Homologs in group_1289

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07830 FBDBKF_07830 100.0 Morganella morganii S1 purT formate-dependent phosphoribosylglycinamide formyltransferase
EHELCC_13660 EHELCC_13660 100.0 Morganella morganii S2 purT formate-dependent phosphoribosylglycinamide formyltransferase
LHKJJB_08745 LHKJJB_08745 100.0 Morganella morganii S3 purT formate-dependent phosphoribosylglycinamide formyltransferase
HKOGLL_08295 HKOGLL_08295 100.0 Morganella morganii S5 purT formate-dependent phosphoribosylglycinamide formyltransferase
F4V73_RS13215 F4V73_RS13215 88.0 Morganella psychrotolerans purT formate-dependent phosphoribosylglycinamide formyltransferase
PMI_RS10775 PMI_RS10775 68.1 Proteus mirabilis HI4320 purT formate-dependent phosphoribosylglycinamide formyltransferase

Distribution of the homologs in the orthogroup group_1289

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1289

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B1JP38 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66BW5 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKC7 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pestis (strain Pestoides F)
Q1CH54 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5W9 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CHW4 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pestis
B2K0H3 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C8V8 0.0 571 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JLK9 0.0 564 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3Z2K0 0.0 559 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella sonnei (strain Ss046)
B4SVD3 0.0 559 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella newport (strain SL254)
P33221 0.0 559 69 0 392 1 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli (strain K12)
B1XHB7 0.0 559 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli (strain K12 / DH10B)
C4ZZK6 0.0 559 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
C0Q2G8 0.0 558 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella paratyphi C (strain RKS4594)
Q57NB7 0.0 558 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella choleraesuis (strain SC-B67)
B5FSQ0 0.0 558 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella dublin (strain CT_02021853)
Q2NTH8 0.0 557 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sodalis glossinidius (strain morsitans)
B2U494 0.0 557 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q8Z5X3 0.0 557 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella typhi
B5BH72 0.0 557 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella paratyphi A (strain AKU_12601)
A9MUY8 0.0 557 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PIA0 0.0 557 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q32HB3 0.0 556 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZNW5 0.0 556 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A7MEA0 0.0 556 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
B4TYQ6 0.0 556 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella schwarzengrund (strain CVM19633)
B4F1Q4 0.0 556 68 0 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Proteus mirabilis (strain HI4320)
Q1RAT6 0.0 556 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli (strain UTI89 / UPEC)
Q0TGY3 0.0 556 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC10 0.0 556 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli O1:K1 / APEC
Q8XCJ9 0.0 554 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Escherichia coli O157:H7
Q322G6 0.0 553 69 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella boydii serotype 4 (strain Sb227)
Q83KS0 0.0 553 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella flexneri
Q0T3V7 0.0 553 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shigella flexneri serotype 5b (strain 8401)
A9MNE8 0.0 551 69 0 390 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XQ21 0.0 548 70 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Klebsiella pneumoniae (strain 342)
B2VJA4 0.0 546 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C6DFT2 0.0 532 68 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D4B6 0.0 527 67 0 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5E4R4 0.0 527 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MK47 0.0 524 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio vulnificus (strain YJ016)
Q8DA32 0.0 524 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio vulnificus (strain CMCP6)
C4LDC0 0.0 522 65 1 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q6LRI4 0.0 522 65 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Photobacterium profundum (strain SS9)
Q87Q53 0.0 519 65 2 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MVH5 0.0 519 63 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q07YK6 0.0 518 64 1 394 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella frigidimarina (strain NCIMB 400)
C3LLS4 0.0 512 63 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio cholerae serotype O1 (strain M66-2)
