Homologs in group_2105

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15840 FBDBKF_15840 100.0 Morganella morganii S1 cyoA cytochrome o ubiquinol oxidase subunit II
EHELCC_18440 EHELCC_18440 100.0 Morganella morganii S2 cyoA cytochrome o ubiquinol oxidase subunit II
LHKJJB_17385 LHKJJB_17385 100.0 Morganella morganii S3 cyoA cytochrome o ubiquinol oxidase subunit II
HKOGLL_17010 HKOGLL_17010 100.0 Morganella morganii S5 cyoA cytochrome o ubiquinol oxidase subunit II
F4V73_RS16470 F4V73_RS16470 90.2 Morganella psychrotolerans cyoA cytochrome o ubiquinol oxidase subunit II
PMI_RS00520 PMI_RS00520 79.0 Proteus mirabilis HI4320 cyoA cytochrome o ubiquinol oxidase subunit II

Distribution of the homologs in the orthogroup group_2105

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2105

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABJ1 6.77e-140 400 62 1 310 1 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli (strain K12)
P0ABJ2 6.77e-140 400 62 1 310 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I427 1.23e-124 362 63 3 277 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WWR1 1.23e-114 337 56 5 312 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas putida
P57544 1.37e-100 300 50 2 283 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P50653 2.93e-96 290 50 6 287 3 cyaB Ubiquinol oxidase subunit 2 Acetobacter aceti
Q8K993 6.62e-96 288 48 1 277 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AA3 4.27e-91 276 49 1 271 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q81HT3 1.67e-52 177 40 5 240 1 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73DE0 1.98e-52 177 40 5 240 3 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81V01 1.98e-52 177 40 5 240 3 qoxA Quinol oxidase subunit 2 Bacillus anthracis
E0TW67 7.58e-51 174 39 6 240 1 qoxA Quinol oxidase subunit 2 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
P34957 3.76e-50 172 39 6 240 1 qoxA Quinol oxidase subunit 2 Bacillus subtilis (strain 168)
Q4L565 5.7e-44 157 35 6 258 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus haemolyticus (strain JCSC1435)
Q8CPP6 2.22e-43 155 36 6 246 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA9 2.22e-43 155 36 6 246 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A181 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MW2)
Q6GAF2 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MSSA476)
Q6GI23 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MRSA252)
Q7A698 2.95e-41 150 35 5 245 1 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain N315)
Q99V36 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HH23 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain COL)
Q2FZJ9 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI17 2.95e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain USA300)
Q2YX14 3.27e-41 150 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q49WI4 4.13e-38 142 32 7 251 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q04441 1.46e-23 102 30 9 255 1 ctaC Cytochrome c oxidase subunit 2 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q03438 8.1e-14 74 28 8 243 1 ctaC Cytochrome c oxidase subunit 2 Bacillus sp. (strain PS3)
Q06474 2.95e-09 60 31 2 117 3 ctaC Cytochrome c oxidase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1RI44 1.12e-08 58 30 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia bellii (strain RML369-C)
P48171 1.27e-08 58 23 8 207 3 mt-co2 Cytochrome c oxidase subunit 2 Oncorhynchus mykiss
Q37677 1.81e-08 57 24 9 208 3 mt-co2 Cytochrome c oxidase subunit 2 Salmo salar
O78682 2.8e-08 57 25 10 208 3 mt-co2 Cytochrome c oxidase subunit 2 Carassius auratus
Q96183 3.17e-08 57 23 8 223 3 mt-co2 Cytochrome c oxidase subunit 2 Polypterus ornatipinnis
P24987 3.2e-08 57 25 10 208 3 mt-co2 Cytochrome c oxidase subunit 2 Cyprinus carpio
Q92I65 3.3e-08 57 29 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULU3 3.39e-08 57 29 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P18944 6.05e-08 55 23 5 172 3 MT-CO2 Cytochrome c oxidase subunit 2 Gallus gallus
P50684 1.23e-07 55 24 7 173 3 MT-CO2 Cytochrome c oxidase subunit 2 Coturnix japonica
P98054 1.25e-07 55 30 4 123 3 ctaC Cytochrome c oxidase subunit 2 Thermostichus vulcanus
P50662 1.44e-07 55 22 9 218 3 MT-CO2 Cytochrome c oxidase subunit 2 Cratogeomys castanops
P24011 1.47e-07 55 25 8 243 3 ctaC Cytochrome c oxidase subunit 2 Bacillus subtilis (strain 168)
Q9MIY7 1.51e-07 54 23 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Danio rerio
P98033 1.55e-07 54 22 4 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Eulemur macaco
Q37604 1.79e-07 54 26 7 179 3 MT-CO2 Cytochrome c oxidase subunit 2 Petromyzon marinus
Q9ZDC6 2.04e-07 55 28 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia prowazekii (strain Madrid E)
Q37741 2.51e-07 54 24 10 208 3 mt-co2 Cytochrome c oxidase subunit 2 Gadus morhua
