Homologs in group_2143

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15840 FBDBKF_15840 90.2 Morganella morganii S1 cyoA cytochrome o ubiquinol oxidase subunit II
EHELCC_18440 EHELCC_18440 90.2 Morganella morganii S2 cyoA cytochrome o ubiquinol oxidase subunit II
NLDBIP_17275 NLDBIP_17275 90.2 Morganella morganii S4 cyoA cytochrome o ubiquinol oxidase subunit II
LHKJJB_17385 LHKJJB_17385 90.2 Morganella morganii S3 cyoA cytochrome o ubiquinol oxidase subunit II
HKOGLL_17010 HKOGLL_17010 90.2 Morganella morganii S5 cyoA cytochrome o ubiquinol oxidase subunit II
PMI_RS00520 PMI_RS00520 76.5 Proteus mirabilis HI4320 cyoA cytochrome o ubiquinol oxidase subunit II

Distribution of the homologs in the orthogroup group_2143

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2143

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ABJ1 1.95e-138 397 63 2 307 1 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli (strain K12)
P0ABJ2 1.95e-138 397 63 2 307 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9I427 7.98e-123 358 60 6 304 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9WWR1 1.75e-115 338 58 4 295 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Pseudomonas putida
P50653 5.28e-100 299 52 6 287 3 cyaB Ubiquinol oxidase subunit 2 Acetobacter aceti
P57544 2.9e-98 294 51 1 268 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K993 3.63e-98 294 50 3 276 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AA3 1.78e-92 279 50 1 271 3 cyoA Cytochrome bo(3) ubiquinol oxidase subunit 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q73DE0 4.15e-54 181 40 5 240 3 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81V01 4.15e-54 181 40 5 240 3 qoxA Quinol oxidase subunit 2 Bacillus anthracis
Q81HT3 6.01e-53 178 40 5 240 1 qoxA Quinol oxidase subunit 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
E0TW67 3.95e-52 177 39 6 250 1 qoxA Quinol oxidase subunit 2 Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
P34957 3.98e-51 174 38 6 250 1 qoxA Quinol oxidase subunit 2 Bacillus subtilis (strain 168)
Q4L565 1.68e-43 156 36 5 255 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus haemolyticus (strain JCSC1435)
Q8CPP6 3.23e-43 155 36 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA9 3.23e-43 155 36 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A181 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MW2)
Q6GAF2 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MSSA476)
Q6GI23 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain MRSA252)
Q7A698 1.98e-40 147 35 5 245 1 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain N315)
Q99V36 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HH23 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain COL)
Q2YX14 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FZJ9 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FI17 1.98e-40 147 35 5 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus aureus (strain USA300)
Q49WI4 9.08e-37 138 33 7 245 3 qoxA Probable quinol oxidase subunit 2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q04441 6.67e-24 103 33 11 242 1 ctaC Cytochrome c oxidase subunit 2 Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q03438 1.14e-13 74 28 9 259 1 ctaC Cytochrome c oxidase subunit 2 Bacillus sp. (strain PS3)
Q06474 2.02e-09 61 31 2 118 3 ctaC Cytochrome c oxidase subunit 2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P48171 7.79e-09 58 23 7 207 3 mt-co2 Cytochrome c oxidase subunit 2 Oncorhynchus mykiss
Q37677 8.9e-09 58 24 8 207 3 mt-co2 Cytochrome c oxidase subunit 2 Salmo salar
Q1RI44 1.08e-08 58 29 4 153 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia bellii (strain RML369-C)
O78682 1.48e-08 57 24 9 207 3 mt-co2 Cytochrome c oxidase subunit 2 Carassius auratus