C5BGW0 0.0 511 66 0 390 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Edwardsiella ictaluri (strain 93-146)
Q9KSM8 4.98e-180 509 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0KK42 1.88e-179 508 64 1 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A1SWW0 6.77e-178 504 61 2 393 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0HS20 1.25e-177 503 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain MR-7)
Q0HFS6 1.29e-177 503 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain MR-4)
A0L052 1.55e-177 503 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain ANA-3)
A4SMX4 5.01e-177 501 66 1 368 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Aeromonas salmonicida (strain A449)
Q8EBB7 2.02e-176 500 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q31DQ3 2.92e-176 499 60 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A3D1A0 7.85e-176 498 64 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A4Y447 4.37e-175 496 63 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WK72 9.81e-175 496 63 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella baltica (strain OS185)
B3GXZ2 1.78e-174 495 62 2 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1B2 1.78e-174 495 62 2 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1RMT4 3.06e-174 494 63 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain W3-18-1)
B0BQ46 3.11e-174 494 62 2 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A1S9F3 4.49e-174 494 63 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q886V7 9.11e-173 491 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48LW5 5.01e-172 489 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A1U3I4 6.12e-172 488 60 2 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q3KHJ9 7.26e-172 488 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas fluorescens (strain Pf0-1)
C3K1H6 9.97e-172 488 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas fluorescens (strain SBW25)
Q65VI3 1.05e-171 488 62 1 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
C6BV99 2.17e-171 487 61 1 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C1DDZ2 2.26e-171 487 63 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B0KRH6 2.31e-171 487 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain GB-1)
Q4ZWZ4 2.98e-171 487 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q1I5Y3 3.47e-171 487 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas entomophila (strain L48)
Q88MW1 4.71e-171 486 62 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0I203 1.13e-170 485 62 1 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Histophilus somni (strain 129Pt)
B1JDF0 1.83e-169 482 62 1 376 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain W619)
Q4KHR3 2.11e-169 482 63 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
C4XMB3 5.4e-169 481 62 1 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q9HXP3 4.91e-168 479 64 1 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RM4 4.91e-168 479 64 1 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYK0 4.91e-168 479 64 1 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain LESB58)
Q30XN3 1.58e-167 478 60 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1K4Y1 4.21e-165 471 63 1 376 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azoarcus sp. (strain BH72)
A4VIT1 4.55e-164 469 61 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
Q9CLZ5 1.14e-163 468 60 1 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pasteurella multocida (strain Pm70)
Q7VNI4 4.82e-163 466 61 2 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8DJ34 9.18e-163 465 61 1 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
A1VFP6 3.26e-162 464 60 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72E56 3.26e-162 464 60 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q0VRD0 3.29e-161 461 59 2 395 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8D2R3 2.41e-159 457 52 2 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
Q2SJZ8 7.79e-159 456 59 1 391 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hahella chejuensis (strain KCTC 2396)
B2FTB9 9.62e-157 450 59 4 393 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stenotrophomonas maltophilia (strain K279a)
Q8PBI2 5.95e-156 448 58 2 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RY47 5.95e-156 448 58 2 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4US21 5.95e-156 448 58 2 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q39QR8 9.47e-156 447 57 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A1ANT6 1.85e-155 447 59 1 387 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B4SP00 8.37e-155 445 60 4 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stenotrophomonas maltophilia (strain R551-3)