Q9ZZ51 3.08e-07 53 23 9 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Squalus acanthias
O47870 3.35e-07 53 23 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Alligator mississippiensis
P50666 4.61e-07 53 22 5 179 3 MT-CO2 Cytochrome c oxidase subunit 2 Cairina moschata
P11948 5.11e-07 53 25 4 159 2 MT-CO2 Cytochrome c oxidase subunit 2 Macaca fascicularis
P98020 5.16e-07 53 25 3 160 3 MT-CO2 Cytochrome c oxidase subunit 2 Cercocebus galeritus
P98037 5.77e-07 53 23 5 197 3 MT-CO2 Cytochrome c oxidase subunit 2 Mandrillus leucophaeus
Q9B8D8 6.88e-07 53 23 8 228 3 COX2 Cytochrome c oxidase subunit 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q4JQI4 8.16e-07 52 22 9 209 3 mt-co2 Cytochrome c oxidase subunit 2 Tetraodon nigroviridis
Q37691 8.55e-07 52 19 8 212 3 MT-CO2 Cytochrome c oxidase subunit 2 Tachyoryctes splendens
O79404 1.4e-06 52 23 9 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Scyliorhinus canicula
P68298 1.74e-06 51 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio hamadryas
P68297 1.74e-06 51 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio anubis
P98044 1.84e-06 51 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Theropithecus gelada
P50685 2e-06 51 20 9 215 3 MT-CO2 Cytochrome c oxidase subunit 2 Cratogeomys bursarius
P25312 2.1e-06 51 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Symphalangus syndactylus
P50690 2.14e-06 51 26 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan troglodytes
P98032 2.26e-06 51 22 4 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Daubentonia madagascariensis
Q96127 2.28e-06 51 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylobates lar
P50692 2.5e-06 51 22 8 210 3 COII Cytochrome c oxidase subunit 2 Aedes aegypti
P26457 2.53e-06 51 26 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan paniscus
P00403 2.53e-06 51 25 4 159 1 MT-CO2 Cytochrome c oxidase subunit 2 Homo sapiens
Q37605 2.77e-06 51 23 3 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Pongo pygmaeus
P26455 2.99e-06 50 24 3 158 3 MT-CO2 Cytochrome c oxidase subunit 2 Chlorocebus aethiops
P50687 3.37e-06 50 21 8 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Dasypus novemcinctus
Q8W9N3 3.47e-06 50 20 8 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Dugong dugon
P98038 3.74e-06 50 27 1 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Macaca mulatta
P26456 4.18e-06 50 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla gorilla
O03895 4.36e-06 50 21 4 164 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Tinamus major
P34189 4.5e-06 50 22 6 172 3 mt-co2 Cytochrome c oxidase subunit 2 Formosania lacustris
O03889 4.98e-06 50 22 5 172 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Apteryx australis
Q38RZ2 4.99e-06 50 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys bartelsii
P50679 5.18e-06 50 20 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Damaliscus pygargus phillipsi
P20375 5.23e-06 50 25 2 129 3 COII Cytochrome c oxidase subunit 2 Apis mellifera ligustica
P98035 5.28e-06 50 26 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemur catta
P92662 5.48e-06 50 21 8 212 3 MT-CO2 Cytochrome c oxidase subunit 2 Osphranter robustus
O03891 5.58e-06 49 21 5 172 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Dromaius novaehollandiae
O03890 5.58e-06 49 21 5 172 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Casuarius bennetti
Q38S23 5.63e-06 50 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Batomys granti
P48660 5.9e-06 50 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus caballus
Q38S47 6.36e-06 50 20 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Lophuromys flavopunctatus
P98019 6.53e-06 50 21 5 179 3 MT-CO2 Cytochrome c oxidase subunit 2 Anas platyrhynchos
Q37472 6.78e-06 50 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla beringei
P98047 7.38e-06 49 25 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Varecia variegata
Q37545 7.87e-06 49 22 4 170 3 COII Cytochrome c oxidase subunit 2 Lumbricus terrestris
P92478 8.1e-06 49 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus asinus
Q38S38 8.33e-06 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Anisomys imitator
P50267 8.34e-06 49 24 2 131 3 COII Cytochrome c oxidase subunit 2 Apis florea
P29163 8.86e-06 49 24 7 211 3 None Cytochrome c oxidase subunit 2 Pneumocystis carinii
P98039 8.97e-06 49 20 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Nycticebus coucang
P98034 9.05e-06 49 29 1 85 3 MT-CO2 Cytochrome c oxidase subunit 2 Hapalemur griseus
Q37595 9.23e-06 49 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Perognathus flavus
Q38S11 9.48e-06 49 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Hybomys univittatus
Q38RZ7 9.84e-06 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacomys longipes
O47670 9.84e-06 49 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Chrysocyon brachyurus