P24987 1.91e-08 57 24 9 207 3 mt-co2 Cytochrome c oxidase subunit 2 Cyprinus carpio
P50662 3.09e-08 57 23 9 214 3 MT-CO2 Cytochrome c oxidase subunit 2 Cratogeomys castanops
P18944 3.8e-08 56 23 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 Gallus gallus
Q92I65 4.22e-08 57 29 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q4ULU3 5.21e-08 57 29 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q9MIY7 6.05e-08 56 24 8 207 3 mt-co2 Cytochrome c oxidase subunit 2 Danio rerio
Q96183 6.28e-08 55 22 8 223 3 mt-co2 Cytochrome c oxidase subunit 2 Polypterus ornatipinnis
P98033 8.63e-08 55 28 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Eulemur macaco
P50684 9.84e-08 55 23 6 176 3 MT-CO2 Cytochrome c oxidase subunit 2 Coturnix japonica
Q37741 1.26e-07 55 24 9 207 3 mt-co2 Cytochrome c oxidase subunit 2 Gadus morhua
Q9ZZ51 1.38e-07 55 23 8 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Squalus acanthias
P98054 1.39e-07 55 29 4 124 3 ctaC Cytochrome c oxidase subunit 2 Thermostichus vulcanus
Q37604 1.45e-07 55 26 6 179 3 MT-CO2 Cytochrome c oxidase subunit 2 Petromyzon marinus
O47870 1.46e-07 55 23 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Alligator mississippiensis
Q9ZDC6 1.95e-07 55 28 3 133 3 ctaC Probable cytochrome c oxidase subunit 2 Rickettsia prowazekii (strain Madrid E)
P50666 2.23e-07 54 22 5 183 3 MT-CO2 Cytochrome c oxidase subunit 2 Cairina moschata
Q37691 2.85e-07 53 20 8 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Tachyoryctes splendens
P98020 5.04e-07 53 25 3 160 3 MT-CO2 Cytochrome c oxidase subunit 2 Cercocebus galeritus
P11948 5.39e-07 53 25 4 159 2 MT-CO2 Cytochrome c oxidase subunit 2 Macaca fascicularis
O79404 6.38e-07 53 23 8 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Scyliorhinus canicula
Q4JQI4 6.44e-07 53 21 7 207 3 mt-co2 Cytochrome c oxidase subunit 2 Tetraodon nigroviridis
P98037 8.52e-07 52 23 5 197 3 MT-CO2 Cytochrome c oxidase subunit 2 Mandrillus leucophaeus
P98035 1.04e-06 52 27 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemur catta
Q9B8D8 1.15e-06 52 22 5 200 3 COX2 Cytochrome c oxidase subunit 2 Candida albicans (strain SC5314 / ATCC MYA-2876)
P24011 1.2e-06 53 25 8 232 3 ctaC Cytochrome c oxidase subunit 2 Bacillus subtilis (strain 168)
P98032 1.22e-06 52 22 5 177 3 MT-CO2 Cytochrome c oxidase subunit 2 Daubentonia madagascariensis
P48660 1.26e-06 52 25 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus caballus
P68298 1.36e-06 52 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio hamadryas
P68297 1.36e-06 52 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Papio anubis
P98044 1.55e-06 52 24 3 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Theropithecus gelada
P98047 1.61e-06 52 26 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Varecia variegata
P98034 1.72e-06 51 21 6 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Hapalemur griseus
P25312 1.8e-06 51 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Symphalangus syndactylus
O03895 1.8e-06 51 22 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Tinamus major
P92478 1.82e-06 51 25 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Equus asinus
Q96127 2.05e-06 51 25 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylobates lar
Q8W9N3 2.05e-06 51 20 8 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Dugong dugon
P50685 2.15e-06 51 21 9 214 3 MT-CO2 Cytochrome c oxidase subunit 2 Cratogeomys bursarius
P50690 2.21e-06 51 26 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan troglodytes
P00403 2.52e-06 51 25 4 159 1 MT-CO2 Cytochrome c oxidase subunit 2 Homo sapiens
P50692 2.69e-06 51 22 8 210 3 COII Cytochrome c oxidase subunit 2 Aedes aegypti
Q38S47 2.69e-06 51 19 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Lophuromys flavopunctatus
