Homologs in group_2105

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15840 FBDBKF_15840 79.0 Morganella morganii S1 cyoA cytochrome o ubiquinol oxidase subunit II
EHELCC_18440 EHELCC_18440 79.0 Morganella morganii S2 cyoA cytochrome o ubiquinol oxidase subunit II
NLDBIP_17275 NLDBIP_17275 79.0 Morganella morganii S4 cyoA cytochrome o ubiquinol oxidase subunit II
LHKJJB_17385 LHKJJB_17385 79.0 Morganella morganii S3 cyoA cytochrome o ubiquinol oxidase subunit II
HKOGLL_17010 HKOGLL_17010 79.0 Morganella morganii S5 cyoA cytochrome o ubiquinol oxidase subunit II
F4V73_RS16470 F4V73_RS16470 76.5 Morganella psychrotolerans cyoA cytochrome o ubiquinol oxidase subunit II

Distribution of the homologs in the orthogroup group_2105

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2105

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABJ1 2.65e-154 437 67 1 314 1 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli (strain K12)
P0ABJ2 2.65e-154 437 67 1 314 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I427 1.04e-126 368 60 4 297 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WWR1 2.36e-118 346 56 5 318 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas putida
P50653 1.72e-106 315 54 5 287 3 cyaB Ubiquinol oxidase subunit 2 Acetobacter aceti
P57544 2.14e-104 310 52 0 271 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K993 6.87e-101 301 50 0 269 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AA3 1.04e-97 292 49 0 279 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
E0TW67 2.07e-53 180 38 6 249 1 qoxA Quinol oxidase subunit 2 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
Q81HT3 6.56e-53 178 39 4 247 1 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73DE0 1.32e-52 177 39 4 247 3 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81V01 1.32e-52 177 39 4 247 3 qoxA Quinol oxidase subunit 2 Bacillus anthracis
P34957 2.09e-52 177 38 6 249 1 qoxA Quinol oxidase subunit 2 Bacillus subtilis (strain 168)
Q4L565 1.22e-47 167 37 7 259 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus haemolyticus (strain JCSC1435)
Q8CPP6 2.25e-42 153 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA9 2.25e-42 153 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q2YX14 2.88e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A181 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MW2)
Q6GAF2 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MSSA476)
Q6GI23 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MRSA252)
Q7A698 2.95e-41 150 37 6 240 1 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain N315)
Q99V36 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HH23 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain COL)
Q2FZJ9 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI17 2.95e-41 150 37 6 240 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain USA300)
Q49WI4 3.14e-41 150 34 6 239 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q04441 2.68e-23 101 31 11 260 1 ctaC Cytochrome c oxidase subunit 2 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q03438 8.92e-15 77 28 7 238 1 ctaC Cytochrome c oxidase subunit 2 Bacillus sp. (strain PS3)
P24011 5.43e-10 63 26 7 244 3 ctaC Cytochrome c oxidase subunit 2 Bacillus subtilis (strain 168)
Q06474 5.51e-10 63 23 5 237 3 ctaC Cytochrome c oxidase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1RI44 2.3e-08 57 28 4 151 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia bellii (strain RML369-C)
Q4ULU3 7.06e-08 56 26 3 142 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P18944 7.37e-08 55 23 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 Gallus gallus
Q92I65 1.39e-07 55 26 3 139 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O78682 2.83e-07 53 23 7 208 3 mt-co2 Cytochrome c oxidase subunit 2 Carassius auratus
Q96183 3.39e-07 53 23 8 216 3 mt-co2 Cytochrome c oxidase subunit 2 Polypterus ornatipinnis
Q9ZDC6 3.63e-07 54 27 3 136 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia prowazekii (strain Madrid E)
P24987 4.04e-07 53 24 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Cyprinus carpio
P50684 6.4e-07 53 23 6 176 3 MT-CO2 Cytochrome c oxidase subunit 2 Coturnix japonica
O47870 6.77e-07 52 23 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Alligator mississippiensis
Q9MIY7 1.09e-06 52 23 7 208 3 mt-co2 Cytochrome c oxidase subunit 2 Danio rerio
Q37604 1.31e-06 52 26 6 179 3 MT-CO2 Cytochrome c oxidase subunit 2 Petromyzon marinus
Q37677 1.64e-06 52 23 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Salmo salar
P98032 2.02e-06 51 22 5 177 3 MT-CO2 Cytochrome c oxidase subunit 2 Daubentonia madagascariensis
P50662 2.18e-06 51 22 8 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Cratogeomys castanops
P48171 2.28e-06 51 23 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Oncorhynchus mykiss
P50666 2.55e-06 51 22 5 183 3 MT-CO2 Cytochrome c oxidase subunit 2 Cairina moschata
P98019 2.75e-06 51 22 5 183 3 MT-CO2 Cytochrome c oxidase subunit 2 Anas platyrhynchos
Q37741 3.7e-06 50 22 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Gadus morhua
P98033 3.92e-06 50 22 4 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Eulemur macaco
O21400 6e-06 50 22 5 184 3 MT-CO2 Cytochrome c oxidase subunit 2 Struthio camelus
Q4JQI4 7.43e-06 49 21 8 208 3 mt-co2 Cytochrome c oxidase subunit 2 Tetraodon nigroviridis
Q9ZZ51 7.71e-06 49 21 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Squalus acanthias
O03895 1.04e-05 48 22 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Tinamus major
