Homologs in group_956

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05235 FBDBKF_05235 100.0 Morganella morganii S1 dbpA ATP-dependent RNA helicase DbpA
EHELCC_12355 EHELCC_12355 100.0 Morganella morganii S2 dbpA ATP-dependent RNA helicase DbpA
LHKJJB_12555 LHKJJB_12555 100.0 Morganella morganii S3 dbpA ATP-dependent RNA helicase DbpA
HKOGLL_11170 HKOGLL_11170 100.0 Morganella morganii S5 dbpA ATP-dependent RNA helicase DbpA
F4V73_RS05690 F4V73_RS05690 86.2 Morganella psychrotolerans dbpA ATP-dependent RNA helicase DbpA
PMI_RS00530 PMI_RS00530 80.7 Proteus mirabilis HI4320 dbpA ATP-dependent RNA helicase DbpA

Distribution of the homologs in the orthogroup group_956

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_956

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P21693 0.0 719 75 0 457 1 dbpA ATP-dependent RNA helicase DbpA Escherichia coli (strain K12)
Q8Y7M8 9.54e-102 315 37 4 458 2 dbpA ATP-dependent RNA helicase DbpA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q814I2 2.83e-97 303 36 5 477 2 dbpA ATP-dependent RNA helicase DbpA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Y8N0 7.24e-97 303 44 5 373 2 cshA ATP-dependent RNA helicase CshA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5L3G9 7.88e-97 302 41 3 371 3 cshA DEAD-box ATP-dependent RNA helicase CshA Geobacillus kaustophilus (strain HTA426)
Q73EU1 9.67e-97 303 42 3 372 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HPE6 1.3e-96 303 42 3 372 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VG0 1.3e-96 303 42 3 372 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus anthracis
A0R8U6 1.3e-96 303 42 3 372 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis (strain Al Hakam)
Q63GX5 1.35e-96 303 42 3 372 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ZK / E33L)
Q81IT9 1.6e-96 303 42 3 372 2 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P96614 4.8e-94 295 42 3 369 1 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus subtilis (strain 168)
P42305 5.65e-94 295 37 3 459 1 dbpA ATP-dependent RNA helicase DbpA Bacillus subtilis (strain 168)
Q65N62 1.03e-92 292 43 2 355 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P57453 1.51e-91 292 45 3 348 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9H6 7.96e-91 290 45 3 348 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AF9 1.77e-89 287 43 2 357 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0A9P8 2.1e-89 287 44 2 349 3 deaD ATP-dependent RNA helicase DeaD Shigella flexneri
P0A9P6 2.1e-89 287 44 2 349 1 deaD ATP-dependent RNA helicase DeaD Escherichia coli (strain K12)
P0A9P7 2.1e-89 287 44 2 349 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XA87 2.19e-89 287 44 2 349 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O157:H7
P44586 7.11e-89 286 41 2 372 3 deaD ATP-dependent RNA helicase DeaD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9Z6C9 8e-89 282 40 3 362 3 cshA ATP-dependent RNA helicase CshA Limosilactobacillus reuteri
Q81DF9 2.63e-88 280 41 1 344 2 cshE DEAD-box ATP-dependent RNA helicase CshE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P0A4D8 1.22e-87 280 44 4 350 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4D7 1.22e-87 280 44 4 350 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4L7W0 3.09e-87 278 40 5 367 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus haemolyticus (strain JCSC1435)
P33906 7.55e-87 281 43 2 349 3 deaD ATP-dependent RNA helicase DeaD Klebsiella pneumoniae
O25029 9.4e-86 274 40 5 352 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain ATCC 700392 / 26695)
B9XXL6 2.31e-85 273 40 5 352 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain B128)
Q6GEZ3 1.92e-84 271 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MRSA252)
Q7A0D2 2.05e-84 271 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MW2)
Q6G7M9 2.05e-84 271 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MSSA476)
Q7A4G0 2.05e-84 271 41 5 351 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain N315)
Q99SH6 2.05e-84 271 41 5 351 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEB9 2.05e-84 271 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain COL)
Q2FWH5 2.05e-84 271 41 5 351 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF45 2.05e-84 271 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain USA300)
Q49Z29 2.95e-84 270 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WH05 1.55e-83 270 40 3 369 1 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH04 1.55e-83 270 40 3 369 3 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2YUH3 4.99e-83 267 41 5 351 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HME0 9.02e-83 267 39 5 366 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CRP6 1.9e-82 266 39 5 366 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q55804 3.42e-82 265 40 5 371 1 crhR RNA helicase CrhR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P25888 1.42e-80 259 40 5 379 1 rhlE ATP-dependent RNA helicase RhlE Escherichia coli (strain K12)
Q887N8 4.47e-77 248 39 7 383 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9HXE5 5.65e-76 246 38 7 383 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S21 5.65e-76 246 38 7 383 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UUT0 5.65e-76 246 38 7 383 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain LESB58)
P27639 2.78e-74 241 36 4 368 2 inf-1 Eukaryotic initiation factor 4A Caenorhabditis elegans
Q58083 3.17e-74 240 37 8 365 1 MJ0669 Probable ATP-dependent RNA helicase MJ0669 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6VKC3 9.25e-74 240 39 6 365 3 rhlB ATP-dependent RNA helicase RhlB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q88NB7 3.7e-73 238 37 8 385 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A3Q9R3 1.55e-72 238 36 8 414 3 rhlB ATP-dependent RNA helicase RhlB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q12099 4.54e-72 236 35 8 380 1 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXY5 4.54e-72 236 35 8 380 3 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain YJM789)
Q9Y6V7 4.74e-72 238 39 6 374 1 DDX49 Probable ATP-dependent RNA helicase DDX49 Homo sapiens
Q12S35 4.92e-72 236 37 6 367 3 rhlB ATP-dependent RNA helicase RhlB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q6FJG1 5.5e-72 235 36 7 360 3 FAL1 ATP-dependent RNA helicase FAL1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FLF3 6.15e-72 239 40 6 355 3 DBP2 ATP-dependent RNA helicase DBP2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9C718 9.89e-72 238 38 7 393 2 RH20 DEAD-box ATP-dependent RNA helicase 20 Arabidopsis thaliana
