Homologs in group_1870

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13970 FBDBKF_13970 100.0 Morganella morganii S1 eno phosphopyruvate hydratase
EHELCC_11645 EHELCC_11645 100.0 Morganella morganii S2 eno phosphopyruvate hydratase
LHKJJB_11845 LHKJJB_11845 100.0 Morganella morganii S3 eno phosphopyruvate hydratase
HKOGLL_10460 HKOGLL_10460 100.0 Morganella morganii S5 eno phosphopyruvate hydratase
F4V73_RS12825 F4V73_RS12825 97.5 Morganella psychrotolerans eno phosphopyruvate hydratase
PMI_RS01065 PMI_RS01065 91.9 Proteus mirabilis HI4320 eno phosphopyruvate hydratase

Distribution of the homologs in the orthogroup group_1870

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1870

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B5XV19 0.0 794 92 2 433 3 eno Enolase Klebsiella pneumoniae (strain 342)
A6TD53 0.0 794 92 2 433 3 eno Enolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4EUF7 0.0 785 91 0 432 1 eno Enolase Proteus mirabilis (strain HI4320)
A7MQZ0 0.0 784 90 2 433 3 eno Enolase Cronobacter sakazakii (strain ATCC BAA-894)
P64076 0.0 783 91 2 433 1 eno Enolase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P64077 0.0 783 91 2 433 3 eno Enolase Salmonella typhi
B4TTY5 0.0 783 91 2 433 3 eno Enolase Salmonella schwarzengrund (strain CVM19633)
B5BF02 0.0 783 91 2 433 3 eno Enolase Salmonella paratyphi A (strain AKU_12601)
C0PXD5 0.0 783 91 2 433 3 eno Enolase Salmonella paratyphi C (strain RKS4594)
A9N2F4 0.0 783 91 2 433 3 eno Enolase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEH4 0.0 783 91 2 433 3 eno Enolase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T483 0.0 783 91 2 433 3 eno Enolase Salmonella newport (strain SL254)
B4TFZ1 0.0 783 91 2 433 3 eno Enolase Salmonella heidelberg (strain SL476)
B5RDS5 0.0 783 91 2 433 3 eno Enolase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW40 0.0 783 91 2 433 3 eno Enolase Salmonella enteritidis PT4 (strain P125109)
Q57KH0 0.0 783 91 2 433 3 eno Enolase Salmonella choleraesuis (strain SC-B67)
A9MF11 0.0 783 91 2 433 3 eno Enolase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5F4N9 0.0 783 91 2 433 3 eno Enolase Salmonella agona (strain SL483)
Q3YY77 0.0 782 90 2 433 3 eno Enolase Shigella sonnei (strain Ss046)
B5FTU9 0.0 781 90 2 433 3 eno Enolase Salmonella dublin (strain CT_02021853)
P0A6Q2 0.0 780 90 2 433 3 eno Enolase Shigella flexneri
Q32CD6 0.0 780 90 2 433 3 eno Enolase Shigella dysenteriae serotype 1 (strain Sd197)
Q31XL1 0.0 780 90 2 433 3 eno Enolase Shigella boydii serotype 4 (strain Sb227)
B2TZF4 0.0 780 90 2 433 3 eno Enolase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LWP5 0.0 780 90 2 433 3 eno Enolase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R7R4 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain UTI89 / UPEC)
B1LQB2 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain SMS-3-5 / SECEC)
B6I6H5 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain SE11)
B7N715 0.0 780 90 2 433 3 eno Enolase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6P9 0.0 780 90 2 433 1 eno Enolase Escherichia coli (strain K12)
B1IU62 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6Q0 0.0 780 90 2 433 3 eno Enolase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TE80 0.0 780 90 2 433 3 eno Enolase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEW7 0.0 780 90 2 433 3 eno Enolase Escherichia coli O1:K1 / APEC
A8A3R4 0.0 780 90 2 433 3 eno Enolase Escherichia coli O9:H4 (strain HS)
B1XDI9 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain K12 / DH10B)
C4ZZT2 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXJ5 0.0 780 90 2 433 3 eno Enolase Escherichia coli O8 (strain IAI1)
B7MZ75 0.0 780 90 2 433 3 eno Enolase Escherichia coli O81 (strain ED1a)
B7NV69 0.0 780 90 2 433 3 eno Enolase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z3E3 0.0 780 90 2 433 3 eno Enolase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6Q1 0.0 780 90 2 433 3 eno Enolase Escherichia coli O157:H7
B7LEJ8 0.0 780 90 2 433 3 eno Enolase Escherichia coli (strain 55989 / EAEC)
B7MLA0 0.0 780 90 2 433 3 eno Enolase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHJ5 0.0 780 90 2 433 3 eno Enolase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQM2 0.0 780 90 2 433 3 eno Enolase Escherichia coli O139:H28 (strain E24377A / ETEC)
A4WDW7 0.0 780 90 2 433 3 eno Enolase Enterobacter sp. (strain 638)
C5B8X2 0.0 780 91 0 432 3 eno Enolase Edwardsiella ictaluri (strain 93-146)