P26457 1.05e-05 49 25 4 184 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan paniscus
P98020 1.25e-05 49 24 3 158 3 MT-CO2 Cytochrome c oxidase subunit 2 Cercocebus galeritus
P34189 1.35e-05 48 22 6 172 3 mt-co2 Cytochrome c oxidase subunit 2 Formosania lacustris
O03892 1.44e-05 48 21 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Nothoprocta perdicaria
P11948 1.61e-05 48 23 3 157 2 MT-CO2 Cytochrome c oxidase subunit 2 Macaca fascicularis
O03889 2.18e-05 48 22 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Apteryx australis
P50692 2.19e-05 48 20 7 211 3 COII Cytochrome c oxidase subunit 2 Aedes aegypti
P25312 2.31e-05 48 24 3 149 3 MT-CO2 Cytochrome c oxidase subunit 2 Symphalangus syndactylus
Q38RZ2 2.42e-05 48 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys bartelsii
O03891 2.56e-05 47 21 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Dromaius novaehollandiae
O03890 2.56e-05 47 21 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Casuarius bennetti
P98037 2.61e-05 48 24 3 157 3 MT-CO2 Cytochrome c oxidase subunit 2 Mandrillus leucophaeus
Q96127 2.86e-05 48 24 3 149 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylobates lar
P50690 3.06e-05 48 25 4 184 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan troglodytes
Q9TA26 3.38e-05 47 24 3 134 3 MT-CO2 Cytochrome c oxidase subunit 2 Loxodonta africana
P00403 3.68e-05 47 24 3 149 1 MT-CO2 Cytochrome c oxidase subunit 2 Homo sapiens
O79404 3.8e-05 47 21 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Scyliorhinus canicula
Q37472 3.89e-05 47 24 4 160 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla beringei
P98044 4.15e-05 47 24 3 157 3 MT-CO2 Cytochrome c oxidase subunit 2 Theropithecus gelada
O47670 4.43e-05 47 23 5 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Chrysocyon brachyurus
P26456 4.81e-05 47 23 4 160 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla gorilla
O47679 4.99e-05 47 23 5 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Speothos venaticus
Q38S23 5.18e-05 47 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Batomys granti
Q8W9N3 5.74e-05 47 20 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Dugong dugon
O03893 6.12e-05 46 20 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Rhea americana
Q38S47 6.29e-05 47 21 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Lophuromys flavopunctatus
P68298 6.71e-05 47 23 3 157 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio hamadryas
P68297 6.71e-05 47 23 3 157 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio anubis
P98035 6.78e-05 47 26 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemur catta
Q2I3H1 7.43e-05 47 24 3 132 3 MT-CO2 Cytochrome c oxidase subunit 2 Elephas maximus
Q38PR9 7.57e-05 47 24 3 132 3 MT-CO2 Cytochrome c oxidase subunit 2 Mammuthus primigenius
P33505 7.84e-05 46 21 6 219 3 COXII Cytochrome c oxidase subunit 2 Anopheles quadrimaculatus
Q37605 7.86e-05 46 22 2 157 3 MT-CO2 Cytochrome c oxidase subunit 2 Pongo pygmaeus
P98054 7.86e-05 47 27 5 118 3 ctaC Cytochrome c oxidase subunit 2 Thermostichus vulcanus
P50687 7.93e-05 46 22 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Dasypus novemcinctus
O47672 8.15e-05 46 23 5 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Cerdocyon thous
P00407 8.35e-05 46 22 8 206 3 mt-co2 Cytochrome c oxidase subunit 2 Xenopus laevis
P98047 8.54e-05 46 25 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Varecia variegata
Q9B8D8 8.64e-05 47 21 7 202 3 COX2 Cytochrome c oxidase subunit 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q38RZ7 0.000105 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacomys longipes
Q9YDX7 0.000106 46 25 6 167 3 aoxA Heme-copper oxidase subunit 2 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q38S20 0.000108 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Berylmys bowersi
Q37706 0.000114 46 25 5 160 3 COII Cytochrome c oxidase subunit 2 Artemia franciscana
Q38S38 0.000116 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Anisomys imitator
O47673 0.000117 46 23 5 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes zerda
P98034 0.000118 46 25 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Hapalemur griseus
Q38RY9 0.000126 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys surifer
Q37643 0.000132 46 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinolophus darlingi
P26455 0.000133 46 23 3 156 3 MT-CO2 Cytochrome c oxidase subunit 2 Chlorocebus aethiops
Q38RY0 0.000134 46 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Oenomys hypoxanthus
Q38RY6 0.000134 46 21 7 188 3 MT-CO2 Cytochrome c oxidase subunit 2 Niviventer culturatus
Q37476 0.000142 45 21 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillurus vallinus
P50673 0.000147 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus sylvaticus
Q38S08 0.00015 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylomyscus parvus
Q2Y0B9 0.000151 45 22 7 188 3 MT-CO2 Cytochrome c oxidase subunit 2 Ailuropoda melanoleuca
Q38S14 0.00016 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Dacnomys millardi
Q38RU7 0.000162 45 19 6 187 3 MT-CO2 Cytochrome c oxidase subunit 2 Sundamys muelleri
P00406 0.000162 45 20 5 170 1 Mt-co2 Cytochrome c oxidase subunit 2 Rattus norvegicus
Q38S56 0.000162 45 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbilliscus robustus
Q38RU1 0.000174 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Zelotomys hildegardeae
Q38S50 0.000177 45 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys ignitus