Q26696 1.01e-71 239 40 7 371 3 HEL64 Putative DEAD-box RNA helicase HEL64 Trypanosoma brucei brucei
Q6CX73 1.22e-71 234 35 6 375 3 FAL1 ATP-dependent RNA helicase FAL1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
B0UUZ9 1.38e-71 235 38 4 351 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 2336)
Q0I1X0 1.43e-71 235 38 4 351 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 129Pt)
P20447 1.47e-71 238 40 7 358 1 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5DQF1 2.14e-71 236 38 4 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q4FZF3 2.16e-71 236 39 6 373 2 Ddx49 Probable ATP-dependent RNA helicase DDX49 Mus musculus
A6ZUA1 2.19e-71 238 40 7 358 3 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain YJM789)
C4K8M8 2.35e-71 234 38 5 353 3 rhlB ATP-dependent RNA helicase RhlB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A8G0U0 2.36e-71 235 37 8 391 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sediminis (strain HAW-EB3)
Q0DM51 2.45e-71 243 39 7 375 2 Os03g0827700 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Oryza sativa subsp. japonica
Q5GUR8 3.48e-71 238 38 9 413 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B1KQF6 3.65e-71 234 37 6 367 3 rhlB ATP-dependent RNA helicase RhlB Shewanella woodyi (strain ATCC 51908 / MS32)
Q8Y755 4.67e-71 234 36 2 344 2 cshB DEAD-box ATP-dependent RNA helicase CshB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8CHZ1 5.42e-71 234 37 4 357 3 rhlB ATP-dependent RNA helicase RhlB Shewanella piezotolerans (strain WP3 / JCM 13877)
Q8W4R3 5.54e-71 238 39 5 369 1 RH30 DEAD-box ATP-dependent RNA helicase 30 Arabidopsis thaliana
Q879Y6 5.69e-71 237 36 13 460 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q3BNH8 6.34e-71 238 39 7 390 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PFZ3 6.67e-71 238 39 7 390 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas axonopodis pv. citri (strain 306)
Q4PHU9 1.28e-70 236 37 5 366 3 DBP2 ATP-dependent RNA helicase DBP2 Ustilago maydis (strain 521 / FGSC 9021)
Q8P4D4 1.87e-70 236 39 7 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWT6 1.87e-70 236 39 7 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain B100)
Q4UPY5 1.87e-70 236 39 7 387 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain 8004)
Q8EJQ5 2.03e-70 233 37 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P09052 2.98e-70 238 39 7 368 1 vas ATP-dependent RNA helicase vasa Drosophila melanogaster
Q5A9Z6 3.17e-70 231 34 4 369 3 FAL1 ATP-dependent RNA helicase FAL1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0A1D6GDY8 3.97e-70 239 39 7 375 3 RH3A DEAD-box ATP-dependent RNA helicase 3A, chloroplastic Zea mays
A1SAL1 4.55e-70 231 37 5 367 3 rhlB ATP-dependent RNA helicase RhlB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0A1D6LAB7 5.35e-70 239 39 7 375 2 RH3B DEAD-box ATP-dependent RNA helicase 3B, chloroplastic Zea mays
A5UI36 5.57e-70 231 38 5 365 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittGG)
A5DE68 5.68e-70 230 35 5 373 3 FAL1 ATP-dependent RNA helicase FAL1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q9CJS1 6.2e-70 231 39 5 365 3 rhlB ATP-dependent RNA helicase RhlB Pasteurella multocida (strain Pm70)
A9L5D5 6.36e-70 231 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS195)
A6WTD3 6.36e-70 231 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS185)
A3D9I5 6.78e-70 231 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E670 6.78e-70 231 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS223)
A5UDI1 1.21e-69 230 38 5 366 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittEE)
A5DWJ1 1.24e-69 229 34 3 361 3 FAL1 ATP-dependent RNA helicase FAL1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q755N4 1.25e-69 234 38 6 376 3 DBP2 ATP-dependent RNA helicase DBP2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P24783 1.34e-69 233 39 6 355 1 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZRX0 1.34e-69 233 39 6 355 3 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain YJM789)
A1RFB3 1.48e-69 230 37 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain W3-18-1)
A4YB09 1.48e-69 230 37 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q9PA24 1.51e-69 233 35 10 459 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain 9a5c)
Q0HQL1 1.61e-69 230 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-7)
Q0HN76 1.61e-69 230 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-4)
Q088J2 1.62e-69 230 35 8 416 3 rhlB ATP-dependent RNA helicase RhlB Shewanella frigidimarina (strain NCIMB 400)
P34580 1.69e-69 231 38 4 365 3 T26G10.1 Putative ATP-dependent RNA helicase T26G10.1 Caenorhabditis elegans
Q6CZD9 1.99e-69 229 39 5 362 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q54E49 2.06e-69 229 35 4 353 3 ddx6 Probable ATP-dependent RNA helicase ddx6 Dictyostelium discoideum
Q5QMN3 2.35e-69 231 38 6 384 3 Os01g0197200 DEAD-box ATP-dependent RNA helicase 20 Oryza sativa subsp. japonica
Q4P184 2.53e-69 228 35 3 345 3 FAL1 ATP-dependent RNA helicase FAL1 Ustilago maydis (strain 521 / FGSC 9021)
Q2NQB2 2.58e-69 229 38 5 353 3 rhlB ATP-dependent RNA helicase RhlB Sodalis glossinidius (strain morsitans)
P46942 3.8e-69 234 39 6 368 2 None ATP-dependent RNA helicase-like protein DB10 Nicotiana sylvestris
Q10I26 4.26e-69 228 35 4 371 1 EIF4A3B Eukaryotic initiation factor 4A-III homolog B Oryza sativa subsp. japonica
P38919 4.57e-69 228 36 3 350 1 EIF4A3 Eukaryotic initiation factor 4A-III Homo sapiens
Q4IJH1 4.79e-69 233 38 9 433 3 DBP3 ATP-dependent RNA helicase DBP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6BT27 4.8e-69 228 34 4 369 3 FAL1 ATP-dependent RNA helicase FAL1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
B5FZY7 4.85e-69 228 36 3 350 2 EIF4A3 Eukaryotic initiation factor 4A-III Taeniopygia guttata
Q5ZM36 4.9e-69 228 36 3 350 2 EIF4A3 Eukaryotic initiation factor 4A-III Gallus gallus
Q3B8Q2 4.93e-69 228 36 3 350 1 Eif4a3 Eukaryotic initiation factor 4A-III Rattus norvegicus
A6M931 4.93e-69 228 36 3 350 2 EIF4A3 Eukaryotic initiation factor 4A-III Sus scrofa
Q2NL22 4.93e-69 228 36 3 350 2 EIF4A3 Eukaryotic initiation factor 4A-III Bos taurus
G0SFM2 6.25e-69 232 38 5 365 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q7MYL2 7.2e-69 228 39 5 362 3 rhlB ATP-dependent RNA helicase RhlB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q91VC3 7.62e-69 228 36 3 350 1 Eif4a3 Eukaryotic initiation factor 4A-III Mus musculus
Q7ZVA6 7.73e-69 228 36 3 350 2 eif4a3 Eukaryotic initiation factor 4A-III Danio rerio