P26457 2.74e-06 51 26 4 159 3 MT-CO2 Cytochrome c oxidase subunit 2 Pan paniscus
P26455 2.79e-06 51 24 3 158 3 MT-CO2 Cytochrome c oxidase subunit 2 Chlorocebus aethiops
P98039 2.84e-06 51 20 6 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Nycticebus coucang
Q37605 2.87e-06 51 23 3 167 3 MT-CO2 Cytochrome c oxidase subunit 2 Pongo pygmaeus
O03889 3.01e-06 50 22 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Apteryx australis
Q38RZ7 3.09e-06 50 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacomys longipes
Q38S38 3.15e-06 50 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Anisomys imitator
P98019 3.21e-06 50 21 5 183 3 MT-CO2 Cytochrome c oxidase subunit 2 Anas platyrhynchos
O03891 3.25e-06 50 21 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Dromaius novaehollandiae
O03890 3.25e-06 50 21 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Casuarius bennetti
Q38RU7 3.3e-06 50 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Sundamys muelleri
P26456 3.39e-06 50 24 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla gorilla
P34189 3.52e-06 50 22 6 172 3 mt-co2 Cytochrome c oxidase subunit 2 Formosania lacustris
P92662 3.69e-06 50 21 8 212 3 MT-CO2 Cytochrome c oxidase subunit 2 Osphranter robustus
P29163 3.84e-06 50 24 7 211 3 None Cytochrome c oxidase subunit 2 Pneumocystis carinii
P98038 4.05e-06 50 27 1 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Macaca mulatta
Q38RZ2 4.24e-06 50 20 8 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys bartelsii
O79417 4.28e-06 50 23 6 205 3 COII Cytochrome c oxidase subunit 2 Branchiostoma lanceolatum
P50687 4.49e-06 50 21 8 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Dasypus novemcinctus
P98027 4.93e-06 50 19 6 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Cheirogaleus medius
Q38S23 5.11e-06 50 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Batomys granti
Q2Y0B9 5.11e-06 50 21 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Ailuropoda melanoleuca
Q38RY6 5.31e-06 50 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Niviventer culturatus
P98046 5.36e-06 50 24 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Carlito syrichta
O47428 6.15e-06 50 23 6 205 3 COII Cytochrome c oxidase subunit 2 Branchiostoma floridae
Q7IKU8 6.28e-06 50 19 6 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Microcebus tavaratra
Q37472 6.28e-06 50 24 5 170 3 MT-CO2 Cytochrome c oxidase subunit 2 Gorilla gorilla beringei
O21400 6.81e-06 50 21 5 176 3 MT-CO2 Cytochrome c oxidase subunit 2 Struthio camelus
Q37545 6.82e-06 50 22 4 170 3 COII Cytochrome c oxidase subunit 2 Lumbricus terrestris
P93285 7.04e-06 50 20 5 216 1 COX2 Cytochrome c oxidase subunit 2 Arabidopsis thaliana
Q38S11 7.7e-06 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Hybomys univittatus
O47670 7.7e-06 49 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Chrysocyon brachyurus
P50679 7.77e-06 49 20 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Damaliscus pygargus phillipsi
P20375 7.78e-06 49 25 2 129 3 COII Cytochrome c oxidase subunit 2 Apis mellifera ligustica
Q38S20 7.85e-06 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Berylmys bowersi
Q38RY9 7.99e-06 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Maxomys surifer
Q37548 8.22e-06 49 20 6 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Macrotus californicus
Q38S62 8.3e-06 49 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillus gerbillus
O47679 8.94e-06 49 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Speothos venaticus
Q9ZZY8 9.1e-06 49 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Hippopotamus amphibius
P00407 9.17e-06 49 22 7 206 3 mt-co2 Cytochrome c oxidase subunit 2 Xenopus laevis