Q3BW63 9.42e-155 445 58 2 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GWZ8 2.74e-154 444 58 4 395 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P047 2.74e-154 444 58 4 395 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2SRI5 5e-154 443 58 4 395 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q3A5Q4 8.9e-154 442 56 1 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P46927 3.59e-153 441 60 3 386 1 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mannheimia haemolytica
Q0BP50 6.99e-153 440 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5V8 6.99e-153 440 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7N9C6 6.99e-153 440 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A6LHW2 7.01e-153 440 57 1 378 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A4IVS8 2.02e-152 439 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NE84 3.19e-152 438 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FN7 3.19e-152 438 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
P39771 5.19e-152 437 56 1 380 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus subtilis (strain 168)
Q8PN36 1.66e-151 437 57 2 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas axonopodis pv. citri (strain 306)
A0Q8N2 1.44e-150 434 54 1 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. novicida (strain U112)
A7Z0Z2 2.73e-148 428 58 1 364 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A6URA6 5.29e-147 425 54 1 387 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q47A50 7.46e-146 422 58 5 393 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Dechloromonas aromatica (strain RCB)
Q58881 2.05e-145 421 54 3 386 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8NM23 3.36e-144 419 55 4 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QHG1 3.36e-144 419 55 4 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain R)
Q2KUD7 5.18e-144 418 57 7 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella avium (strain 197N)
A6UUH1 1.24e-143 417 52 2 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q6M0Z5 3.06e-143 416 54 2 383 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VIB2 1.03e-142 414 54 1 382 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B8GRA4 1.15e-142 414 57 6 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A4G068 3.59e-142 413 54 1 382 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A4JGK4 3.71e-142 413 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q6FAM6 4.05e-142 413 55 4 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0SEI4 5.26e-142 413 57 7 393 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q0BD59 8.69e-142 412 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q606K7 2.72e-141 411 56 4 392 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7W006 9.35e-141 410 57 7 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1BUU4 1.82e-140 409 57 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia orbicola (strain AU 1054)
Q39E61 1.82e-140 409 57 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A0K993 1.82e-140 409 57 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia cenocepacia (strain HI2424)
Q142Q7 1.84e-140 409 56 4 393 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
Q7WEY0 2.06e-140 409 57 7 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A3N7B6 4.26e-140 408 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
Q63VY4 1.15e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUJ4 1.15e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT04 1.15e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
A3M4Q9 1.24e-139 407 55 4 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A1V2C2 1.27e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
Q62IF4 1.27e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4F3 1.27e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI07 1.27e-139 407 58 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
Q7W3K5 1.76e-139 407 57 7 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A4G4X3 2.42e-139 406 56 6 388 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Herminiimonas arsenicoxydans
Q1LMC7 6.26e-139 405 56 6 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8FMB3 1.27e-138 404 55 4 384 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q3SKP9 3.57e-138 403 57 5 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q2SZW6 8.31e-138 402 56 4 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B3R259 1.05e-137 402 56 6 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4T9D5 1.65e-137 401 54 7 397 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
Q0KAH8 3.42e-137 400 56 8 399 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q470L8 4.79e-137 400 56 6 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q1H1W4 4.95e-137 400 57 6 383 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A9BNI6 5.54e-137 400 56 8 402 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
B1Y650 7.6e-137 400 56 7 401 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q46KI4 1.19e-136 399 51 3 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
A2C2S8 2.98e-136 398 51 3 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
A1TE53 1.33e-135 397 54 6 397 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
