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Mycolicibacterium gilvum (strain PYR-GCK)
A9WU27 7.05e-69 226 38 8 385 3 nhaA Na(+)/H(+) antiporter NhaA Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A4F6L1 1.8e-68 224 42 3 349 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q2J9U7 2.15e-68 225 42 7 375 3 nhaA Na(+)/H(+) antiporter NhaA Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q6AB77 1.06e-67 223 37 9 392 3 nhaA Na(+)/H(+) antiporter NhaA Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q92Y37 3.19e-67 222 38 6 420 3 nhaA Na(+)/H(+) antiporter NhaA Rhizobium meliloti (strain 1021)
A1SHU2 5.48e-67 226 35 5 411 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0QW18 7.42e-65 216 40 5 373 3 nhaA Na(+)/H(+) antiporter NhaA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0M0N2 1.59e-63 213 43 6 393 3 nhaA Na(+)/H(+) antiporter NhaA Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0JR38 4.75e-63 212 39 7 377 3 nhaA Na(+)/H(+) antiporter NhaA Arthrobacter sp. (strain FB24)
A4G6P0 1.03e-62 215 34 5 404 3 nhaA Na(+)/H(+) antiporter NhaA Herminiimonas arsenicoxydans
Q9X929 2e-62 211 41 6 377 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1R4H0 3.79e-62 209 38 7 391 3 nhaA Na(+)/H(+) antiporter NhaA Paenarthrobacter aurescens (strain TC1)
Q2VPW7 9.75e-62 208 34 10 407 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium breve (strain NCIMB 8807 / UCC2003)
A5CM04 1.03e-61 207 37 5 395 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q8G5R2 2e-61 208 35 11 408 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium longum (strain NCC 2705)
Q0SG15 4.11e-61 211 38 11 422 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Rhodococcus jostii (strain RHA1)
Q4UJQ7 5.38e-61 201 35 3 289 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q82EL6 1.57e-60 205 40 5 380 3 nhaA Na(+)/H(+) antiporter NhaA Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2IE76 5.57e-58 202 37 8 425 3 nhaA Na(+)/H(+) antiporter NhaA Anaeromyxobacter dehalogenans (strain 2CP-C)
A6W4F5 2.07e-57 196 38 6 379 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A1A0Y8 2.32e-57 197 35 9 394 3 nhaA Na(+)/H(+) antiporter NhaA Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q9S1X8 9.16e-57 194 40 6 356 3 nhaA1 Na(+)/H(+) antiporter NhaA 1/4 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8GU51 3.28e-55 186 37 1 261 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Sheila Smith)
B0BVP1 3.28e-55 186 37 1 261 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia rickettsii (strain Iowa)
Q7VFN1 3.75e-55 192 40 1 238 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q7VFN1 6.6e-22 100 40 2 137 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A8LVS8 8.49e-55 194 33 9 419 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Salinispora arenicola (strain CNS-205)
A1T2V5 1.07e-53 191 35 7 393 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A3PTR0 1.37e-53 190 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain JLS)
Q1BES7 5.77e-53 189 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain MCS)
A1UA55 5.77e-53 189 35 5 382 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycobacterium sp. (strain KMS)
A4T134 1.78e-51 184 33 4 388 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Mycolicibacterium gilvum (strain PYR-GCK)
Q9S2C8 7.81e-51 183 33 8 398 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A4X5I0 8.36e-49 178 33 7 410 3 nhaA3 Na(+)/H(+) antiporter NhaA 3 Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q0RHS2 9.64e-49 175 38 6 350 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A5CTB2 4.82e-48 171 38 8 360 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q0RPD5 2.02e-46 167 39 7 356 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q83MP1 5.3e-37 141 33 10 336 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain Twist)
Q83N58 5.58e-37 141 33 10 336 3 nhaA Na(+)/H(+) antiporter NhaA Tropheryma whipplei (strain TW08/27)
Q24V86 7.46e-30 122 32 16 393 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain Y51)
B8FPI3 7.46e-30 122 32 16 393 3 nhaA Na(+)/H(+) antiporter NhaA Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q28L40 9.78e-30 122 33 17 409 3 nhaA Na(+)/H(+) antiporter NhaA Jannaschia sp. (strain CCS1)
A8GYC5 4.03e-29 114 35 2 171 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain OSU 85-389)
Q74AP9 1.05e-28 118 30 12 363 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q39WP5 2.6e-28 117 33 9 306 3 nhaA Na(+)/H(+) antiporter NhaA Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1ATB4 3.41e-27 114 30 14 393 3 nhaA2 Na(+)/H(+) antiporter NhaA 2 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A5G6V8 1.3e-25 110 32 12 353 3 nhaA Na(+)/H(+) antiporter NhaA Geotalea uraniireducens (strain Rf4)
Q1RGL5 1.54e-22 95 40 0 106 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia bellii (strain RML369-C)
A1AK41 7.41e-22 99 32 15 389 3 nhaA1 Na(+)/H(+) antiporter NhaA 1 Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q92FX2 1.6e-19 87 34 1 135 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GQA2 1.45e-10 60 38 0 60 5 nhaA Putative Na(+)/H(+) antiporter NhaA homolog Rickettsia akari (strain Hartford)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_06470
Feature type CDS
Gene nhaA
Product Na+/H+ antiporter NhaA
Location 133013 - 134191 (strand: -1)
Length 1179 (nucleotides) / 392 (amino acids)
In genomic island -