Q37595 9.91e-06 49 20 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Perognathus flavus
Q37476 1.1e-05 49 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbillurus vallinus
P50688 1.13e-05 49 20 6 209 3 MT-CO2 Cytochrome c oxidase subunit 2 Galago senegalensis
Q37643 1.16e-05 49 20 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinolophus darlingi
P98042 1.18e-05 49 25 2 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Propithecus tattersalli
P98043 1.19e-05 49 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Cephalopachus bancanus
Q38S50 1.19e-05 49 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys ignitus
P50267 1.27e-05 49 24 2 131 3 COII Cytochrome c oxidase subunit 2 Apis florea
P50673 1.28e-05 49 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus sylvaticus
Q38S56 1.3e-05 49 19 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Gerbilliscus robustus
P24988 1.31e-05 48 18 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Microtus pennsylvanicus
Q38S08 1.32e-05 48 19 8 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Hylomyscus parvus
O03893 1.36e-05 48 20 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Rhea americana
P50672 1.38e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Acomys wilsoni
Q37684 1.45e-05 48 23 3 135 3 MT-CO2 Cytochrome c oxidase subunit 2 Tupaia glis
Q38RY0 1.5e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Oenomys hypoxanthus
Q38S00 1.5e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Leopoldamys sabanus
Q38RU1 1.55e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Zelotomys hildegardeae
P29859 1.6e-05 48 20 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila bifasciata
O03851 1.62e-05 48 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Ceratotherium simum
Q37685 1.63e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Tragelaphus imberbis
Q38S29 1.74e-05 48 19 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus semotus
P92693 1.76e-05 48 27 1 122 3 MT-CO2 Cytochrome c oxidase subunit 2 Pongo abelii
Q38RV3 1.78e-05 48 19 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhynchomys isarogensis
Q38S14 1.95e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Dacnomys millardi
Q96190 2.08e-05 48 24 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhinoceros unicornis
P00406 2.2e-05 48 19 7 210 1 Mt-co2 Cytochrome c oxidase subunit 2 Rattus norvegicus
O03892 2.21e-05 48 20 4 168 3 MT-CO2 Cytochrome c oxidase subunit 2 (Fragment) Nothoprocta perdicaria
P98021 2.24e-05 48 19 5 180 3 COII Cytochrome c oxidase subunit 2 Simulium vittatum
Q38RX1 2.24e-05 48 18 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys jacksoni
Q38S26 2.24e-05 48 24 2 120 3 MT-CO2 Cytochrome c oxidase subunit 2 Arvicanthis somalicus
Q38S65 2.33e-05 48 19 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Desmodillus auricularis
P67799 2.36e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila pseudoobscura pseudoobscura
P67798 2.36e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila persimilis
P67797 2.36e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila miranda
P84287 2.39e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila azteca
P84202 2.39e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila athabasca
P84201 2.39e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila algonquin
Q85TA0 2.39e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila affinis
Q37369 2.44e-05 48 23 2 126 3 MT-CO2 Cytochrome c oxidase subunit 2 Antilocapra americana
P50268 2.53e-05 48 24 2 129 3 COII Cytochrome c oxidase subunit 2 Apis koschevnikovi
P29856 2.62e-05 48 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila ambigua
P00405 2.72e-05 48 19 7 210 1 Mtco2 Cytochrome c oxidase subunit 2 Mus musculus
P50683 2.75e-05 48 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Cavia aperea