C5CP83 2.58e-135 396 54 6 397 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Variovorax paradoxus (strain S110)
Q21SJ0 5.22e-135 395 56 10 408 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0R2Y2 9.75e-135 394 55 6 394 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q55336 1.76e-134 393 53 3 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6Q186 2.11e-134 393 53 2 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
B1MKI7 3.98e-134 393 53 6 403 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A6SZI7 3.81e-133 390 56 6 384 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Janthinobacterium sp. (strain Marseille)
A1TV10 4.34e-132 388 54 9 408 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paracidovorax citrulli (strain AAC00-1)
Q2N8K3 5.13e-132 387 55 3 365 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Erythrobacter litoralis (strain HTCC2594)
A1VT89 5.78e-132 387 53 6 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas naphthalenivorans (strain CJ2)
Q12FU8 6.45e-132 387 54 6 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3M8Q4 1.26e-129 381 51 2 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8EYF0 1.61e-129 380 50 4 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72LY0 1.61e-129 380 50 4 375 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q30UL7 4.38e-129 379 51 4 372 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q0I600 8.26e-129 379 52 2 378 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9311)
Q3AUF2 4.52e-128 377 51 3 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
Q056L2 3.06e-127 375 50 3 361 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04P21 3.06e-127 375 50 3 361 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q18K60 1.31e-126 374 51 1 389 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q8YXB6 1.3e-124 368 50 2 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A2BWY5 1.64e-124 368 45 2 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9515)
A6GWP9 1.71e-124 368 50 4 384 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q7VBB3 2.89e-124 367 49 4 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A1BHN0 6.59e-124 366 52 3 359 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
A6Q6K6 2.43e-123 365 50 5 390 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q7M8I0 3.68e-123 364 49 2 378 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
A3PD91 1.57e-122 363 46 2 380 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9301)
A2BRG6 1.83e-121 360 46 2 380 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain AS9601)
Q7V179 1.9e-120 358 45 2 379 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q5N3J5 3.89e-120 357 53 2 364 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QP9 3.89e-120 357 53 2 364 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q981B9 5.63e-120 357 46 5 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q7U3B3 1.78e-119 355 52 2 357 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parasynechococcus marenigrum (strain WH8102)
Q2IJJ5 1.98e-119 355 53 4 358 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q3AG69 4.3e-119 354 53 2 357 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
A5GPT7 4.59e-119 354 50 3 390 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain WH7803)
Q8KDJ0 4.59e-119 354 49 3 376 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q31AM1 4.31e-118 352 45 2 381 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9312)
Q7V3S4 9.76e-117 348 49 2 368 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
A8ACE0 1.01e-116 348 48 5 390 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A6L404 1.59e-116 348 50 6 385 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q96Y60 2e-116 348 47 4 395 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A2CE36 4.19e-116 347 49 2 368 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
Q4JC46 1.48e-113 340 45 4 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5LD90 5.63e-113 338 49 7 386 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8U3M7 7.63e-113 340 47 6 398 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A5GX22 1.34e-112 338 50 3 370 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
Q9UY67 2e-112 338 47 6 398 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q64UB2 2.81e-112 337 49 7 386 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain YCH46)
Q4JXR6 2.91e-112 337 46 5 396 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium jeikeium (strain K411)
Q8A9W1 3.85e-112 336 49 6 380 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5JFN8 9.69e-110 332 47 6 401 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
O58056 1.2e-109 332 46 6 398 1 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8G5B0 3.5e-108 327 46 8 404 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bifidobacterium longum (strain NCC 2705)