A6VR00 0.0 778 89 0 432 3 eno Enolase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7N835 0.0 774 90 0 432 3 eno Enolase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8G9W1 0.0 768 90 2 433 3 eno Enolase Serratia proteamaculans (strain 568)
B2VFY8 0.0 766 89 2 433 3 eno Enolase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q65VZ7 0.0 764 87 1 435 3 eno Enolase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P57975 0.0 761 87 0 432 3 eno Enolase Pasteurella multocida (strain Pm70)
B0UV89 0.0 760 87 0 432 3 eno Enolase Histophilus somni (strain 2336)
Q0I1Z1 0.0 760 87 0 432 3 eno Enolase Histophilus somni (strain 129Pt)
A5UI73 0.0 759 87 1 435 3 eno Enolase Haemophilus influenzae (strain PittGG)
Q4QLX6 0.0 759 87 1 435 3 eno Enolase Haemophilus influenzae (strain 86-028NP)
Q7VNM6 0.0 759 86 0 432 3 eno Enolase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F8L5 0.0 759 86 1 435 3 eno Enolase Glaesserella parasuis serovar 5 (strain SH0165)
A5UDD6 0.0 759 87 1 435 3 eno Enolase Haemophilus influenzae (strain PittEE)
B1JK09 0.0 758 89 2 433 3 eno Enolase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66ED8 0.0 758 89 2 433 3 eno Enolase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K561 0.0 758 89 2 433 3 eno Enolase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FLZ5 0.0 758 89 2 433 3 eno Enolase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPY1 0.0 758 89 2 433 3 eno Enolase Yersinia pestis (strain Pestoides F)
Q1CLT2 0.0 758 89 2 433 3 eno Enolase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1D1 0.0 758 89 2 433 3 eno Enolase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBN2 0.0 758 89 2 433 3 eno Enolase Yersinia pestis
Q1C3Y6 0.0 758 89 2 433 3 eno Enolase Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D182 0.0 757 89 2 433 3 eno Enolase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P43806 0.0 757 87 1 435 3 eno Enolase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
C6DDJ5 0.0 756 89 2 433 3 eno Enolase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C4K4K1 0.0 755 83 0 432 3 eno Enolase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B3GY00 0.0 754 86 1 435 3 eno Enolase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N1B9 0.0 754 86 1 435 3 eno Enolase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1JJR4 0.0 753 89 2 433 3 eno Enolase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0T1P7 0.0 752 88 3 433 3 eno Enolase Shigella flexneri serotype 5b (strain 8401)
B0BQ53 0.0 752 86 1 435 3 eno Enolase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
Q2NVN7 0.0 750 88 0 432 3 eno Enolase Sodalis glossinidius (strain morsitans)
Q87LQ0 0.0 744 86 0 432 1 eno Enolase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MHQ1 0.0 738 86 0 432 3 eno Enolase Vibrio vulnificus (strain YJ016)
A4SRC1 0.0 738 87 0 432 3 eno Enolase Aeromonas salmonicida (strain A449)
C4LBR1 0.0 737 87 0 432 3 eno Enolase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q5E326 0.0 737 85 0 432 3 eno Enolase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FAF9 0.0 736 85 0 432 3 eno Enolase Aliivibrio fischeri (strain MJ11)
Q8GE63 0.0 735 87 0 432 1 eno Enolase Aeromonas hydrophila
Q8DC62 0.0 734 86 0 432 3 eno Enolase Vibrio vulnificus (strain CMCP6)
Q6LMT1 0.0 734 84 0 432 3 eno Enolase Photobacterium profundum (strain SS9)
C3LQZ0 0.0 733 86 0 432 3 eno Enolase Vibrio cholerae serotype O1 (strain M66-2)
Q9KPC5 0.0 733 86 0 432 3 eno Enolase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5I3 0.0 733 86 0 432 3 eno Enolase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B6EKL8 0.0 733 85 0 432 3 eno Enolase Aliivibrio salmonicida (strain LFI1238)
A0KGH3 0.0 732 86 0 432 3 eno Enolase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B8CJP6 0.0 723 82 0 432 3 eno Enolase Shewanella piezotolerans (strain WP3 / JCM 13877)
A6VUU9 0.0 715 80 0 432 3 eno Enolase Marinomonas sp. (strain MWYL1)
Q086B0 0.0 714 81 0 432 3 eno Enolase Shewanella frigidimarina (strain NCIMB 400)
Q3IDM2 0.0 704 79 0 432 3 eno Enolase Pseudoalteromonas translucida (strain TAC 125)
Q0HXH0 0.0 702 80 1 432 3 eno Enolase Shewanella sp. (strain MR-7)
Q0HL72 0.0 702 80 1 432 3 eno Enolase Shewanella sp. (strain MR-4)
A0KU82 0.0 700 80 1 432 3 eno Enolase Shewanella sp. (strain ANA-3)
A1S4D7 0.0 700 80 1 432 3 eno Enolase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EBR0 0.0 700 80 1 432 3 eno Enolase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3QC77 0.0 699 79 1 432 3 eno Enolase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9KYH0 0.0 694 80 1 432 3 eno Enolase Shewanella baltica (strain OS195)