Contig

Accession contig_6
Length 178871 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1196
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF06965 Na+/H+ antiporter 1

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3004 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Na+/H+ antiporter NhaA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03313 Na+:H+ antiporter, NhaA family - -

Protein Sequence

MTAIIRQFLKLEAAGGILLIIAALIALVMANTPLSALYQSFLDIPVAVKFAALEIDKPLLLWINDALMAIFFLVVGLEVKRELMTGSLAGRDKAMFPAIAALGGMIAPALVYLLFNGGDAAAAQGWAIPAATDIAFALGVMALLGKRVPTELKVFLLALAIIDDLGVIVIIALFYTKTVSLTALLLAALMVVVLCVMNWRNVSNTAAYMIAGLILWVCILKSGVHATLAGVIVGFLIPLRSKDGEHSPSEELEHVLHPWVAFLILPLFAFANAGVSVQGISFDALMGTLPLGILLGLFVGKPLGIFTACLISVKLGFAKLPERITLNQIFAVSVLCGIGFTMSIFIAGLAFTGLPEAFNTYSKLGILIGSTMAAVTGLFLLHSVLPKKTVRQ

Flanking regions ( +/- flanking 50bp)

GTTAATTGTTTGCATATTATTAACGCCGACAGTATTAAAGGAGTTAACCCATGACCGCAATTATCCGACAGTTCTTAAAACTCGAAGCCGCAGGCGGCATACTGCTGATTATCGCCGCGCTGATCGCGCTGGTAATGGCGAATACGCCGTTGTCGGCGTTGTATCAGTCGTTTCTTGATATTCCTGTTGCTGTAAAATTTGCGGCACTGGAAATTGATAAGCCCTTGTTATTATGGATTAATGACGCTCTGATGGCGATATTTTTCCTGGTCGTCGGGCTCGAAGTAAAAAGGGAGCTGATGACCGGCTCTCTGGCCGGGCGCGACAAAGCGATGTTTCCGGCAATTGCCGCACTCGGCGGTATGATAGCCCCGGCGCTGGTCTATCTGCTGTTTAACGGCGGGGATGCCGCTGCTGCACAGGGCTGGGCGATTCCGGCCGCAACCGATATTGCCTTTGCCCTCGGCGTAATGGCACTGCTGGGTAAAAGAGTACCGACAGAGCTGAAAGTCTTTCTGCTGGCACTGGCGATTATTGATGACCTCGGGGTTATCGTGATTATCGCGCTGTTTTACACCAAAACCGTTTCACTGACAGCGCTGCTGCTGGCGGCACTGATGGTGGTGGTATTGTGTGTGATGAACTGGCGTAATGTCAGCAACACCGCTGCGTATATGATTGCGGGGCTGATATTGTGGGTGTGTATTCTGAAATCCGGCGTGCACGCAACTCTGGCCGGAGTGATCGTCGGGTTCCTGATCCCGCTGCGCAGTAAAGATGGTGAGCACTCACCGTCAGAGGAGCTGGAGCATGTGCTGCATCCGTGGGTGGCGTTTCTGATCCTGCCGCTGTTTGCCTTTGCCAATGCCGGTGTCAGTGTTCAGGGAATTTCCTTTGATGCACTGATGGGCACACTGCCGCTGGGGATCCTGCTCGGTCTGTTTGTCGGTAAACCGCTGGGGATTTTCACCGCATGTCTGATTTCGGTAAAACTGGGCTTTGCAAAACTGCCGGAGAGGATTACTCTTAACCAGATATTCGCTGTATCGGTGTTATGCGGGATCGGTTTTACAATGTCTATCTTTATCGCGGGACTGGCATTTACCGGGCTTCCGGAAGCATTTAACACCTACTCCAAGCTGGGAATTCTGATTGGTTCCACTATGGCGGCAGTTACCGGGTTGTTCCTGCTCCATTCCGTGTTACCGAAGAAAACAGTCCGGCAGTAATCCGTTATTCACCGGCCTCCGCGGCCGGTGAATACAACAGAATTTCCGAG