A1A0S3 9.08e-105 318 48 6 377 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q0W4L8 2.48e-101 310 45 11 413 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P15567 4.84e-29 122 27 12 374 3 ade6 Phosphoribosylaminoimidazole carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P50504 9.91e-26 112 27 11 306 3 ADE2 Phosphoribosylaminoimidazole carboxylase Schwanniomyces occidentalis
Q01930 3.14e-25 110 26 12 368 3 ADE1 Phosphoribosylaminoimidazole carboxylase Ogataea methanolica
P12045 5.9e-25 108 26 10 350 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Bacillus subtilis (strain 168)
Q54QE4 1.27e-24 110 25 11 376 1 purC/E Bifunctional purine synthesis protein purC/E Dictyostelium discoideum
O74197 2.05e-24 108 24 10 309 1 ADE2 Phosphoribosylaminoimidazole carboxylase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P21264 3.04e-24 108 25 9 306 1 ADE2 Phosphoribosylaminoimidazole carboxylase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0C017 5.56e-21 98 29 11 362 2 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q92210 7.35e-21 98 26 14 311 3 ADE2 Phosphoribosylaminoimidazole carboxylase Candida albicans (strain SC5314 / ATCC MYA-2876)
P43850 8.68e-21 96 32 5 205 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0CQ37 2.96e-20 96 28 11 367 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CQ36 1.05e-19 94 27 11 364 3 ADE2 Phosphoribosylaminoimidazole carboxylase Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q8CPP2 1.62e-19 92 23 10 378 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQA5 6.07e-19 91 23 10 378 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P52559 7.09e-19 90 27 12 375 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q54975 5.63e-18 88 25 9 358 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L574 8.56e-18 87 24 12 368 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus haemolyticus (strain JCSC1435)
P55195 1.75e-17 87 26 13 353 2 PURKE Phosphoribosylaminoimidazole carboxylase, chloroplastic (Fragment) Vigna aconitifolia
Q8NX94 7.48e-17 85 23 12 380 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MW2)
Q6GAE8 7.48e-17 85 23 12 380 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MSSA476)
Q5HH19 9.54e-17 84 23 12 380 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain COL)
Q5E1R3 2.83e-16 83 24 8 302 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87KE0 6.18e-16 82 24 8 315 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6GI19 8.14e-16 82 23 12 380 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain MRSA252)
Q7A695 8.77e-16 81 22 12 380 1 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain N315)
Q99V32 8.77e-16 81 22 12 380 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
O06457 1.54e-15 80 23 11 369 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9KVT8 2.18e-15 80 26 10 320 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q49WI9 1.59e-14 78 22 13 372 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P72158 7.89e-14 75 25 9 307 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O66608 8.62e-14 75 26 12 322 1 purK N5-carboxyaminoimidazole ribonucleotide synthase Aquifex aeolicus (strain VF5)
P09029 1.78e-13 74 26 6 245 1 purK N5-carboxyaminoimidazole ribonucleotide synthase Escherichia coli (strain K12)
Q8DDD8 7.7e-12 69 23 8 315 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Vibrio vulnificus (strain CMCP6)
Q7MGL1 1.17e-11 69 23 8 315 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Vibrio vulnificus (strain YJ016)
P9WHL9 1.41e-10 66 25 8 308 1 purK N5-carboxyaminoimidazole ribonucleotide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHL8 1.41e-10 66 25 8 308 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65899 1.41e-10 66 25 8 308 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P46701 2.96e-09 62 30 9 250 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Mycobacterium leprae (strain TN)
Q44678 1.39e-08 60 31 3 136 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Corynebacterium ammoniagenes
P74724 2.45e-08 59 22 12 402 3 purK N5-carboxyaminoimidazole ribonucleotide synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0REV9 5.08e-07 55 28 5 157 3 carB Carbamoyl phosphate synthase large chain Clavibacter sepedonicus
A5CRX5 1.89e-06 53 26 3 146 3 carB Carbamoyl phosphate synthase large chain Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q9CCR2 2.96e-06 53 27 4 166 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
B8GEA3 3.33e-06 53 26 3 168 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
Q87WP4 3.78e-06 53 23 6 234 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P29753 3.89e-06 52 25 8 226 2 vanC Vancomycin C-type resistance protein VanC Enterococcus gallinarum
P38100 3.91e-06 52 23 6 243 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5SKN1 1.16e-05 51 23 5 209 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P96495 1.57e-05 50 23 5 209 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A3CU73 1.72e-05 50 26 5 159 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A6WCC6 1.83e-05 50 27 3 148 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q8FT42 2.67e-05 50 24 2 147 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q54KE6 3.38e-05 49 23 7 222 3 mccA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Dictyostelium discoideum