P93285 1.04e-05 49 20 5 216 1 COX2 Cytochrome c oxidase subunit 2 Arabidopsis thaliana
Q38RY9 1.06e-05 49 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys surifer
Q38S20 1.12e-05 49 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Berylmys bowersi
Q37685 1.34e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Tragelaphus imberbis
O21400 1.37e-05 48 22 5 172 3 MT-CO2 Cytochrome c oxidase subunit 2 Struthio camelus
P92693 1.44e-05 48 27 1 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Pongo abelii
P98046 1.44e-05 48 28 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Carlito syrichta
Q2Y0B9 1.52e-05 48 21 7 214 3 MT-CO2 Cytochrome c oxidase subunit 2 Ailuropoda melanoleuca
O47679 1.57e-05 48 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Speothos venaticus
P50268 1.64e-05 48 24 2 129 3 COII Cytochrome c oxidase subunit 2 Apis koschevnikovi
O79417 1.66e-05 48 23 6 205 3 COII Cytochrome c oxidase subunit 2 Branchiostoma lanceolatum
Q38S08 1.75e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylomyscus parvus
P50673 1.78e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus sylvaticus
Q38RU1 1.8e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Zelotomys hildegardeae
Q37684 1.82e-05 48 28 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Tupaia glis
Q37548 1.85e-05 48 21 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Macrotus californicus
Q38S00 1.85e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Leopoldamys sabanus
P24988 1.9e-05 48 18 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Microtus pennsylvanicus
O47672 1.9e-05 48 21 7 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Cerdocyon thous
Q38RY0 1.94e-05 48 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Oenomys hypoxanthus
P29859 1.97e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila bifasciata
Q38S62 2.03e-05 48 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillus gerbillus
P98027 2.09e-05 48 20 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Cheirogaleus medius
Q38S29 2.09e-05 48 19 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus semotus
Q37643 2.36e-05 48 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinolophus darlingi
Q37476 2.42e-05 48 21 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillurus vallinus
O47428 2.46e-05 48 23 6 205 3 COII Cytochrome c oxidase subunit 2 Branchiostoma floridae
Q7IKU8 2.49e-05 48 20 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Microcebus tavaratra
Q38RV3 2.54e-05 48 19 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhynchomys isarogensis
P00406 2.54e-05 48 19 7 211 1 Mt-co2 Cytochrome c oxidase subunit 2 Rattus norvegicus
Q38S14 2.54e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Dacnomys millardi
Q38RU7 2.61e-05 48 18 7 214 3 MT-CO2 Cytochrome c oxidase subunit 2 Sundamys muelleri
O03893 2.66e-05 47 20 4 164 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Rhea americana
Q37430 2.76e-05 48 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Capra hircus
Q38S56 2.89e-05 48 19 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbilliscus robustus
Q38S26 2.89e-05 48 20 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Arvicanthis somalicus
Q38RX1 2.94e-05 48 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys jacksoni
P84287 3.13e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila azteca
P84202 3.13e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila athabasca
P84201 3.13e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila algonquin
Q85TA0 3.13e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila affinis
Q38RY6 3.14e-05 48 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Niviventer culturatus
P50683 3.17e-05 47 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Cavia aperea
P50688 3.2e-05 47 20 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 Galago senegalensis
P67799 3.22e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila pseudoobscura pseudoobscura
P67798 3.22e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila persimilis
P67797 3.22e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila miranda
O47673 3.26e-05 47 21 7 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes zerda
P29856 3.28e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila ambigua
Q9ZZY8 3.32e-05 47 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Hippopotamus amphibius
P29860 3.34e-05 47 20 6 214 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila lowei
P00405 3.35e-05 47 19 7 211 1 Mtco2 Cytochrome c oxidase subunit 2 Mus musculus
Q38S50 3.54e-05 47 19 7 214 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys ignitus
Q38S35 3.61e-05 47 19 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus mystacinus
P98043 3.64e-05 47 27 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Cephalopachus bancanus