B5DG42 8.16e-69 227 36 3 350 2 eif4a3 Eukaryotic initiation factor 4A-III Salmo salar
Q59LU0 8.99e-69 231 38 6 356 3 DBP2 ATP-dependent RNA helicase DBP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q755W0 9.13e-69 227 35 5 356 3 FAL1 ATP-dependent RNA helicase FAL1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
C6DHF5 1.04e-68 228 38 5 362 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GZJ0 1.34e-68 228 36 5 357 3 rhlB ATP-dependent RNA helicase RhlB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q54CE0 1.49e-68 236 41 6 366 3 ddx17 Probable ATP-dependent RNA helicase ddx17 Dictyostelium discoideum
Q6BY27 1.65e-68 230 39 6 355 3 DBP2 ATP-dependent RNA helicase DBP2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q5VNM3 1.72e-68 226 36 3 350 1 EIF4A3A Eukaryotic initiation factor 4A-III homolog A Oryza sativa subsp. japonica
B7ZTW1 1.87e-68 227 36 3 350 2 eif4a3 Eukaryotic initiation factor 4A-III Xenopus tropicalis
B0TJ29 1.95e-68 227 36 5 357 3 rhlB ATP-dependent RNA helicase RhlB Shewanella halifaxensis (strain HAW-EB4)
Q9VHS8 2.11e-68 226 34 4 369 1 CG7483 Eukaryotic initiation factor 4A-III Drosophila melanogaster
Q4R3Q1 2.26e-68 226 35 3 350 2 EIF4A3 Eukaryotic initiation factor 4A-III Macaca fascicularis
Q2UNB7 2.47e-68 228 39 5 347 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q10055 2.73e-68 226 33 4 374 1 tif412 ATP-dependent RNA helicase fal1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M2E0 3.42e-68 228 34 2 356 2 RH12 DEAD-box ATP-dependent RNA helicase 12 Arabidopsis thaliana
A7E449 3.51e-68 230 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A7TJ36 3.57e-68 229 39 8 363 3 DBP3 ATP-dependent RNA helicase DBP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q5U526 3.57e-68 226 36 3 350 2 eif4a3-a Eukaryotic initiation factor 4A-III-A Xenopus laevis
A5DL80 3.77e-68 230 37 4 354 3 DBP2 ATP-dependent RNA helicase DBP2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q4IFI0 3.83e-68 228 40 3 329 3 RRP3 ATP-dependent rRNA helicase RRP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B4F1V3 3.89e-68 226 37 5 362 3 rhlB ATP-dependent RNA helicase RhlB Proteus mirabilis (strain HI4320)
A6SFW7 4.07e-68 230 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Botryotinia fuckeliana (strain B05.10)
A0KS84 4.11e-68 226 36 6 371 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain ANA-3)
Q6FS54 4.11e-68 229 39 7 359 3 DBP3 ATP-dependent RNA helicase DBP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6CIV2 4.8e-68 229 36 6 386 3 DBP2 ATP-dependent RNA helicase DBP2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9LYJ9 4.81e-68 231 38 7 369 2 RH46 DEAD-box ATP-dependent RNA helicase 46 Arabidopsis thaliana
O42226 6.17e-68 225 35 3 350 2 eif4a3-b Eukaryotic initiation factor 4A-III-B Xenopus laevis
A1C5V3 6.96e-68 228 38 10 390 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
P24782 8e-68 229 37 8 374 2 dbp2 ATP-dependent RNA helicase dbp2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6C4D4 8.36e-68 229 36 5 368 3 DBP2 ATP-dependent RNA helicase DBP2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q0IHV9 8.51e-68 227 32 1 365 2 ddx6 Probable ATP-dependent RNA helicase ddx6 Xenopus tropicalis
Q5N7W4 1.03e-67 231 39 5 365 2 Os01g0911100 DEAD-box ATP-dependent RNA helicase 30 Oryza sativa subsp. japonica
Q8H136 1.16e-67 230 38 8 392 1 RH14 DEAD-box ATP-dependent RNA helicase 14 Arabidopsis thaliana
B2VG58 1.42e-67 225 38 5 362 3 rhlB ATP-dependent RNA helicase RhlB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9LUW6 1.59e-67 229 36 8 376 1 RH9 DEAD-box ATP-dependent RNA helicase 9, mitochondrial Arabidopsis thaliana
A7EYW0 1.88e-67 229 41 8 364 3 dbp3 ATP-dependent RNA helicase dbp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
P41380 1.94e-67 223 33 4 371 2 None Eukaryotic initiation factor 4A-3 Nicotiana plumbaginifolia
A6QXC1 2e-67 226 40 11 365 3 DBP3 ATP-dependent RNA helicase DBP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q94A52 2.07e-67 224 34 4 371 1 EIF4A3 Eukaryotic initiation factor 4A-III homolog Arabidopsis thaliana
Q6CH58 2.24e-67 226 37 3 354 3 RRP3 ATP-dependent rRNA helicase RRP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q10202 2.58e-67 228 40 10 369 3 dbp3 ATP-dependent RNA helicase dbp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A7TEF4 2.83e-67 223 33 8 379 3 FAL1 ATP-dependent RNA helicase FAL1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A3LS22 2.84e-67 226 36 4 372 3 RRP3 ATP-dependent rRNA helicase RRP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A6SCT6 2.9e-67 229 41 9 367 3 dbp3 ATP-dependent RNA helicase dbp3 Botryotinia fuckeliana (strain B05.10)
Q9LUW5 3.6e-67 229 36 8 376 1 RH53 DEAD-box ATP-dependent RNA helicase 53, mitochondrial Arabidopsis thaliana
Q6BQ61 4.02e-67 225 37 4 371 3 RRP3 ATP-dependent rRNA helicase RRP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q4WJE9 4.03e-67 225 39 3 328 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q87KH5 4.53e-67 224 37 7 369 3 rhlB ATP-dependent RNA helicase RhlB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q4WH83 4.7e-67 226 41 9 355 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0UK12 4.96e-67 226 40 4 329 3 RRP3 ATP-dependent rRNA helicase RRP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A1D405 5.2e-67 224 39 3 328 3 rrp3 ATP-dependent rRNA helicase rrp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P54824 6.83e-67 224 32 1 365 1 ddx6 ATP-dependent RNA helicase ddx6 Xenopus laevis
Q7MGP7 8.13e-67 223 33 6 419 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain YJ016)
A9MJ29 8.37e-67 223 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q94BV4 8.64e-67 226 34 2 354 2 RH6 DEAD-box ATP-dependent RNA helicase 6 Arabidopsis thaliana
P26196 9.84e-67 224 32 1 365 1 DDX6 Probable ATP-dependent RNA helicase DDX6 Homo sapiens
A4WG30 1.05e-66 222 38 4 362 3 rhlB ATP-dependent RNA helicase RhlB Enterobacter sp. (strain 638)
P54823 1.09e-66 224 32 1 365 1 Ddx6 Probable ATP-dependent RNA helicase DDX6 Mus musculus
A6RGE3 1.13e-66 226 36 4 365 3 DBP2 ATP-dependent RNA helicase DBP2 Ajellomyces capsulatus (strain NAm1 / WU24)
Q755A5 1.21e-66 225 39 8 359 3 DBP3 ATP-dependent RNA helicase DBP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P0CR00 1.4e-66 224 40 4 345 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CR01 1.4e-66 224 40 4 345 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q5B5E7 1.53e-66 223 39 5 346 3 rrp3 ATP-dependent rRNA helicase rrp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8DDN6 1.62e-66 222 34 7 419 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain CMCP6)