A6WR28 0.0 694 80 1 432 3 eno Enolase Shewanella baltica (strain OS185)
A3D795 0.0 694 80 1 432 3 eno Enolase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E8T1 0.0 694 80 1 432 3 eno Enolase Shewanella baltica (strain OS223)
A1SSQ7 0.0 690 82 0 431 3 eno Enolase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q12PZ4 0.0 688 78 1 432 3 eno Enolase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B0TK04 0.0 688 78 1 432 3 eno Enolase Shewanella halifaxensis (strain HAW-EB4)
B1KPT6 0.0 687 77 1 432 3 eno Enolase Shewanella woodyi (strain ATCC 51908 / MS32)
A8H1S5 0.0 686 77 1 432 3 eno Enolase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1RHF3 0.0 686 80 1 432 3 eno Enolase Shewanella sp. (strain W3-18-1)
A4Y943 0.0 686 80 1 432 3 eno Enolase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A8FSS8 0.0 682 77 1 432 3 eno Enolase Shewanella sediminis (strain HAW-EB3)
Q1LTN8 0.0 680 77 0 432 3 eno Enolase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q47WR1 0.0 679 78 0 432 3 eno Enolase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q15QR6 0.0 675 77 1 432 3 eno Enolase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5R143 0.0 648 74 1 429 3 eno Enolase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B4RVU5 0.0 644 76 1 432 3 eno Enolase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q9HXZ5 0.0 641 74 1 431 3 eno Enolase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RA7 0.0 641 74 1 431 1 eno Enolase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V7V4 0.0 641 74 1 431 3 eno Enolase Pseudomonas aeruginosa (strain LESB58)
A6V1F3 0.0 641 74 1 431 3 eno Enolase Pseudomonas aeruginosa (strain PA7)
B1JB38 0.0 639 73 1 431 3 eno Enolase Pseudomonas putida (strain W619)
B0KSB9 0.0 639 73 1 431 3 eno Enolase Pseudomonas putida (strain GB-1)
Q88MF9 0.0 638 73 1 431 3 eno Enolase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1I646 0.0 637 73 1 431 3 eno Enolase Pseudomonas entomophila (strain L48)
Q4KHF6 0.0 634 73 1 431 3 eno Enolase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2SKX0 0.0 632 73 1 432 3 eno Enolase Hahella chejuensis (strain KCTC 2396)
Q3KH92 0.0 630 72 1 431 3 eno Enolase Pseudomonas fluorescens (strain Pf0-1)
A1TZ48 0.0 630 75 1 432 3 eno Enolase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q48F79 0.0 629 72 2 431 3 eno Enolase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q886M3 0.0 629 72 2 431 3 eno1 Enolase 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZWQ8 0.0 627 72 2 431 3 eno1 Enolase 1 Pseudomonas syringae pv. syringae (strain B728a)
P57492 0.0 619 70 1 431 3 eno Enolase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A4XWS1 0.0 618 73 1 431 3 eno Enolase Pseudomonas mendocina (strain ymp)
B8D7U7 0.0 617 70 1 431 3 eno Enolase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9J5 0.0 617 70 1 431 3 eno Enolase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
Q21LC2 0.0 612 72 1 430 3 eno Enolase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8K9E0 0.0 607 68 1 431 3 eno Enolase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B3PJB3 0.0 603 72 1 430 3 eno Enolase Cellvibrio japonicus (strain Ueda107)
Q8D2K1 0.0 603 67 0 432 3 eno Enolase Wigglesworthia glossinidia brevipalpis
Q1QZX7 0.0 595 69 1 432 3 eno Enolase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A0L7X8 0.0 588 68 1 427 3 eno Enolase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q0VQD6 0.0 588 70 2 430 3 eno Enolase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
P59566 0.0 584 65 0 421 3 eno Enolase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q47DI1 0.0 574 66 2 427 3 eno Enolase Dechloromonas aromatica (strain RCB)
Q057H3 0.0 574 63 0 427 3 eno Enolase Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A7GUR7 0.0 570 66 1 427 3 eno Enolase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A5WG13 0.0 564 66 4 430 3 eno Enolase Psychrobacter sp. (strain PRwf-1)
A9VQ48 0.0 564 66 2 428 3 eno Enolase Bacillus mycoides (strain KBAB4)
Q631M2 0.0 564 66 2 428 3 eno Enolase Bacillus cereus (strain ZK / E33L)
Q493N5 0.0 563 63 2 428 3 eno Enolase Blochmanniella pennsylvanica (strain BPEN)
Q6HBF3 0.0 563 66 2 428 3 eno Enolase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EZA0 0.0 563 66 2 428 3 eno Enolase Bacillus cereus (strain 03BB102)
B7JFG3 0.0 563 66 2 428 3 eno Enolase Bacillus cereus (strain AH820)
Q81X78 0.0 563 66 2 428 3 eno Enolase Bacillus anthracis