Q38RW8 3.75e-05 47 19 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys taitae
P00407 3.84e-05 47 22 8 206 3 mt-co2 Cytochrome c oxidase subunit 2 Xenopus laevis
O03848 4.01e-05 47 21 8 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Latimeria chalumnae
Q7IZ16 4.19e-05 47 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias bulleri
P98021 4.25e-05 47 19 5 180 3 COII Cytochrome c oxidase subunit 2 Simulium vittatum
P98049 4.39e-05 47 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Oryctolagus cuniculus
Q38RV6 4.43e-05 47 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhabdomys pumilio
P67796 4.67e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila tolteca
P67795 4.67e-05 47 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila narragansett
Q37369 5.13e-05 47 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Antilocapra americana
O79549 5.32e-05 47 23 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycodon semicarinatus
O03892 5.52e-05 47 20 4 164 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Nothoprocta perdicaria
P98042 5.63e-05 47 28 1 85 3 MT-CO2 Cytochrome c oxidase subunit 2 Propithecus tattersalli
Q37596 5.74e-05 47 20 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Phyllostomus hastatus
Q38S65 5.74e-05 47 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Desmodillus auricularis
Q3T4C0 5.78e-05 47 24 9 212 3 cox2 Cytochrome c oxidase subunit 2 Zancudomyces culisetae
P33505 6.17e-05 47 20 5 177 3 COXII Cytochrome c oxidase subunit 2 Anopheles quadrimaculatus
Q9G5S9 6.41e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias quadrimaculatus
Q9G185 6.47e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias townsendii
Q9G1N5 6.53e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias rufus
Q7IZ08 6.53e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias merriami
O03851 6.71e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Ceratotherium simum
Q9G0U1 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias sonomae
Q7IZ01 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias palmeri
Q7IZ11 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias dorsalis
Q7IZ14 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias cinereicollis
Q7IZ15 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias canipes
Q7IZ21 6.84e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias amoenus
O78750 6.9e-05 47 19 7 211 1 MT-CO2 Cytochrome c oxidase subunit 2 Ovis aries
P50691 7.43e-05 47 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Sciurus carolinensis
P05490 7.44e-05 47 20 5 221 3 COX2 Cytochrome c oxidase subunit 2 Oenothera berteroana
P43376 8.12e-05 47 23 8 212 3 COX2 Cytochrome c oxidase subunit 2 Lachancea thermotolerans (strain ATCC 56472 / CBS 6340 / NRRL Y-8284)
Q38RU4 8.38e-05 46 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Uromys caudimaculatus
Q38S02 8.46e-05 46 18 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemniscomys barbarus
Q38S05 8.54e-05 46 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Leggadina forresti
P50672 8.94e-05 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys wilsoni
Q38RW5 9.11e-05 46 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys tullbergi
P41311 9.14e-05 46 19 8 213 3 MT-CO2 Cytochrome c oxidase subunit 2 Didelphis virginiana
Q96190 9.45e-05 46 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinoceros unicornis
Q37649 0.000107 46 20 5 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Rousettus leschenaultii
Q38S17 0.000117 46 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Conilurus penicillatus
P20387 0.00014 46 24 7 183 3 COX2 Cytochrome c oxidase subunit 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P34840 0.000155 45 20 5 177 3 COII Cytochrome c oxidase subunit 2 Anopheles gambiae
Q38S41 0.000163 45 19 7 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Micaelamys namaquensis
Q3L6W7 0.000168 45 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Ailurus fulgens
Q9YDX7 0.000176 45 22 8 222 3 aoxA Heme-copper oxidase subunit 2 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q37419 0.000184 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Boselaphus tragocamelus
Q37547 0.0002 45 19 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacothrix typica
P00410 0.000209 45 24 7 183 1 COX2 Cytochrome c oxidase subunit 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P50680 0.000211 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Gazella spekei
Q9G2X2 0.000222 45 19 4 197 3 MT-CO2 Cytochrome c oxidase subunit 2 Myxine glutinosa
P47918 0.000223 45 20 6 214 3 COX2 Cytochrome c oxidase subunit 2 Cyberlindnera mrakii
P06029 0.000228 45 21 7 210 3 COX2 Cytochrome c oxidase subunit 2 Cyberlindnera saturnus
Q9XLW8 0.000229 45 22 8 212 3 COX2 Cytochrome c oxidase subunit 2 Lachancea kluyveri (strain ATCC 58438 / CBS 3082 / BCRC 21498 / NBRC 1685 / JCM 7257 / NCYC 543 / NRRL Y-12651)