A2RB17 1.64e-66 223 39 5 348 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B7VME9 1.68e-66 222 36 6 368 3 rhlB ATP-dependent RNA helicase RhlB Vibrio atlanticus (strain LGP32)
Q4P3U9 1.77e-66 226 37 5 369 3 RRP3 ATP-dependent rRNA helicase RRP3 Ustilago maydis (strain 521 / FGSC 9021)
Q2GWJ5 1.84e-66 221 35 4 368 3 FAL1 ATP-dependent RNA helicase FAL1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q8RXK6 1.86e-66 224 33 1 359 2 RH8 DEAD-box ATP-dependent RNA helicase 8 Arabidopsis thaliana
B5BIS9 1.88e-66 222 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi A (strain AKU_12601)
A7EML8 1.93e-66 223 39 3 330 3 rrp3 ATP-dependent rRNA helicase rrp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q65RG7 1.94e-66 221 38 5 363 3 rhlB ATP-dependent RNA helicase RhlB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P0A2P0 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P1 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhi
B4TNT3 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella schwarzengrund (strain CVM19633)
C0Q2V9 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi C (strain RKS4594)
A9MXF3 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ26 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella newport (strain SL254)
B4TB13 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella heidelberg (strain SL476)
B5RFS3 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVH2 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella enteritidis PT4 (strain P125109)
Q57HT6 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella choleraesuis (strain SC-B67)
B5EZ40 2.09e-66 221 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella agona (strain SL483)
Q8L7S8 2.09e-66 229 37 8 393 1 RH3 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Arabidopsis thaliana
A6S4N4 2.42e-66 221 34 4 379 3 fal1 ATP-dependent RNA helicase fal1 Botryotinia fuckeliana (strain B05.10)
Q5E8U5 2.44e-66 222 36 6 368 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6C347 2.5e-66 221 33 3 350 3 FAL1 ATP-dependent RNA helicase FAL1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q1DP69 2.63e-66 224 38 5 363 3 DBP2 ATP-dependent RNA helicase DBP2 Coccidioides immitis (strain RS)
A7EM88 2.67e-66 221 34 4 379 3 fal1 ATP-dependent RNA helicase fal1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
B5FF87 2.72e-66 221 36 6 368 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain MJ11)
Q818H2 2.82e-66 221 35 2 354 2 cshB DEAD-box ATP-dependent RNA helicase CshB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5VQL1 2.9e-66 228 38 7 360 2 Os01g0172200 DEAD-box ATP-dependent RNA helicase 14 Oryza sativa subsp. japonica
A8G828 3.03e-66 221 38 4 350 3 rhlB ATP-dependent RNA helicase RhlB Serratia proteamaculans (strain 568)
A1SZG4 3.14e-66 221 37 7 380 3 rhlB ATP-dependent RNA helicase RhlB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A7MQI2 3.15e-66 221 39 5 356 3 rhlB ATP-dependent RNA helicase RhlB Cronobacter sakazakii (strain ATCC BAA-894)
A6RW56 3.27e-66 223 39 3 330 3 rrp3 ATP-dependent rRNA helicase rrp3 Botryotinia fuckeliana (strain B05.10)
Q96GQ7 3.77e-66 229 39 8 385 1 DDX27 Probable ATP-dependent RNA helicase DDX27 Homo sapiens
Q5AWA6 4.15e-66 223 39 9 369 3 dbp3 ATP-dependent RNA helicase dbp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9WTM2 4.22e-66 222 32 1 365 2 DDX6 Probable ATP-dependent RNA helicase DDX6 (Fragment) Cavia porcellus
Q9P735 4.32e-66 220 35 3 350 3 fal-1 ATP-dependent RNA helicase fal-1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A8ACT3 4.38e-66 221 38 4 362 3 rhlB ATP-dependent RNA helicase RhlB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q5ZKB9 4.55e-66 223 32 1 365 2 DDX6 Probable ATP-dependent RNA helicase DDX6 Gallus gallus
P41381 4.63e-66 220 37 3 330 2 None Eukaryotic initiation factor 4A-8 Nicotiana tabacum
Q9SQV1 5.21e-66 232 40 7 364 2 RH40 DEAD-box ATP-dependent RNA helicase 40 Arabidopsis thaliana
Q5B0J9 6.36e-66 224 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5RFQ5 7.09e-66 222 32 1 365 2 DDX6 Probable ATP-dependent RNA helicase DDX6 Pongo abelii
A4QU31 7.88e-66 219 34 3 366 3 FAL1 ATP-dependent RNA helicase FAL1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B6EPA4 8.79e-66 220 37 7 368 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio salmonicida (strain LFI1238)
P44922 9.14e-66 219 38 5 365 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q07886 1.03e-65 223 38 8 367 2 Dbp45A Probable ATP-dependent RNA helicase Dbp45A Drosophila melanogaster
B1JQ11 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G19 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRC8 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis (strain Pestoides F)
Q1CNK3 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAD8 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis
B2K046 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBQ4 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD47 1.05e-65 220 38 5 350 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1CR32 1.05e-65 221 39 3 328 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q0SYX0 1.1e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri serotype 5b (strain 8401)
A6TGG9 1.11e-65 219 37 5 367 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A3GFV3 1.26e-65 219 33 4 369 3 FAL1 ATP-dependent RNA helicase FAL1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q4IAA0 1.26e-65 219 35 3 350 3 FAL1 ATP-dependent RNA helicase FAL1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6C9P3 1.41e-65 223 39 7 352 3 DBP3 ATP-dependent RNA helicase DBP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
A1DG51 1.59e-65 221 40 9 355 3 dbp3 ATP-dependent RNA helicase dbp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q329V8 1.67e-65 219 37 5 367 3 rhlB ATP-dependent RNA helicase RhlB Shigella dysenteriae serotype 1 (strain Sd197)
Q6FNK8 1.78e-65 221 37 5 381 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B7LU75 1.84e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A5DAC8 1.86e-65 222 40 6 349 3 DBP3 ATP-dependent RNA helicase DBP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
B7NTG2 1.94e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q4X195 2.09e-65 222 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2U070 2.18e-65 223 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B5XYY9 2.27e-65 219 37 5 367 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae (strain 342)