A0RKS3 0.0 563 66 2 428 3 eno Enolase Bacillus thuringiensis (strain Al Hakam)
C3LDI0 0.0 563 66 2 428 3 eno Enolase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P0A3 0.0 563 66 2 428 3 eno Enolase Bacillus anthracis (strain A0248)
Q473G4 0.0 563 65 1 426 3 eno Enolase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2U9C3 0.0 562 66 2 426 3 eno Enolase Ralstonia pickettii (strain 12J)
Q0KCE2 0.0 561 65 1 426 3 eno Enolase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1Q9K6 0.0 561 65 4 432 3 eno Enolase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q31G68 0.0 561 65 2 426 3 eno Enolase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q1LPI5 0.0 560 65 1 426 3 eno1 Enolase 1 Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B3R499 0.0 559 65 1 426 3 eno Enolase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A0ALD9 0.0 558 66 1 425 3 eno Enolase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
P64074 0.0 558 66 1 425 1 eno Enolase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0A0H3GN27 0.0 558 66 1 425 1 eno Enolase Listeria monocytogenes serotype 1/2a (strain 10403S)
P64075 0.0 558 66 1 425 3 eno Enolase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y0B5 0.0 557 65 2 426 3 eno Enolase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q4FR74 0.0 557 64 4 432 3 eno Enolase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B8DDA1 0.0 557 66 1 427 3 eno Enolase Listeria monocytogenes serotype 4a (strain HCC23)
Q71WX1 0.0 557 66 1 427 3 eno Enolase Listeria monocytogenes serotype 4b (strain F2365)
C1KY94 0.0 557 66 1 427 3 eno Enolase Listeria monocytogenes serotype 4b (strain CLIP80459)
B1XUR8 0.0 555 65 2 429 3 eno Enolase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A4SXE9 0.0 555 65 2 426 3 eno Enolase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B0V677 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain AYE)
A3M5Y1 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B0VQI4 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain SDF)
B2I2A5 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain ACICU)
B7I918 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain AB0057)
B7H227 0.0 554 65 4 432 3 eno Enolase Acinetobacter baumannii (strain AB307-0294)
C5D7M1 0.0 554 65 1 427 3 eno Enolase Geobacillus sp. (strain WCH70)
P37869 0.0 553 65 1 425 1 eno Enolase Bacillus subtilis (strain 168)
A1W4R1 0.0 553 63 3 427 3 eno Enolase Acidovorax sp. (strain JS42)
A6SXG3 0.0 553 63 2 426 3 eno Enolase Janthinobacterium sp. (strain Marseille)
A7Z8Y1 0.0 553 64 1 425 3 eno Enolase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5KVE7 0.0 552 65 1 425 3 eno Enolase Geobacillus kaustophilus (strain HTA426)
Q6FAT9 0.0 552 65 4 432 3 eno Enolase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1BHS0 0.0 552 64 2 426 3 eno Enolase Burkholderia orbicola (strain AU 1054)
B1JUY6 0.0 552 64 2 426 3 eno Enolase Burkholderia orbicola (strain MC0-3)
B4EDA1 0.0 552 64 2 426 3 eno Enolase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K8N1 0.0 552 64 2 426 3 eno Enolase Burkholderia cenocepacia (strain HI2424)
Q74K78 0.0 552 63 1 425 3 eno1 Enolase 1 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A4ISP4 0.0 551 65 1 425 3 eno Enolase Geobacillus thermodenitrificans (strain NG80-2)
A9AGW2 0.0 550 64 2 426 3 eno Enolase Burkholderia multivorans (strain ATCC 17616 / 249)
Q0BDS3 0.0 550 64 2 426 3 eno Enolase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YT09 0.0 550 64 2 426 3 eno Enolase Burkholderia ambifaria (strain MC40-6)
Q815K8 0.0 550 66 2 428 3 eno Enolase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HED2 0.0 550 66 2 428 3 eno Enolase Bacillus cereus (strain B4264)
Q21V37 0.0 550 63 2 426 3 eno Enolase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q65EN2 0.0 550 64 1 425 3 eno Enolase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7IP20 0.0 550 66 2 428 3 eno Enolase Bacillus cereus (strain G9842)
A4JFY5 0.0 550 64 2 426 3 eno Enolase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q39EV9 0.0 550 64 2 426 3 eno Enolase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A8FHJ0 0.0 550 64 1 425 3 eno Enolase Bacillus pumilus (strain SAFR-032)
A1VLH1 0.0 549 64 3 427 3 eno Enolase Polaromonas naphthalenivorans (strain CJ2)
A9LZL4 0.0 549 63 2 426 3 eno Enolase Neisseria meningitidis serogroup C (strain 053442)
B9J4M4 0.0 549 66 2 428 3 eno Enolase Bacillus cereus (strain Q1)
B7HW52 0.0 549 66 2 428 3 eno Enolase Bacillus cereus (strain AH187)