Q38S59 0.000231 45 26 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Meriones shawi
P08306 0.000239 45 22 7 215 1 ctaC Cytochrome c oxidase subunit 2 Paracoccus denitrificans
Q2I3H1 0.000245 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Elephas maximus
Q38PR9 0.000256 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Mammuthus primigenius
P29865 0.00026 45 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila subobscura
Q9TA26 0.000265 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Loxodonta africana
P68530 0.000266 45 25 1 88 1 MT-CO2 Cytochrome c oxidase subunit 2 Bos taurus
P68554 0.000266 45 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos mutus grunniens
P68553 0.000266 45 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos indicus
P50678 0.000289 45 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bubalus depressicornis
P48890 0.000292 45 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Felis catus
P26857 0.000295 45 22 6 196 3 COX2 Cytochrome c oxidase subunit 2 Marchantia polymorpha
Q38S53 0.000303 45 20 2 129 3 MT-CO2 Cytochrome c oxidase subunit 2 Taterillus emini
O47674 0.000303 45 20 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycaon pictus
P50675 0.000323 45 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Syncerus caffer
P68294 0.000338 44 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos javanicus
P68295 0.000338 44 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos gaurus
P68296 0.000338 44 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bison bonasus
Q37416 0.000361 44 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Bison bison
O47678 0.000388 44 22 2 131 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex sechurae
O79673 0.000394 44 21 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Pelomedusa subrufa
O48276 0.00041 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Urocyon cinereoargenteus
Q7J6G4 0.00041 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Atelocynus microtis
P43370 0.000413 44 24 3 137 3 COX2 Cytochrome c oxidase subunit 2 Brettanomyces custersianus
Q539C6 0.000418 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes corsac
O47680 0.00043 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes macrotis
O47681 0.000434 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes vulpes
Q7J6G2 0.000438 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex vetulus
O48267 0.000438 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex griseus
P29880 0.000452 44 20 6 212 3 COII Cytochrome c oxidase subunit 2 Sympetrum striolatum
O47676 0.000454 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex culpaeus
Q599A0 0.000467 44 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera borealis
P38596 0.000475 44 27 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Halichoerus grypus
P41294 0.000475 44 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera musculus
P50686 0.000498 44 22 2 129 3 MT-CO2 Cytochrome c oxidase subunit 2 Galeopterus variegatus
P98031 0.000502 44 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis simensis
P00409 0.00052 44 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila yakuba
P24986 0.000546 44 22 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera physalus
A6H4Q5 0.000569 44 21 6 191 3 COX2 Cytochrome c oxidase subunit 2 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P50253 0.000581 44 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila simulans
P67782 0.000627 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis lupus
P67780 0.000627 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis lupus familiaris
P67781 0.000627 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis latrans
O47669 0.000656 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis aureus
P00408 0.000673 43 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila melanogaster
O47668 0.000675 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Cuon alpinus
O47671 0.000687 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis mesomelas elongae
P50667 0.000731 43 22 2 121 1 MT-CO2 Cytochrome c oxidase subunit 2 Sus scrofa
O47677 0.000733 43 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex gymnocercus
Q37440 0.00076 43 25 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Rusa unicolor
O47675 0.000796 43 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Nyctereutes procyonoides
P48871 0.000834 43 20 6 210 3 COX2 Cytochrome c oxidase subunit 2 Wickerhamomyces canadensis
O47667 0.001 43 26 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis adustus
A9RAG1 0.001 43 19 5 181 3 COX2 Cytochrome c oxidase subunit 2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_17275
Feature type CDS
Gene cyoA
Product cytochrome o ubiquinol oxidase subunit II
Location 5264 - 6214 (strand: -1)
Length 951 (nucleotides) / 316 (amino acids)