Q38S35 0.000179 45 20 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus mystacinus
P24988 0.000181 45 19 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Microtus pennsylvanicus
Q38S00 0.000181 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Leopoldamys sabanus
P50672 0.000181 45 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys wilsoni
P29859 0.000181 45 19 6 211 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila bifasciata
Q38S62 0.000182 45 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillus gerbillus
P98039 0.000186 45 20 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 Nycticebus coucang
Q38S17 0.000196 45 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Conilurus penicillatus
Q38S26 0.000198 45 28 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Arvicanthis somalicus
P50688 0.000202 45 22 5 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Galago senegalensis
P00405 0.000207 45 20 5 170 1 Mtco2 Cytochrome c oxidase subunit 2 Mus musculus
P50683 0.000211 45 28 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Cavia aperea
Q38RV6 0.000215 45 20 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhabdomys pumilio
Q38S11 0.000215 45 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Hybomys univittatus
Q38RV3 0.000238 45 19 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhynchomys isarogensis
P48660 0.00024 45 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus caballus
P29860 0.000242 45 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila lowei
Q37547 0.000245 45 21 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacothrix typica
P29865 0.00026 45 21 7 214 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila subobscura
Q38RX1 0.000266 45 20 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys jacksoni
P92478 0.000271 45 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus asinus
P98046 0.000273 45 24 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Carlito syrichta
Q38S29 0.000286 45 21 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus semotus
P50679 0.000292 45 20 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Damaliscus pygargus phillipsi
Q38RW8 0.0003 45 20 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys taitae
Q38S65 0.0003 45 21 5 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Desmodillus auricularis
P84287 0.000327 45 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila azteca
P84202 0.000327 45 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila athabasca
P84201 0.000327 45 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila algonquin
Q85TA0 0.000327 45 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila affinis
P29856 0.000346 44 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila ambigua
P67796 0.000349 44 20 7 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila tolteca
P67795 0.000349 44 20 7 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila narragansett
Q38S59 0.000353 44 25 1 90 3 MT-CO2 Cytochrome c oxidase subunit 2 Meriones shawi
P25002 0.000359 44 20 4 168 3 COII Cytochrome c oxidase subunit 2 Pisaster ochraceus
P67799 0.000366 44 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila pseudoobscura pseudoobscura
P67798 0.000366 44 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila persimilis
P67797 0.000366 44 19 6 215 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila miranda
P98027 0.00041 44 24 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Cheirogaleus medius
Q38RU4 0.000434 44 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Uromys caudimaculatus
P98043 0.000442 44 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Cephalopachus bancanus
O47674 0.000454 44 22 6 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycaon pictus
Q38S05 0.000541 44 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Leggadina forresti
Q38RW5 0.000551 44 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys tullbergi
Q7IKU8 0.000577 44 20 4 166 3 MT-CO2 Cytochrome c oxidase subunit 2 Microcebus tavaratra
Q38S41 0.000577 44 21 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Micaelamys namaquensis
P93285 0.00058 44 20 9 220 1 COX2 Cytochrome c oxidase subunit 2 Arabidopsis thaliana
P92662 0.000598 44 22 6 171 3 MT-CO2 Cytochrome c oxidase subunit 2 Osphranter robustus
P98021 0.000618 43 18 5 180 3 COII Cytochrome c oxidase subunit 2 Simulium vittatum
P98042 0.000632 43 24 2 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Propithecus tattersalli
P98038 0.000632 43 24 1 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Macaca mulatta
Q82AL0 0.000637 44 25 8 222 3 ctaC Probable cytochrome c oxidase subunit 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
O03851 0.000687 43 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Ceratotherium simum
Q38S02 0.000713 43 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemniscomys barbarus
O47668 0.000713 43 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Cuon alpinus
Q37685 0.000726 43 19 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Tragelaphus imberbis
Q96190 0.000767 43 24 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinoceros unicornis
Q7IZ16 0.000841 43 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias bulleri
O03848 0.001 43 20 8 217 3 MT-CO2 Cytochrome c oxidase subunit 2 Latimeria chalumnae
P32646 0.001 44 22 6 186 2 COX2 Cytochrome c oxidase subunit 2, mitochondrial (Fragment) Vigna unguiculata
Q38S53 0.001 43 26 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Taterillus emini