Q72XY5 0.0 549 66 2 428 3 eno Enolase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5WDK9 0.0 548 65 2 427 3 eno Enolase Shouchella clausii (strain KSM-K16)
Q13X07 0.0 548 64 2 426 3 eno Enolase Paraburkholderia xenovorans (strain LB400)
A4G737 0.0 548 62 2 426 3 eno Enolase Herminiimonas arsenicoxydans
B4RMD8 0.0 548 63 2 426 3 eno Enolase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8Z2 0.0 548 63 2 426 3 eno Enolase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B9MEQ4 0.0 547 63 3 427 3 eno Enolase Acidovorax ebreus (strain TPSY)
E6ER18 0.0 546 63 3 429 1 eno Enolase Enterococcus faecalis (strain TX4000 / JH2-2)
P0DM31 0.0 546 63 3 429 3 eno Enolase Enterococcus faecalis (strain ATCC 700802 / V583)
A1K7F6 0.0 546 64 2 427 3 eno Enolase Azoarcus sp. (strain BH72)
Q042F4 0.0 546 62 1 425 1 eno2 Enolase 2 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B2SXU9 0.0 546 64 2 426 3 eno Enolase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A1TLS5 0.0 546 63 3 427 3 eno Enolase Paracidovorax citrulli (strain AAC00-1)
Q2SXC5 0.0 546 64 2 426 3 eno Enolase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9JU46 0.0 546 63 2 423 3 eno Enolase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B1Y4K4 0.0 546 62 2 426 3 eno Enolase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
B0K6X6 0.0 545 64 2 426 3 eno Enolase Thermoanaerobacter sp. (strain X514)
B2JIX0 0.0 545 64 2 426 3 eno Enolase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q63SQ0 0.0 545 64 2 426 3 eno Enolase Burkholderia pseudomallei (strain K96243)
A3NB82 0.0 545 64 2 426 3 eno Enolase Burkholderia pseudomallei (strain 668)
Q3JQQ6 0.0 545 64 2 426 3 eno Enolase Burkholderia pseudomallei (strain 1710b)
A3NX13 0.0 545 64 2 426 3 eno Enolase Burkholderia pseudomallei (strain 1106a)
A1V5K2 0.0 545 64 2 426 3 eno Enolase Burkholderia mallei (strain SAVP1)
Q62J10 0.0 545 64 2 426 3 eno Enolase Burkholderia mallei (strain ATCC 23344)
A2SAU7 0.0 545 64 2 426 3 eno Enolase Burkholderia mallei (strain NCTC 10229)
A3ML77 0.0 545 64 2 426 3 eno Enolase Burkholderia mallei (strain NCTC 10247)
Q9JZ53 0.0 545 63 2 423 3 eno Enolase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B1YLD8 0.0 543 63 1 427 3 eno Enolase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B0K882 0.0 543 63 2 426 3 eno Enolase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q8GR70 0.0 542 63 3 429 1 eno Enolase Enterococcus hirae
C4L5H4 0.0 542 64 1 427 3 eno Enolase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q8R967 0.0 542 63 2 426 3 eno Enolase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q128E4 0.0 541 64 2 426 3 eno Enolase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q3A578 0.0 540 64 3 427 3 eno Enolase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1KUB6 0.0 540 63 2 426 3 eno Enolase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9K717 0.0 539 65 2 425 3 eno Enolase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C5CSV6 0.0 538 62 2 426 3 eno Enolase Variovorax paradoxus (strain S110)
B1GYL7 0.0 538 63 3 429 3 eno Enolase Endomicrobium trichonymphae
A2SJR2 0.0 537 62 3 430 3 eno Enolase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q3SL43 0.0 536 63 2 430 3 eno Enolase Thiobacillus denitrificans (strain ATCC 25259)
Q7VQH3 0.0 536 59 1 431 3 eno Enolase Blochmanniella floridana
Q1H011 0.0 535 60 2 427 3 eno Enolase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B3E2S8 0.0 534 65 2 426 3 eno Enolase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A5CX71 0.0 534 60 1 423 3 eno Enolase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q5NZ69 0.0 533 62 2 427 3 eno Enolase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3JCT1 0.0 532 63 2 427 3 eno Enolase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
P33675 0.0 530 62 1 430 1 eno Enolase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q39T27 0.0 530 65 3 427 3 eno Enolase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B1HVS4 0.0 529 63 2 428 3 eno Enolase Lysinibacillus sphaericus (strain C3-41)
Q181T5 0.0 528 62 1 427 3 eno Enolase Clostridioides difficile (strain 630)
Q2IID9 0.0 528 63 1 430 3 eno Enolase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q1GI52 0.0 527 61 2 431 3 eno Enolase Ruegeria sp. (strain TM1040)
A5GEW5 0.0 526 63 3 428 3 eno Enolase Geotalea uraniireducens (strain Rf4)
B0S1G7 0.0 526 62 2 427 3 eno Enolase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8RI55 0.0 525 65 4 430 3 eno Enolase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B8JAC4 0.0 525 63 1 430 3 eno Enolase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