P41382 2.53e-65 218 35 3 349 2 None Eukaryotic initiation factor 4A-10 Nicotiana tabacum
O02494 2.67e-65 218 33 5 372 2 EIF4-A Eukaryotic initiation factor 4A Cryptosporidium parvum
Q3YVI4 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Shigella sonnei (strain Ss046)
P0A8K0 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri
Q1R4F9 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain UTI89 / UPEC)
B6I4B6 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SE11)
B7NF85 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8J8 2.72e-65 219 37 4 362 1 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12)
B1IWC0 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8J9 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU3 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHV0 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O1:K1 / APEC
A8A6N4 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O9:H4 (strain HS)
B1X9Z4 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / DH10B)
C4ZZ48 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5C7 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O8 (strain IAI1)
B7MR01 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O81 (strain ED1a)
B7L8B6 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain 55989 / EAEC)
B7MGJ1 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN5 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTY2 2.72e-65 219 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q9CAI7 2.74e-65 218 37 3 330 1 TIF4A-3 Eukaryotic initiation factor 4A-3 Arabidopsis thaliana
P0CQ76 2.78e-65 222 37 5 370 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ77 2.78e-65 222 37 5 370 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q41741 3.08e-65 218 36 3 330 2 None Eukaryotic initiation factor 4A Zea mays
Q8SR63 3.12e-65 218 36 4 367 3 RRP3 ATP-dependent rRNA helicase RRP3 Encephalitozoon cuniculi (strain GB-M1)
Q40467 3.13e-65 218 37 3 330 2 None Eukaryotic initiation factor 4A-14 Nicotiana tabacum
Q0ILZ4 3.32e-65 224 37 7 365 2 Os12g0611200 DEAD-box ATP-dependent RNA helicase 9 Oryza sativa subsp. japonica
A1A4H6 3.33e-65 226 38 8 385 2 DDX27 Probable ATP-dependent RNA helicase DDX27 Bos taurus
A1DGZ7 3.37e-65 222 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A6QRQ7 3.58e-65 220 39 3 328 3 RRP3 ATP-dependent rRNA helicase RRP3 Ajellomyces capsulatus (strain NAm1 / WU24)
B1LLV3 3.98e-65 218 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SMS-3-5 / SECEC)
Q1DZK8 4.11e-65 221 40 7 337 3 DBP3 ATP-dependent RNA helicase DBP3 Coccidioides immitis (strain RS)
Q4WEB4 4.2e-65 218 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q86XP3 4.45e-65 228 38 4 347 1 DDX42 ATP-dependent RNA helicase DDX42 Homo sapiens
B5FN74 4.47e-65 218 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Salmonella dublin (strain CT_02021853)
B5YY28 4.52e-65 218 38 5 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q31UK5 4.62e-65 218 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 4 (strain Sb227)
B2TU12 4.62e-65 218 37 4 362 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q5JKF2 4.72e-65 226 39 7 369 2 Os01g0549400 DEAD-box ATP-dependent RNA helicase 40 Oryza sativa subsp. japonica
P54475 4.87e-65 218 36 3 347 1 cshB DEAD-box ATP-dependent RNA helicase CshB Bacillus subtilis (strain 168)
Q810A7 5.13e-65 228 38 4 347 1 Ddx42 ATP-dependent RNA helicase DDX42 Mus musculus
A2QC74 6.57e-65 221 36 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9P6N8 6.64e-65 219 37 4 345 3 rrp3 ATP-dependent rRNA helicase rrp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6BZ77 6.85e-65 220 40 9 361 3 DBP3 ATP-dependent RNA helicase DBP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q7RY59 7.03e-65 220 38 3 352 3 rrp-3 ATP-dependent rRNA helicase rrp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q921N6 7.48e-65 225 38 8 385 1 Ddx27 Probable ATP-dependent RNA helicase DDX27 Mus musculus
Q5R7D1 9.35e-65 228 38 4 347 2 DDX42 ATP-dependent RNA helicase DDX42 Pongo abelii
Q40470 9.64e-65 217 37 3 330 2 None Eukaryotic initiation factor 4A-7 Nicotiana tabacum
C3LQR1 9.9e-65 218 35 6 367 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain M66-2)
Q9KV52 9.9e-65 218 35 6 367 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R4 9.9e-65 218 35 6 367 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A3LRW2 1.01e-64 220 39 8 358 3 DBP3 ATP-dependent RNA helicase DBP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q29S22 1.07e-64 218 36 3 352 2 DDX47 Probable ATP-dependent RNA helicase DDX47 Bos taurus
Q5QYF8 1.22e-64 217 37 5 368 3 rhlB ATP-dependent RNA helicase RhlB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q7SBC6 1.28e-64 221 36 5 365 3 drh-1 ATP-dependent RNA helicase dbp2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4IF76 1.32e-64 220 35 5 364 3 DBP2 ATP-dependent RNA helicase DBP2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A6QSQ0 1.35e-64 218 33 4 383 3 FAL1 ATP-dependent RNA helicase FAL1 Ajellomyces capsulatus (strain NAm1 / WU24)
Q8XAT4 1.39e-64 217 38 5 362 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7
Q6Z2Z4 1.42e-64 216 36 3 330 1 Os02g0146600 Eukaryotic initiation factor 4A-3 Oryza sativa subsp. japonica
A2QY39 1.43e-64 219 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A1CJ18 1.5e-64 219 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q9H0S4 1.51e-64 218 36 3 352 1 DDX47 Probable ATP-dependent RNA helicase DDX47 Homo sapiens
Q9VIF6 1.66e-64 219 37 3 348 1 pths ATP-dependent RNA helicase DDX47 Drosophila melanogaster
A1C595 1.83e-64 216 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q9CWX9 2.01e-64 217 36 3 352 2 Ddx47 Probable ATP-dependent RNA helicase DDX47 Mus musculus
A7MXT4 2.05e-64 217 36 7 369 3 rhlB ATP-dependent RNA helicase RhlB Vibrio campbellii (strain ATCC BAA-1116)
Q2H720 2.08e-64 220 36 5 365 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q1E5R1 2.32e-64 219 36 6 358 3 DHH1 ATP-dependent RNA helicase DHH1 Coccidioides immitis (strain RS)
Q59PR3 3.16e-64 216 37 8 366 3 DBP8 ATP-dependent RNA helicase DBP8 Candida albicans (strain SC5314 / ATCC MYA-2876)
A2QFL3 3.32e-64 218 37 13 427 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P41376 3.42e-64 216 36 3 330 1 EIF4A1 Eukaryotic initiation factor 4A-1 Arabidopsis thaliana
A5E1W4 3.47e-64 219 38 7 358 3 DBP3 ATP-dependent RNA helicase DBP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q1E1N5 3.58e-64 217 39 3 330 3 RRP3 ATP-dependent rRNA helicase RRP3 Coccidioides immitis (strain RS)