P29860 2.77e-05 48 19 6 214 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila lowei
Q38RW8 2.85e-05 48 18 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys taitae
P33505 3.01e-05 48 20 5 177 3 COXII Cytochrome c oxidase subunit 2 Anopheles quadrimaculatus
Q38RV6 3.04e-05 48 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Rhabdomys pumilio
O47672 3.16e-05 48 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Cerdocyon thous
Q38S35 3.25e-05 47 19 8 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Apodemus mystacinus
Q37430 3.31e-05 47 20 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Capra hircus
O79673 3.36e-05 47 23 8 211 3 MT-CO2 Cytochrome c oxidase subunit 2 Pelomedusa subrufa
Q7IZ16 3.4e-05 47 24 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias bulleri
P98049 3.6e-05 47 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Oryctolagus cuniculus
O79549 3.76e-05 47 23 4 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycodon semicarinatus
P50691 4.06e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Sciurus carolinensis
P67796 4.12e-05 47 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila tolteca
P67795 4.12e-05 47 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila narragansett
O47673 4.29e-05 47 21 7 208 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes zerda
Q9G185 4.45e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias townsendii
O03848 4.55e-05 47 20 7 207 3 MT-CO2 Cytochrome c oxidase subunit 2 Latimeria chalumnae
Q9G1N5 4.66e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias rufus
Q7IZ08 4.66e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias merriami
Q9G5S9 4.93e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias quadrimaculatus
P05490 5.38e-05 47 20 5 221 3 COX2 Cytochrome c oxidase subunit 2 Oenothera berteroana
Q9G0U1 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias sonomae
Q7IZ01 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias palmeri
Q7IZ11 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias dorsalis
Q7IZ14 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias cinereicollis
Q7IZ15 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias canipes
Q7IZ21 5.51e-05 47 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Tamias amoenus
Q38RW5 5.88e-05 47 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Praomys tullbergi
P41311 6.53e-05 47 19 8 213 3 MT-CO2 Cytochrome c oxidase subunit 2 Didelphis virginiana
P34840 6.62e-05 47 19 6 207 3 COII Cytochrome c oxidase subunit 2 Anopheles gambiae
Q38S02 7e-05 47 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Lemniscomys barbarus
Q38RU4 7.07e-05 47 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Uromys caudimaculatus
Q38S05 7.34e-05 47 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Leggadina forresti
Q38S59 7.53e-05 47 21 4 147 3 MT-CO2 Cytochrome c oxidase subunit 2 Meriones shawi
Q9G2X2 7.59e-05 47 19 4 197 3 MT-CO2 Cytochrome c oxidase subunit 2 Myxine glutinosa
Q37547 7.75e-05 46 18 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Malacothrix typica
Q38S41 8.12e-05 46 22 2 124 3 MT-CO2 Cytochrome c oxidase subunit 2 Micaelamys namaquensis
Q38S17 8.91e-05 46 19 7 210 3 MT-CO2 Cytochrome c oxidase subunit 2 Conilurus penicillatus
O78750 9.33e-05 46 20 7 210 1 MT-CO2 Cytochrome c oxidase subunit 2 Ovis aries
Q37649 0.000103 46 20 5 169 3 MT-CO2 Cytochrome c oxidase subunit 2 Rousettus leschenaultii
Q37596 0.000105 46 21 4 165 3 MT-CO2 Cytochrome c oxidase subunit 2 Phyllostomus hastatus
P41294 0.000106 46 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera musculus
Q599A0 0.000109 46 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera borealis