C0Z6L3 0.0 525 63 2 426 3 eno Enolase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B4UDM8 0.0 525 63 1 426 3 eno Enolase Anaeromyxobacter sp. (strain K)
A1WL86 0.0 525 60 3 431 3 eno Enolase Verminephrobacter eiseniae (strain EF01-2)
C1FQW6 0.0 523 61 2 425 3 eno Enolase Clostridium botulinum (strain Kyoto / Type A2)
Q2NJ39 0.0 523 61 3 428 3 eno Enolase Aster yellows witches'-broom phytoplasma (strain AYWB)
Q8ENP5 0.0 523 64 2 425 3 eno Enolase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B9M3M1 0.0 523 62 3 428 3 eno Enolase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B8J467 0.0 523 60 2 425 3 eno Enolase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q2Y9P0 0.0 522 61 2 426 3 eno Enolase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1WWZ2 0.0 522 61 4 430 3 eno Enolase Halorhodospira halophila (strain DSM 244 / SL1)
Q6YQT9 0.0 522 62 4 428 3 eno Enolase Onion yellows phytoplasma (strain OY-M)
Q28RE8 0.0 521 60 2 431 3 eno Enolase Jannaschia sp. (strain CCS1)
Q74AR6 0.0 521 63 3 427 3 eno Enolase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O85348 0.0 521 60 3 426 3 eno Enolase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A7FQP0 0.0 521 61 2 425 3 eno Enolase Clostridium botulinum (strain ATCC 19397 / Type A)
Q604M4 0.0 521 61 2 430 3 eno2 Enolase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B3WCW7 0.0 521 61 2 429 3 eno Enolase Lacticaseibacillus casei (strain BL23)
A6TU30 0.0 521 61 1 427 3 eno Enolase Alkaliphilus metalliredigens (strain QYMF)
A1AW20 0.0 520 61 3 422 3 eno Enolase Ruthia magnifica subsp. Calyptogena magnifica
A7G9Y3 0.0 520 61 2 425 3 eno Enolase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IDB9 0.0 520 61 2 425 3 eno Enolase Clostridium botulinum (strain Okra / Type B1)
Q03AK4 0.0 520 61 2 429 3 eno Enolase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B9KQU4 0.0 520 60 2 430 3 eno Enolase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J3H9 0.0 520 60 2 430 3 eno Enolase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PIV3 0.0 520 60 2 430 3 eno Enolase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
C1DCC3 0.0 519 62 2 426 3 eno Enolase Laribacter hongkongensis (strain HLHK9)
A4WR18 0.0 518 60 2 431 3 eno Enolase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q11QE1 0.0 518 60 2 427 3 eno Enolase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q5LQL4 0.0 517 60 3 431 3 eno Enolase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0AD93 0.0 517 60 3 426 3 eno Enolase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q5FNN5 0.0 517 61 3 432 3 eno Enolase Gluconobacter oxydans (strain 621H)
A9HJ75 0.0 517 61 3 432 3 eno Enolase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q97L52 0.0 517 60 2 423 3 eno Enolase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8GQ75 0.0 516 63 3 430 3 eno Enolase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C0QRV6 0.0 516 62 3 427 3 eno Enolase Persephonella marina (strain DSM 14350 / EX-H1)
B1KTJ8 0.0 516 61 2 425 3 eno Enolase Clostridium botulinum (strain Loch Maree / Type A3)
C6E471 0.0 516 63 3 428 3 eno Enolase Geobacter sp. (strain M21)
B5EGF2 0.0 516 63 3 428 3 eno Enolase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q215A2 0.0 516 61 3 430 3 eno Enolase Rhodopseudomonas palustris (strain BisB18)
B6IQ30 0.0 516 60 2 430 3 eno Enolase Rhodospirillum centenum (strain ATCC 51521 / SW)
A1APJ8 0.0 516 63 3 426 3 eno Enolase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B6YQN5 0.0 515 59 5 432 3 eno Enolase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q04DH2 0.0 515 61 3 424 3 eno Enolase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q2L088 0.0 514 61 3 426 3 eno Enolase Bordetella avium (strain 197N)
O66778 0.0 514 59 4 429 3 eno Enolase Aquifex aeolicus (strain VF5)
A7HCC4 0.0 514 61 1 430 3 eno Enolase Anaeromyxobacter sp. (strain Fw109-5)
Q0C0R3 0.0 513 60 2 430 3 eno Enolase Hyphomonas neptunium (strain ATCC 15444)