Q6CT46 3.63e-64 218 39 8 360 3 DBP3 ATP-dependent RNA helicase DBP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q5ACU6 3.7e-64 219 36 6 373 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2GUI4 3.93e-64 219 40 8 373 3 DBP3 ATP-dependent RNA helicase DBP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q1DTB3 3.96e-64 215 34 3 350 3 FAL1 ATP-dependent RNA helicase FAL1 Coccidioides immitis (strain RS)
A5E6W6 3.99e-64 218 37 8 371 3 RRP3 ATP-dependent rRNA helicase RRP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q54TJ4 4.5e-64 223 37 7 353 3 ddx27 Probable ATP-dependent RNA helicase ddx27 Dictyostelium discoideum
Q2U5A2 5.04e-64 218 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A1D071 5.17e-64 214 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P41379 5.2e-64 215 37 3 324 2 None Eukaryotic initiation factor 4A-2 Nicotiana plumbaginifolia
Q4WWD3 5.22e-64 218 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q40471 5.37e-64 215 36 3 330 2 None Eukaryotic initiation factor 4A-9 Nicotiana tabacum
P41378 6.88e-64 215 36 3 330 2 None Eukaryotic initiation factor 4A Triticum aestivum
A1D8G1 7.01e-64 217 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A4RK80 7.29e-64 221 37 5 382 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q0CBE1 7.33e-64 217 35 4 356 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P38712 7.47e-64 217 37 5 381 1 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9LU46 8.35e-64 219 36 6 359 2 RH35 DEAD-box ATP-dependent RNA helicase 35 Arabidopsis thaliana
Q0CL13 8.52e-64 217 38 10 387 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q55BR9 8.66e-64 217 37 5 366 3 ddx49 Probable ATP-dependent RNA helicase ddx49 Dictyostelium discoideum
P35683 8.78e-64 214 36 3 330 2 Os06g0701100 Eukaryotic initiation factor 4A-1 Oryza sativa subsp. japonica
A6RY31 1.02e-63 218 35 4 364 3 dhh1 ATP-dependent RNA helicase dhh1 Botryotinia fuckeliana (strain B05.10)
A4R715 1.08e-63 218 34 4 356 3 DHH1 ATP-dependent RNA helicase DHH1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P23128 1.1e-63 216 32 4 389 1 me31B ATP-dependent RNA helicase me31b Drosophila melanogaster
Q5AUL4 1.29e-63 214 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2UAK1 1.31e-63 213 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q7XMK8 1.31e-63 216 33 2 361 2 Os04g0533000 DEAD-box ATP-dependent RNA helicase 6 Oryza sativa subsp. japonica
Q9SZB4 1.36e-63 218 37 7 360 3 RH43 Putative DEAD-box ATP-dependent RNA helicase 43 Arabidopsis thaliana
A6ZSX1 1.48e-63 216 37 5 381 3 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain YJM789)
A1C6C4 1.48e-63 218 35 5 363 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q0CAS8 1.59e-63 213 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A4QSS5 1.6e-63 217 35 5 360 3 DBP2 ATP-dependent RNA helicase DBP2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A5AAE5 1.62e-63 213 34 3 350 3 fal1 ATP-dependent RNA helicase fal1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q4PFD9 1.71e-63 225 37 5 354 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Ustilago maydis (strain 521 / FGSC 9021)
Q4HW67 1.71e-63 217 34 6 370 3 DHH1 ATP-dependent RNA helicase DHH1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q7Y183 1.82e-63 215 37 9 366 2 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. japonica
A2XKG2 1.82e-63 215 37 9 366 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. indica
Q5APT8 1.88e-63 218 38 9 360 3 DBP3 ATP-dependent RNA helicase DBP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q75EW9 2.03e-63 216 36 5 383 3 RRP3 ATP-dependent rRNA helicase RRP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5F485 2.28e-63 224 37 4 347 2 DDX42 ATP-dependent RNA helicase DDX42 Gallus gallus
Q91VN6 2.31e-63 219 37 7 389 1 Ddx41 Probable ATP-dependent RNA helicase DDX41 Mus musculus
Q2UMH8 2.41e-63 216 38 9 368 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A7EIX7 2.47e-63 214 34 4 353 3 sub2 ATP-dependent RNA helicase sub2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q61496 2.7e-63 220 39 6 346 1 Ddx4 ATP-dependent RNA helicase DDX4 Mus musculus
Q0U7S9 2.74e-63 216 35 4 353 3 DHH1 ATP-dependent RNA helicase DHH1 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
P0CQ72 2.75e-63 213 33 4 369 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ73 2.75e-63 213 33 4 369 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P41377 2.97e-63 213 36 3 330 1 TIF4A-2 Eukaryotic initiation factor 4A-2 Arabidopsis thaliana
Q2H1Q8 3.31e-63 215 39 3 329 3 RRP3 ATP-dependent rRNA helicase RRP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q6FW42 3.95e-63 220 37 6 361 3 DRS1 ATP-dependent RNA helicase DRS1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q1DMX8 4.38e-63 221 34 10 444 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Coccidioides immitis (strain RS)
Q0CIQ3 4.57e-63 213 36 5 352 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q7S5R1 4.92e-63 218 38 10 402 3 dbp-3 ATP-dependent RNA helicase dbp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5JK84 5.05e-63 213 35 3 341 1 AIP2 DEAD-box ATP-dependent RNA helicase 15 Oryza sativa subsp. japonica
Q0JM17 5.5e-63 213 35 3 341 1 AIP1 DEAD-box ATP-dependent RNA helicase 56 Oryza sativa subsp. japonica
Q6LLL5 6.29e-63 213 34 6 377 3 rhlB ATP-dependent RNA helicase RhlB Photobacterium profundum (strain SS9)
Q9SA27 6.53e-63 214 37 7 380 2 RH36 DEAD-box ATP-dependent RNA helicase 36 Arabidopsis thaliana
Q40468 6.68e-63 212 36 3 330 2 None Eukaryotic initiation factor 4A-15 Nicotiana tabacum
Q756G5 7.02e-63 213 39 9 367 3 DBP8 ATP-dependent RNA helicase DBP8 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A3LP87 7.05e-63 213 38 8 355 3 DBP8 ATP-dependent RNA helicase DBP8 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
A3LWX3 7.39e-63 214 35 5 373 3 DHH1 ATP-dependent RNA helicase DHH1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q40465 7.66e-63 212 36 3 330 2 None Eukaryotic initiation factor 4A-11 Nicotiana tabacum
A5AA68 8.16e-63 215 37 10 383 3 dbp8 ATP-dependent RNA helicase dbp8 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A4QVP2 9.3e-63 211 34 4 369 3 TIF1 ATP-dependent RNA helicase eIF4A Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
O62591 1.11e-62 211 36 2 351 3 LmjF.01.0770 Probable eukaryotic initiation factor 4A Leishmania major
A4HRK0 1.11e-62 211 36 2 351 3 LinJ01.0780 Probable eukaryotic initiation factor 4A Leishmania infantum
Q0E3X4 1.16e-62 217 37 5 350 2 Os02g0150100 DEAD-box ATP-dependent RNA helicase 35A Oryza sativa subsp. japonica