P47918 0.000116 46 20 6 214 3 COX2 Cytochrome c oxidase subunit 2 Cyberlindnera mrakii
Q37419 0.000121 46 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Boselaphus tragocamelus
P06029 0.000123 46 20 6 214 3 COX2 Cytochrome c oxidase subunit 2 Cyberlindnera saturnus
P29865 0.000132 46 19 6 208 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila subobscura
P68530 0.000135 46 22 2 125 1 MT-CO2 Cytochrome c oxidase subunit 2 Bos taurus
P68554 0.000135 46 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos mutus grunniens
P68553 0.000135 46 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos indicus
P24986 0.000136 46 23 2 121 3 MT-CO2 Cytochrome c oxidase subunit 2 Balaenoptera physalus
P50680 0.000138 46 23 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Gazella spekei
P50678 0.000152 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bubalus depressicornis
P50675 0.000157 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Syncerus caffer
P26857 0.000161 46 22 6 196 3 COX2 Cytochrome c oxidase subunit 2 Marchantia polymorpha
P20387 0.000175 45 24 7 183 3 COX2 Cytochrome c oxidase subunit 2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q38S53 0.000178 45 20 2 129 3 MT-CO2 Cytochrome c oxidase subunit 2 Taterillus emini
P68294 0.000178 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos javanicus
P68295 0.000178 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bos gaurus
P68296 0.000178 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bison bonasus
P50667 0.000179 45 23 2 121 1 MT-CO2 Cytochrome c oxidase subunit 2 Sus scrofa
Q3L6W7 0.000181 45 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Ailurus fulgens
Q37416 0.000194 45 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Bison bison
P08306 0.000206 45 22 7 219 1 ctaC Cytochrome c oxidase subunit 2 Paracoccus denitrificans
P43376 0.00025 45 24 7 183 3 COX2 Cytochrome c oxidase subunit 2 Lachancea thermotolerans (strain ATCC 56472 / CBS 6340 / NRRL Y-8284)
Q37718 0.000261 45 19 2 136 3 MT-CO2 Cytochrome c oxidase subunit 2 Ornithorhynchus anatinus
P48890 0.000272 45 27 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Felis catus
Q9YDX7 0.000283 45 24 10 220 3 aoxA Heme-copper oxidase subunit 2 Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
P00410 0.000289 45 24 7 183 1 COX2 Cytochrome c oxidase subunit 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9TA26 0.000301 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Loxodonta africana
Q2I3H1 0.000304 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Elephas maximus
Q38PR9 0.00031 45 26 1 88 3 MT-CO2 Cytochrome c oxidase subunit 2 Mammuthus primigenius
P50686 0.00031 45 24 2 120 3 MT-CO2 Cytochrome c oxidase subunit 2 Galeopterus variegatus
O47674 0.000366 44 20 7 206 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycaon pictus
Q37440 0.00044 44 22 2 125 3 MT-CO2 Cytochrome c oxidase subunit 2 Rusa unicolor
P98031 0.00044 44 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis simensis
P50253 0.000464 44 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila simulans
P00409 0.000481 44 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila yakuba
O47680 0.00051 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes macrotis
O47678 0.000514 44 22 2 131 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex sechurae
O47681 0.000519 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes vulpes
Q539C6 0.000529 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Vulpes corsac
O47676 0.000534 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex culpaeus
O48276 0.000549 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Urocyon cinereoargenteus
Q7J6G4 0.000549 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Atelocynus microtis