Contig

Accession ZDB_536
Length 56187 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2105
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00116 Cytochrome C oxidase subunit II, periplasmic domain
PF06481 COX Aromatic Rich Motif

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1622 Energy production and conversion (C) C Heme/copper-type cytochrome/quinol oxidase, subunit 2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02297 cytochrome o ubiquinol oxidase subunit II [EC:7.1.1.3] Oxidative phosphorylation
Metabolic pathways
Cytochrome o ubiquinol oxidase

Protein Sequence

MNYKKSIGVISLLASALLLGGCDMALMNPKGTIGAEQKTLILTAIGLMLIVVIPVIIMAIVFALRYRETRKATYRPDWAHSNKIELVVWTVPIIIILILGTITWKTTHELDPYKPLVSDQEPVTIQVISMDWKWLFIYPDQGIATVNEIAFPVGVPVNFKITSDSVMNSFFIPQLGGQIYAMAGMQTKLHLIAEEPGVYKGISASYSGHGFSDMKFTATATPTREAFDEWVAKVKASPDTLTTTVAFDALAKPSVNNPVVYFSAVKPNLFVDTINKFGHSGHGAGKTHEGESHSMMNMSADEHSSHMPAAHAGNEG

Flanking regions ( +/- flanking 50bp)

CGACAAGAGTACTTGAGTACCTTTGTTTTTGGGGTCGTTGGATGAGACTTATGAACTACAAAAAGAGTATTGGGGTAATCTCGCTGCTCGCATCTGCACTTTTGCTGGGCGGATGCGATATGGCACTGATGAACCCGAAAGGCACTATCGGTGCTGAGCAAAAAACACTGATTTTAACCGCCATTGGTCTGATGCTCATTGTGGTTATTCCGGTCATTATCATGGCAATCGTTTTTGCCCTGCGTTACCGGGAAACCAGAAAAGCAACTTACCGTCCTGACTGGGCGCATTCCAATAAAATCGAGCTGGTCGTCTGGACTGTTCCGATCATTATCATTCTGATCCTGGGTACCATTACATGGAAAACCACCCATGAGCTGGATCCGTACAAGCCGCTGGTCAGTGACCAGGAGCCAGTCACCATCCAGGTTATCTCAATGGACTGGAAATGGTTATTTATCTATCCGGATCAAGGCATTGCCACTGTCAATGAGATCGCATTCCCTGTCGGTGTTCCTGTCAATTTCAAAATCACCTCTGATTCTGTGATGAACTCGTTTTTCATCCCGCAGTTAGGCGGCCAGATTTATGCGATGGCAGGTATGCAGACCAAACTGCATCTGATTGCGGAAGAGCCGGGCGTGTACAAAGGCATTTCTGCCAGCTACAGCGGACACGGTTTCTCTGACATGAAATTTACCGCCACTGCCACCCCGACACGCGAAGCCTTCGATGAGTGGGTTGCGAAGGTGAAAGCCTCACCGGACACCCTGACCACCACCGTAGCGTTTGACGCACTGGCAAAACCGAGTGTGAACAACCCGGTTGTCTATTTCTCCGCTGTCAAACCAAACCTGTTTGTGGACACCATTAACAAATTTGGTCACAGCGGCCACGGTGCCGGGAAGACACACGAAGGCGAAAGCCATTCAATGATGAACATGAGCGCAGATGAACACAGCAGCCATATGCCTGCAGCTCATGCCGGGAATGAGGGGTAAAGCATGTTCGGAAAATTAACACTGGATGCCATCCCCCTGCATGAGCCTAT