Q109G2 1.33e-62 214 33 1 359 2 Os10g0503700 DEAD-box ATP-dependent RNA helicase 12 Oryza sativa subsp. japonica
P0CQ70 1.35e-62 211 37 4 352 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ71 1.35e-62 211 37 4 352 3 TIF1 ATP-dependent RNA helicase eIF4A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A1CX72 1.55e-62 219 36 9 407 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q8GY84 1.58e-62 212 37 7 386 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Arabidopsis thaliana
A0KEG9 1.74e-62 211 37 9 380 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P32892 1.81e-62 219 37 6 362 1 DRS1 ATP-dependent RNA helicase DRS1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7A0P8 1.86e-62 219 37 6 362 3 DRS1 ATP-dependent RNA helicase DRS1 Saccharomyces cerevisiae (strain YJM789)
Q0UY62 1.86e-62 216 40 6 337 3 DBP3 ATP-dependent RNA helicase DBP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q4WPE9 1.86e-62 219 36 9 407 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q9C8J1 1.93e-62 210 33 3 351 2 RH34 DEAD-box ATP-dependent RNA helicase 34 Arabidopsis thaliana
Q2HFP1 1.96e-62 210 34 4 369 3 TIF1 ATP-dependent RNA helicase eIF4A Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q18212 1.98e-62 211 31 4 364 1 hel-1 Spliceosome RNA helicase DDX39B homolog Caenorhabditis elegans
Q91372 2.17e-62 218 38 7 344 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Xenopus laevis
Q9UJV9 2.19e-62 216 37 7 389 1 DDX41 Probable ATP-dependent RNA helicase DDX41 Homo sapiens
Q25225 2.45e-62 210 35 3 368 3 LbrM01_V2.0740 Probable eukaryotic initiation factor 4A Leishmania braziliensis
Q7ZY47 2.93e-62 221 35 11 440 2 ddx42 ATP-dependent RNA helicase DDX42 Xenopus laevis
Q55D61 2.99e-62 210 31 3 363 3 tifA Eukaryotic initiation factor 4A Dictyostelium discoideum
Q61656 3.12e-62 215 36 5 371 1 Ddx5 Probable ATP-dependent RNA helicase DDX5 Mus musculus
Q0D8N0 3.17e-62 215 36 6 364 2 Os07g0143700 DEAD-box ATP-dependent RNA helicase 53 Oryza sativa subsp. japonica
P17844 3.35e-62 215 36 5 371 1 DDX5 Probable ATP-dependent RNA helicase DDX5 Homo sapiens
A7TJM9 3.58e-62 218 37 5 347 3 DRS1 ATP-dependent RNA helicase DRS1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q5R4I9 3.72e-62 215 36 5 371 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pongo abelii
A3LQW7 3.91e-62 213 38 6 355 3 DBP2 ATP-dependent RNA helicase DBP2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q0DB53 4.02e-62 215 38 8 376 2 Os06g0602400 DEAD-box ATP-dependent RNA helicase 52A Oryza sativa subsp. japonica
Q38F76 4.04e-62 210 35 2 352 3 Tb09.160.3270 Probable eukaryotic initiation factor 4A Trypanosoma brucei brucei (strain 927/4 GUTat10.1)
Q501J6 4.16e-62 216 38 7 349 1 Ddx17 Probable ATP-dependent RNA helicase DDX17 Mus musculus
P44701 4.52e-62 211 36 7 352 3 srmB ATP-dependent RNA helicase SrmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7SH33 4.98e-62 221 36 5 369 3 prp-5 Pre-mRNA-processing ATP-dependent RNA helicase prp-5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6CT85 5.65e-62 212 37 5 362 3 RRP3 ATP-dependent rRNA helicase RRP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P0CQ80 5.82e-62 215 35 3 352 3 DHH1 ATP-dependent RNA helicase DHH1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ81 5.82e-62 215 35 3 352 3 DHH1 ATP-dependent RNA helicase DHH1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9P7C7 5.97e-62 220 35 6 387 1 prp11 Pre-mRNA-processing ATP-dependent RNA helicase prp11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9NQI0 6.31e-62 217 39 6 344 1 DDX4 Probable ATP-dependent RNA helicase DDX4 Homo sapiens
Q3MSQ8 6.57e-62 217 38 6 344 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Pelophylax lessonae
C4LB49 6.9e-62 210 35 6 378 3 rhlB ATP-dependent RNA helicase RhlB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5B3H7 7e-62 213 38 10 384 3 dbp8 ATP-dependent RNA helicase dbp8 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9HGM5 7.45e-62 211 37 6 377 3 dbp8 ATP-dependent RNA helicase dbp8 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5DY34 8.32e-62 216 38 10 355 3 DRS1 ATP-dependent RNA helicase DRS1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A4RGD1 8.4e-62 213 39 3 327 3 RRP3 ATP-dependent rRNA helicase RRP3 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q6H7S2 8.6e-62 212 32 2 361 2 Os02g0641800 DEAD-box ATP-dependent RNA helicase 8 Oryza sativa subsp. japonica
Q4R5S7 9.63e-62 216 39 6 344 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Macaca fascicularis
Q9LFN6 1.01e-61 209 35 3 329 1 RH56 DEAD-box ATP-dependent RNA helicase 56 Arabidopsis thaliana
Q56XG6 1.01e-61 209 35 3 329 1 RH15 DEAD-box ATP-dependent RNA helicase 15 Arabidopsis thaliana
Q6GWX0 1.05e-61 216 39 6 344 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Sus scrofa
Q4E162 1.15e-61 209 35 2 352 3 Tc00.1047053511585.190 Probable eukaryotic initiation factor 4A Trypanosoma cruzi (strain CL Brener)
A5DLE0 1.18e-61 209 39 9 354 3 DBP8 ATP-dependent RNA helicase DBP8 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q58Z64 1.18e-61 214 35 3 352 1 VAD1 ATP-dependent RNA helicase VAD1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q7RV88 1.27e-61 208 34 4 369 3 tif-1 ATP-dependent RNA helicase eIF4A Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A7TK63 1.32e-61 209 38 9 369 3 DBP8 ATP-dependent RNA helicase DBP8 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q09181 1.36e-61 211 34 6 369 3 ste13 Putative ATP-dependent RNA helicase ste13 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5E0U9 1.48e-61 209 37 8 356 3 DBP8 ATP-dependent RNA helicase DBP8 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
P19109 1.72e-61 216 37 8 376 1 Rm62 ATP-dependent RNA helicase p62 Drosophila melanogaster
A7EGL7 1.77e-61 208 33 4 369 3 tif1 ATP-dependent RNA helicase eIF4A Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q2GQ93 1.78e-61 211 34 6 356 3 DHH1 ATP-dependent RNA helicase DHH1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A1D6X9 1.82e-61 211 37 11 385 3 dbp8 ATP-dependent RNA helicase dbp8 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q5ACK7 1.86e-61 213 38 7 358 3 DRS1 ATP-dependent RNA helicase DRS1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2HEB0 1.88e-61 215 34 9 428 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q92841 1.94e-61 216 38 7 349 1 DDX17 Probable ATP-dependent RNA helicase DDX17 Homo sapiens
P0C2N8 2.01e-61 217 40 7 357 3 drh-11 ATP-dependent RNA helicase drs1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A4STJ7 2.08e-61 209 36 9 378 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas salmonicida (strain A449)