Q7J6G2 0.000559 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex vetulus
O48267 0.000559 44 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex griseus
P00408 0.000584 44 19 6 210 3 mt:CoII Cytochrome c oxidase subunit 2 Drosophila melanogaster
P38596 0.000585 44 27 1 84 3 MT-CO2 Cytochrome c oxidase subunit 2 Halichoerus grypus
P43370 0.000593 44 21 4 176 3 COX2 Cytochrome c oxidase subunit 2 Brettanomyces custersianus
Q9XLW8 0.000651 44 21 9 257 3 COX2 Cytochrome c oxidase subunit 2 Lachancea kluyveri (strain ATCC 58438 / CBS 3082 / BCRC 21498 / NBRC 1685 / JCM 7257 / NCYC 543 / NRRL Y-12651)
P48871 0.000692 43 20 5 214 3 COX2 Cytochrome c oxidase subunit 2 Wickerhamomyces canadensis
O47668 0.0008 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Cuon alpinus
O47669 0.0008 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis aureus
P67782 0.000808 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis lupus
P67780 0.000808 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis lupus familiaris
P67781 0.000808 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis latrans
O47677 0.000861 43 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Lycalopex gymnocercus
O47675 0.001 43 29 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Nyctereutes procyonoides
P29881 0.001 43 20 6 207 3 COII Cytochrome c oxidase subunit 2 Zootermopsis angusticollis
O47671 0.001 43 27 1 86 3 MT-CO2 Cytochrome c oxidase subunit 2 Canis mesomelas elongae
Q3T4C0 0.001 43 22 7 212 3 cox2 Cytochrome c oxidase subunit 2 Zancudomyces culisetae

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS16470
Feature type CDS
Gene cyoA
Product cytochrome o ubiquinol oxidase subunit II
Location 112898 - 113851 (strand: 1)
Length 954 (nucleotides) / 317 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000006
Length 212134 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2143
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00116 Cytochrome C oxidase subunit II, periplasmic domain
PF06481 COX Aromatic Rich Motif

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1622 Energy production and conversion (C) C Heme/copper-type cytochrome/quinol oxidase, subunit 2

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02297 cytochrome o ubiquinol oxidase subunit II [EC:7.1.1.3] Oxidative phosphorylation
Metabolic pathways
Cytochrome o ubiquinol oxidase

Protein Sequence

MNYKKSIGIVMLLAATLLSGGCDMVLMDPKGTIGAQQKTLILTAIGLMLIVVIPVIIMTIVFAMRYREAKKATYRPNWAHSNKIELVVWTVPIIIILILGTITWKTTHELDPYKPLVSDQKPVTIQVISMDWKWLFIYPDQGIATVNEIAFPVGVPVNFKITSDSVMNSFFIPQLGGQIYAMAGMQTKLHLIADEPGVYKGISASYSGHGFSDMKFTATATPTREAFDEWVAKVKASPDTLNTTDAFNALAKPSVNNPVAYFSTVKPNLFVDTINKFGHAGHGSAKMQEGESHSMMDMSADEHGGHMPAATHTGNKG

Flanking regions ( +/- flanking 50bp)

AACGACAATAGTACTGAGCACCTTTATTTTTGGGGTCGTTGGATGAGCTTATGAACTACAAAAAGAGTATCGGGATAGTCATGCTGCTCGCAGCCACGCTTTTATCAGGCGGGTGCGACATGGTGTTGATGGATCCAAAAGGCACTATCGGAGCGCAGCAGAAAACGCTGATCTTAACTGCAATTGGTCTGATGCTTATTGTGGTCATTCCGGTCATTATCATGACAATTGTTTTTGCCATGCGCTACCGGGAAGCAAAAAAAGCAACTTACCGTCCTAACTGGGCACATTCAAACAAAATTGAACTTGTCGTCTGGACCGTTCCAATCATTATCATTCTGATTCTGGGAACAATTACGTGGAAAACCACCCACGAACTGGATCCTTACAAACCCCTGGTCAGTGATCAGAAACCTGTCACTATTCAGGTTATTTCTATGGATTGGAAATGGTTATTTATCTATCCGGATCAAGGTATTGCCACTGTGAATGAGATTGCATTCCCGGTCGGTGTTCCTGTCAATTTCAAAATCACCTCTGACTCTGTAATGAATTCATTTTTCATTCCGCAGTTAGGCGGCCAGATTTACGCAATGGCCGGCATGCAAACCAAACTGCATCTTATTGCTGATGAACCGGGTGTGTATAAGGGGATTTCCGCGAGTTACAGCGGTCATGGTTTCTCTGACATGAAATTTACCGCAACCGCCACCCCGACACGCGAAGCCTTTGATGAATGGGTTGCCAAAGTGAAAGCTTCACCGGATACCCTGAACACCACTGACGCGTTCAATGCATTAGCAAAACCGAGCGTTAATAACCCGGTCGCCTACTTCTCAACCGTCAAGCCAAACCTGTTTGTGGACACCATTAACAAATTTGGTCATGCCGGTCATGGCAGCGCGAAAATGCAGGAAGGCGAAAGCCATTCAATGATGGATATGAGTGCAGATGAGCATGGCGGTCATATGCCTGCGGCAACTCATACCGGGAATAAGGGGTAAAGCATGTTCGGAAAATTAACACTGGATGCAGTTCCCCTGCATGAACCGAT