B7KRB4 1.48e-180 513 61 2 430 3 eno Enolase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q89KV6 1.75e-180 513 60 3 430 3 eno Enolase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7VW79 1.98e-180 513 61 3 426 3 eno Enolase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W5N9 1.98e-180 513 61 3 426 3 eno Enolase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WD75 1.98e-180 513 61 3 426 3 eno Enolase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A8LQL4 2.07e-180 512 60 3 430 3 eno Enolase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2RT60 2.34e-180 512 61 2 431 3 eno Enolase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A7HXW7 2.44e-180 512 60 3 431 3 eno Enolase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q316Q0 2.8e-180 512 61 2 425 3 eno Enolase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0PYP4 3.95e-180 512 60 1 425 3 eno Enolase Clostridium novyi (strain NT)
C0QI43 5.01e-180 511 63 2 418 3 eno Enolase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A1B9D2 5.81e-180 511 59 2 431 3 eno Enolase Paracoccus denitrificans (strain Pd 1222)
A9IIP8 6.52e-180 511 61 3 426 3 eno Enolase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q1GVS8 7.44e-180 511 62 2 425 3 eno Enolase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A5EK13 8.55e-180 511 61 3 430 3 eno Enolase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A9W6G9 8.59e-180 511 61 2 430 3 eno Enolase Methylorubrum extorquens (strain PA1)
A5N2N5 9.1e-180 511 60 2 423 3 eno Enolase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E6B1 9.1e-180 511 60 2 423 3 eno Enolase Clostridium kluyveri (strain NBRC 12016)
A4YVC0 9.96e-180 511 61 3 430 3 eno Enolase Bradyrhizobium sp. (strain ORS 278)
Q03SL5 1.09e-179 511 60 1 425 3 eno Enolase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q24MW5 1.91e-179 510 61 2 429 3 eno2 Enolase 2 Desulfitobacterium hafniense (strain Y51)
B9MS47 2.11e-179 510 63 2 422 3 eno Enolase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q92Q98 2.85e-179 509 60 3 431 3 eno Enolase Rhizobium meliloti (strain 1021)
Q2IWD0 3.54e-179 509 61 3 430 3 eno Enolase Rhodopseudomonas palustris (strain HaA2)
C3MBJ9 3.67e-179 509 60 3 431 3 eno Enolase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q89Z05 4.16e-179 509 61 4 432 3 eno Enolase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q164E3 4.18e-179 509 60 3 430 3 eno Enolase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q0B080 4.73e-179 509 59 2 430 3 eno Enolase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q5NGW8 4.86e-179 510 61 3 427 3 eno Enolase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14IC0 4.86e-179 510 61 3 427 3 eno Enolase Francisella tularensis subsp. tularensis (strain FSC 198)
Q136E5 6.18e-179 509 61 3 430 3 eno Enolase Rhodopseudomonas palustris (strain BisB5)
C1F9E6 7.41e-179 509 60 2 426 3 eno Enolase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
A0Q5J9 7.69e-179 509 61 3 427 3 eno Enolase Francisella tularensis subsp. novicida (strain U112)
Q8P9Z3 8.09e-179 508 60 2 426 3 eno Enolase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RU05 8.09e-179 508 60 2 426 3 eno Enolase Xanthomonas campestris pv. campestris (strain B100)
Q4UTP2 8.09e-179 508 60 2 426 3 eno Enolase Xanthomonas campestris pv. campestris (strain 8004)
Q38Y18 1.07e-178 508 60 2 426 3 eno Enolase Latilactobacillus sakei subsp. sakei (strain 23K)
B5YF30 1.12e-178 508 62 4 425 3 eno Enolase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
B1ZEJ8 1.59e-178 508 61 2 430 3 eno Enolase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q050L5 1.65e-178 508 60 2 427 3 eno Enolase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04SI9 1.65e-178 508 60 2 427 3 eno Enolase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q0BKV1 1.74e-178 509 61 3 427 3 eno Enolase Francisella tularensis subsp. holarctica (strain OSU18)
A6U8E5 1.83e-178 508 60 3 431 3 eno Enolase Sinorhizobium medicae (strain WSM419)
Q8PLS0 2.09e-178 508 59 2 426 3 eno Enolase Xanthomonas axonopodis pv. citri (strain 306)
Q2G662 2.11e-178 508 61 2 426 3 eno Enolase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q0STE0 3.35e-178 507 60 2 424 3 eno Enolase Clostridium perfringens (strain SM101 / Type A)
Q0TQZ2 3.35e-178 507 60 2 424 3 eno Enolase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8KNX9 3.56e-178 507 61 5 434 3 eno Enolase Bacteroides fragilis (strain YCH46)
Q5LG64 3.56e-178 507 61 5 434 3 eno Enolase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A8MFY2 3.72e-178 507 61 1 425 3 eno Enolase Alkaliphilus oremlandii (strain OhILAs)
Q3BUT0 3.9e-178 507 59 2 426 3 eno Enolase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3AFC8 3.92e-178 507 61 3 427 3 eno Enolase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8XKU4 4.22e-178 507 60 2 424 3 eno Enolase Clostridium perfringens (strain 13 / Type A)
Q2A278 5.2e-178 508 61 3 427 3 eno Enolase Francisella tularensis subsp. holarctica (strain LVS)