P18185 5.12e-05 49 26 15 311 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P9WPK3 6.75e-05 48 24 2 165 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 6.75e-05 48 24 2 165 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P55641 7.3e-05 48 24 9 274 4 NGR_a01790 Uncharacterized protein y4rH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P58939 8.98e-05 48 23 2 147 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
C1A4I5 9.11e-05 48 22 11 325 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
P58943 0.000104 48 23 12 309 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A0A0H3JRU9 0.000127 48 30 4 144 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
P58942 0.000158 47 23 13 312 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
Q9KXR6 0.000176 47 26 4 148 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q827Q7 0.000181 47 25 2 147 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q42777 0.000204 47 24 6 200 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Glycine max
A1T8H1 0.000239 47 27 8 207 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1D6Y8 0.00028 47 26 8 214 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q7U054 0.000284 47 24 2 165 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9HP43 0.000306 47 24 7 238 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q2FLD9 0.000321 47 24 4 195 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
O50236 0.00053 46 23 4 199 3 carB Carbamoyl phosphate synthase large chain Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B1W463 0.000562 46 25 2 147 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q1B9F9 0.000573 45 25 6 204 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 0.000573 45 25 6 204 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 0.000573 45 25 6 204 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
A7HH70 0.000577 45 29 6 139 3 ddl D-alanine--D-alanine ligase Anaeromyxobacter sp. (strain Fw109-5)
Q9PIL7 0.000667 45 23 8 237 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1AVY9 0.000675 45 21 6 246 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A4TBY6 0.000789 45 26 8 207 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_14105
Feature type CDS
Gene purT
Product formate-dependent phosphoribosylglycinamide formyltransferase
Location 87430 - 88650 (strand: 1)
Length 1221 (nucleotides) / 406 (amino acids)

Contig

Accession ZDB_529
Length 159829 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1289
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02222 ATP-grasp domain
PF21244 PurT, C-terminal
PF22660 Ribonucleotide synthetase preATP-grasp domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0027 Nucleotide transport and metabolism (F) F Formate-dependent phosphoribosylglycinamide formyltransferase (GAR transformylase)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K08289 phosphoribosylglycinamide formyltransferase 2 [EC:6.3.1.21] Purine metabolism
Metabolic pathways
Biosynthesis of secondary metabolites		 De novo purine biosynthesis, PRPP + glutamine => IMP

Protein Sequence

MARKFSGISEQVTVMTTLGTALRPGATKVMLLGAGELGKEVAIECQRLGIEVIAVDRYDNAPAMHIAHRRYVINMLDGAELEAVIRKEQPDHIVPEIEAIATDTLYRLEQEGFHVVPCANAVKLTMNREGIRRLAAEELRLMTSEYRFADDEASFIRAAGEIGFPCIIKPVMSSSGKGQSIIRDESTLHDAWLASQEAGRAGKGRVIVERMIDFDYEITLLTVRAADGVHFCAPVGHRQERGDYRESWQPQAMPDAVLARAQQVAETIVNGLGGYGLFGVELFVRGEDIIFNEVSPRPHDTGLVTLISQNISEFALHVRAFLGLPAGEIVQYRPAASAVILPSLRSDDVRYSGLEHALTGTVQLRLFAKPEIDGSRRMGVALALAPSVQEAVDAAKQAAASVVVTG

Flanking regions ( +/- flanking 50bp)

CAGCCGGTGATTTGCTTATTTCGTGACTAAAGCAAACGATTGCGTATATAATGGCGCGCAAATTTTCCGGTATTTCTGAACAGGTGACAGTGATGACAACATTAGGTACGGCATTACGCCCGGGTGCCACAAAAGTGATGCTGCTGGGCGCAGGTGAATTAGGCAAAGAAGTGGCGATTGAGTGCCAGCGGCTCGGTATTGAAGTGATTGCTGTTGATCGTTATGACAACGCGCCGGCCATGCATATCGCACACCGCCGCTATGTGATCAACATGCTGGACGGCGCGGAGCTGGAAGCTGTGATCCGGAAAGAACAGCCTGACCATATTGTGCCGGAAATTGAAGCGATTGCGACAGATACATTATACCGTTTGGAGCAGGAGGGTTTTCATGTCGTGCCCTGTGCCAATGCGGTAAAACTGACCATGAACCGCGAAGGGATCCGCCGCCTGGCCGCAGAAGAGCTGAGGCTGATGACATCAGAATACCGTTTTGCGGATGATGAGGCGTCTTTTATCCGTGCCGCCGGTGAGATTGGATTTCCCTGCATTATCAAGCCGGTGATGAGTTCATCGGGTAAAGGGCAGAGCATTATCCGCGATGAAAGCACATTGCACGATGCCTGGCTGGCCTCTCAGGAAGCAGGACGCGCCGGAAAAGGGCGGGTGATTGTCGAGCGGATGATTGATTTCGATTATGAAATCACCCTGCTGACTGTCCGTGCGGCAGATGGTGTGCATTTTTGTGCACCGGTCGGGCACCGTCAGGAGCGCGGGGATTACCGTGAATCCTGGCAGCCGCAGGCCATGCCGGATGCTGTTCTGGCACGGGCACAACAGGTGGCGGAGACTATCGTTAACGGGCTGGGCGGCTATGGTCTGTTCGGTGTTGAGCTGTTTGTCCGTGGTGAGGATATTATTTTTAATGAAGTTTCTCCGCGTCCTCACGATACCGGGCTGGTCACACTGATTTCACAGAATATCTCTGAATTTGCCCTGCACGTGCGGGCGTTTCTCGGATTGCCGGCCGGAGAGATAGTTCAGTACCGTCCGGCTGCCTCAGCCGTGATCCTGCCGTCACTGCGCAGCGATGATGTCCGTTACAGCGGGCTGGAGCACGCCCTGACCGGGACTGTGCAGTTGCGCCTGTTTGCCAAACCGGAGATTGACGGCTCCCGGCGCATGGGCGTTGCCCTGGCGCTGGCACCTTCTGTTCAGGAAGCGGTGGACGCGGCAAAACAGGCTGCGGCATCGGTAGTCGTCACCGGCTGACCGGGGTAATATCAGTGATAGCCTTCCCGTATATATAAAGAGGAAGGCAT