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00520
Feature type CDS
Gene cyoA
Product cytochrome o ubiquinol oxidase subunit II
Location 134281 - 135231 (strand: -1)
Length 951 (nucleotides) / 316 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2105
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00116 Cytochrome C oxidase subunit II, periplasmic domain
PF06481 COX Aromatic Rich Motif

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1622 Energy production and conversion (C) C Heme/copper-type cytochrome/quinol oxidase, subunit 2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02297 cytochrome o ubiquinol oxidase subunit II [EC:7.1.1.3] Oxidative phosphorylation
Metabolic pathways		 Cytochrome o ubiquinol oxidase

Protein Sequence

MRLMKYIKSIGTLSLLAAAVLLSGCDMALMNPKGAIGAEQKTLILIALGLMLIVVIPVILMVIVFAYRYRESNTKATYRPNWAHSNKIELVVWTVPIIIIVILATITWKTTHELDPYKPLVSDEKPVTIEVVSMDWKWLFIYPEQGIATVNELAFPTNVPVNFKITSDSVMNSFFIPRLGGQIYAMAGMQTKLHLIANEPGEYQGMSASYSGHGFSDMKFTAIATPDRAGFDAWVAKVKQSSDTLNTTAAFDELAKPSQKNPVTYYSSVKPMLFQETISKFGHTGHGAHTGSNQTEHSDATMNMNMSHAAHAGAEE

Flanking regions ( +/- flanking 50bp)

TACTGATACTGATGAAACAACAATAGAACCTTTATCATTTGGGTCGTTGGATGAGACTTATGAAATACATAAAAAGTATTGGGACACTCTCGCTATTAGCAGCCGCTGTTCTTTTAAGTGGTTGCGATATGGCGTTAATGAATCCCAAAGGCGCTATCGGCGCTGAGCAAAAAACATTAATCCTCATTGCGCTTGGTTTAATGTTGATTGTTGTGATACCGGTAATTCTGATGGTGATTGTTTTCGCTTATCGCTACCGTGAATCCAATACTAAAGCAACTTATCGCCCTAATTGGGCTCACTCAAATAAAATTGAGCTTGTCGTGTGGACCGTGCCGATTATCATTATCGTGATATTGGCAACCATCACATGGAAAACAACCCATGAACTTGATCCCTATAAACCACTAGTTTCAGATGAGAAACCGGTTACCATTGAAGTGGTTTCAATGGACTGGAAATGGTTATTTATCTATCCAGAACAAGGTATTGCAACCGTTAACGAACTGGCTTTCCCAACCAATGTTCCTGTTAATTTCAAAATTACCTCTGATTCTGTCATGAACTCATTCTTTATCCCGCGCTTAGGTGGACAAATCTATGCCATGGCTGGAATGCAAACCAAACTTCACTTAATTGCTAATGAACCAGGTGAATACCAAGGTATGTCAGCAAGTTATAGCGGACACGGTTTCTCTGACATGAAGTTTACCGCCATTGCGACACCTGATCGTGCAGGCTTTGATGCATGGGTTGCAAAAGTAAAACAGTCATCAGATACGTTAAATACCACCGCTGCATTTGATGAACTTGCTAAACCAAGCCAGAAAAATCCAGTGACCTACTATTCAAGCGTGAAGCCGATGTTATTCCAAGAGACCATCTCTAAATTTGGTCATACAGGTCATGGCGCTCACACCGGTAGCAATCAGACTGAACACTCTGATGCAACAATGAATATGAACATGAGCCACGCGGCACATGCAGGAGCAGAGGAATAAAGGCATGTTCGGAAAATTAACTCTCGATGCAATCCCGCTACAAGAACCCA