P29562 2.09e-61 208 35 5 370 1 EIF4A1 Eukaryotic initiation factor 4A-I (Fragment) Oryctolagus cuniculus
A7TGU7 2.37e-61 210 33 4 366 3 DHH1 ATP-dependent RNA helicase DHH1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P60843 2.49e-61 208 35 5 370 1 Eif4a1 Eukaryotic initiation factor 4A-I Mus musculus
P60842 2.49e-61 208 35 5 370 1 EIF4A1 Eukaryotic initiation factor 4A-I Homo sapiens
Q3SZ54 2.49e-61 208 35 5 370 2 EIF4A1 Eukaryotic initiation factor 4A-I Bos taurus
Q2R1M8 2.55e-61 213 37 8 398 3 Os11g0599500 DEAD-box ATP-dependent RNA helicase 52C Oryza sativa subsp. japonica
Q9V3C0 2.63e-61 213 37 5 356 1 abs ATP-dependent RNA helicase abstrakt Drosophila melanogaster
Q9Y7T7 2.96e-61 214 35 5 370 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A6R3R5 3.16e-61 207 35 4 352 3 TIF1 ATP-dependent RNA helicase eIF4A Ajellomyces capsulatus (strain NAm1 / WU24)
A5A6J2 3.6e-61 213 36 5 371 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pan troglodytes
A3LSN3 4.06e-61 215 37 7 362 3 DRS1 ATP-dependent RNA helicase DRS1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5R5F5 4.18e-61 207 36 4 351 2 EIF4A1 Eukaryotic initiation factor 4A-I Pongo abelii
Q6BJX6 4.44e-61 210 35 6 369 3 DHH1 ATP-dependent RNA helicase DHH1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q4R6M5 4.71e-61 212 36 5 371 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Macaca fascicularis
A6RJ45 5.37e-61 207 33 4 369 3 tif1 ATP-dependent RNA helicase eIF4A Botryotinia fuckeliana (strain B05.10)
Q64060 5.48e-61 214 38 9 352 1 Ddx4 Probable ATP-dependent RNA helicase DDX4 Rattus norvegicus
Q6CJV1 6.17e-61 214 37 7 352 3 DRS1 ATP-dependent RNA helicase DRS1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6C0X2 6.23e-61 210 34 5 372 3 DHH1 ATP-dependent RNA helicase DHH1 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6C024 6.89e-61 211 33 4 380 3 PRP28 Pre-mRNA-splicing ATP-dependent RNA helicase PRP28 Yarrowia lipolytica (strain CLIB 122 / E 150)
A5DS77 7.12e-61 210 39 7 362 3 DBP2 ATP-dependent RNA helicase DBP2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q0UU86 7.62e-61 206 33 4 369 3 TIF1 ATP-dependent RNA helicase eIF4A Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q4WX43 8.49e-61 206 32 4 382 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A7TS37 8.52e-61 209 36 5 365 3 RRP3 ATP-dependent rRNA helicase RRP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q0CXD0 9.02e-61 206 34 3 362 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q6FQZ0 9.47e-61 207 37 8 366 3 DBP8 ATP-dependent RNA helicase DBP8 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q4WXW1 9.48e-61 209 37 11 385 3 dbp8 ATP-dependent RNA helicase dbp8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A5A6N4 9.54e-61 206 35 5 370 2 EIF4A1 Eukaryotic initiation factor 4A-I Pan troglodytes
Q7S5D9 9.68e-61 211 34 6 356 3 drh-10 ATP-dependent RNA helicase dhh1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4R8K5 1.08e-60 206 35 5 370 2 EIF4A1 Eukaryotic initiation factor 4A-I Macaca fascicularis
Q02748 1.2e-60 206 34 4 368 1 eIF4A Eukaryotic initiation factor 4A Drosophila melanogaster
Q54VT4 1.23e-60 209 33 4 368 3 ddx47 Probable ATP-dependent RNA helicase ddx47 Dictyostelium discoideum
Q95YF3 1.31e-60 206 31 2 351 1 cgh-1 ATP-dependent RNA helicase cgh-1 Caenorhabditis elegans
Q2H4D0 1.4e-60 207 34 3 346 3 SUB2 ATP-dependent RNA helicase SUB2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
O13792 1.57e-60 206 33 4 348 1 uap56 ATP-dependent RNA helicase uap56 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2QEN5 1.66e-60 205 34 4 369 3 tif1 ATP-dependent RNA helicase eIF4A Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q5W5U4 1.67e-60 213 38 6 344 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Bos taurus
Q6CSZ7 1.84e-60 208 34 5 373 3 DHH1 ATP-dependent RNA helicase DHH1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_12695
Feature type CDS
Gene dbpA
Product ATP-dependent RNA helicase DbpA
Location 126886 - 128259 (strand: -1)
Length 1374 (nucleotides) / 457 (amino acids)

Contig

Accession ZDB_527
Length 181446 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_956
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain
PF03880 DbpA RNA binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0513 Replication, recombination and repair (L) L Superfamily II DNA and RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05591 ATP-dependent RNA helicase DbpA [EC:3.6.4.13] - -

Protein Sequence

MTSFAELNALPAEQITNLNELGYLTMTPVQAAALPAILAGKDVRAQAKTGSGKTAAFGLGLLQHIDAGHFMTQALVLCPTRELADQVAGELRRLARYLPNIKILTLCGGVPFGAQRDSLIHPPHIIVATPGRLIDHLNKDTLHLDAIRTLVLDEADRMLDMGFADDITEILSRTPEERQTLLFSATWPDEIAAVSRRFQRDPQTIEINSTDELPAVEQQFYEVSRRGKTELLQKLLSREQPASCVVFCNTKKDCQDVYEALESSGQSVLVLHGDMEQRERDQTLIRFANGSSRVLVATDVASRGLDIKALELVINYELAWDPEVHVHRIGRTARAGESGLAISLCAPEEAVRANALEEMLHMKLNWQPIPAGLRITPLDAAMATLCIDGGKKAKIRPGDILGAMTGDMGLNGEDIGKIVIHPMHAYVAVRQGIAQQARKLLQQGKIKGKPVRVRLLK

Flanking regions ( +/- flanking 50bp)

TAGTATCATTGCCGCAAATCTCTCTTTTTATTTAATCCGGAATTTTCATCGTGACCTCATTTGCTGAACTTAATGCACTTCCCGCAGAACAAATTACCAACCTGAATGAACTGGGTTATCTGACCATGACCCCGGTTCAGGCCGCCGCATTACCGGCCATTCTCGCGGGTAAAGATGTCCGTGCGCAGGCCAAAACCGGCAGCGGGAAAACCGCCGCATTCGGCCTGGGGCTGTTACAGCATATCGATGCCGGACACTTTATGACCCAGGCACTGGTTCTGTGCCCGACCCGGGAACTGGCGGATCAGGTTGCCGGTGAACTGCGCCGTCTGGCGCGTTATCTGCCGAATATCAAAATTCTGACCTTATGCGGCGGTGTGCCGTTCGGTGCCCAGCGCGATTCCCTGATCCACCCGCCGCACATTATTGTGGCCACCCCGGGCCGCCTGATTGACCATCTGAACAAAGACACGCTGCACCTTGATGCTATCCGCACTCTGGTGCTGGATGAAGCTGACCGTATGCTGGATATGGGTTTTGCTGACGATATTACTGAAATCCTCTCCCGTACCCCGGAAGAACGTCAGACCCTGCTGTTTTCCGCCACCTGGCCGGATGAGATTGCGGCCGTCAGCCGCCGTTTTCAGCGCGATCCGCAAACCATTGAAATCAACAGCACCGACGAACTTCCGGCGGTTGAGCAGCAGTTTTATGAAGTTTCACGGCGCGGCAAAACTGAACTGTTACAGAAATTACTGAGCCGCGAACAACCGGCATCCTGTGTGGTGTTCTGCAACACCAAGAAAGATTGCCAGGATGTGTATGAAGCCCTGGAGAGCAGCGGACAGAGTGTTTTAGTGCTGCACGGCGATATGGAACAGCGCGAGCGTGACCAGACCCTGATCCGCTTTGCCAACGGCAGCAGCCGTGTGCTGGTTGCCACCGATGTGGCGTCACGCGGGCTCGATATCAAAGCCCTTGAGCTGGTGATCAACTATGAACTGGCGTGGGATCCGGAAGTGCATGTTCACCGCATCGGCCGTACCGCCCGTGCCGGTGAAAGCGGACTGGCGATCAGCCTGTGTGCACCGGAAGAAGCGGTCCGGGCAAACGCACTGGAAGAGATGCTGCATATGAAACTGAACTGGCAGCCAATCCCTGCCGGGCTGCGCATCACCCCGCTGGATGCGGCAATGGCGACACTGTGTATTGACGGCGGCAAAAAAGCCAAAATCCGTCCGGGGGACATTCTCGGCGCCATGACCGGTGATATGGGGCTGAACGGCGAAGATATCGGCAAAATCGTGATCCATCCGATGCATGCTTATGTCGCGGTGCGCCAGGGTATCGCGCAGCAGGCGCGTAAACTGCTTCAGCAGGGTAAAATCAAAGGAAAACCTGTCAGAGTACGATTGCTGAAATAGTCACAAAGGACAGCATTTCCCGTCAGCGGATGATATCTCTGTTTTGTATC