A4XKV0 6.09e-178 506 63 2 422 3 eno Enolase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q88YH3 6.7e-178 507 58 2 428 1 eno1 Enolase 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B0SRL5 9.01e-178 506 61 3 423 3 eno Enolase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0S8S8 9.01e-178 506 61 3 423 3 eno Enolase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B2FK88 1.76e-177 505 61 3 427 3 eno Enolase Stenotrophomonas maltophilia (strain K279a)
Q2K8W9 2.11e-177 505 61 3 431 3 eno Enolase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1ISS7 2.16e-177 505 61 3 426 3 eno Enolase Koribacter versatilis (strain Ellin345)
B9EAH1 2.52e-177 505 59 5 431 3 eno Enolase Macrococcus caseolyticus (strain JCSC5402)
B8EJT3 2.95e-177 504 61 2 430 3 eno Enolase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q98MZ3 3.42e-177 504 61 3 431 3 eno Enolase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B1LZU6 3.46e-177 504 61 2 430 3 eno Enolase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q1J2H6 3.71e-177 504 59 4 427 3 eno Enolase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A6LR09 3.74e-177 504 59 2 425 3 eno Enolase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q0BSX3 4.17e-177 504 59 3 431 3 eno Enolase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
C6BSL8 4.36e-177 504 60 2 425 3 eno Enolase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C3KZ49 4.37e-177 504 61 2 425 3 eno Enolase Clostridium botulinum (strain 657 / Type Ba4)
Q9PDT8 4.41e-177 504 60 2 426 3 eno Enolase Xylella fastidiosa (strain 9a5c)
Q87DY6 6.68e-177 504 60 2 426 3 eno Enolase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I937 6.68e-177 504 60 2 426 3 eno Enolase Xylella fastidiosa (strain M23)
B2GAM0 6.68e-177 504 58 2 426 3 eno Enolase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q5GYK4 8.68e-177 503 59 2 426 3 eno Enolase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SUA6 8.68e-177 503 59 2 426 3 eno Enolase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P1K8 8.68e-177 503 59 2 426 3 eno Enolase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B4SR86 9.26e-177 503 61 3 427 3 eno Enolase Stenotrophomonas maltophilia (strain R551-3)
B5ZNA1 9.86e-177 503 61 3 431 3 eno Enolase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B8FKT4 1.37e-176 503 62 4 423 3 eno Enolase Desulfatibacillum aliphaticivorans
Q898R0 1.38e-176 503 60 2 425 3 eno Enolase Clostridium tetani (strain Massachusetts / E88)
A1VGV5 1.38e-176 503 59 2 425 3 eno Enolase Nitratidesulfovibrio vulgaris (strain DP4)
Q72F92 1.38e-176 503 59 2 425 1 eno Enolase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1WSY0 2.89e-176 503 58 2 418 3 eno Enolase Ligilactobacillus salivarius (strain UCC118)
B8E0W1 3.7e-176 501 61 4 425 3 eno Enolase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
Q1MH36 4.6e-176 501 61 3 431 3 eno Enolase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A0LEC9 4.72e-176 501 59 3 431 3 eno Enolase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8DPS0 4.81e-176 502 58 3 431 1 eno Enolase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IPX8 4.81e-176 502 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain CGSP14)
Q04KG2 4.81e-176 502 58 3 431 3 eno Enolase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8UFH1 5.19e-176 501 60 3 431 3 eno Enolase Agrobacterium fabrum (strain C58 / ATCC 33970)
B1V8R6 6.62e-176 501 61 3 418 3 eno Enolase Phytoplasma australiense
B7IFN4 8.49e-176 501 59 2 423 3 eno Enolase Thermosipho africanus (strain TCF52B)
Q03GW5 8.51e-176 501 58 2 426 3 eno Enolase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B2IKR4 8.54e-176 501 60 2 430 3 eno Enolase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B2V9N8 1.15e-175 500 58 2 430 3 eno Enolase Sulfurihydrogenibium sp. (strain YO3AOP1)
Q1QMI9 1.31e-175 500 60 2 430 3 eno Enolase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
O32513 1.55e-175 500 59 2 425 1 eno Enolase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
C1CRM6 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain Taiwan19F-14)
C1CKJ0 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain P1031)
C1CEB3 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain JJA)
Q97QS2 1.93e-175 500 58 3 431 1 eno Enolase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZPW9 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IBR3 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain Hungary19A-6)
C1C7C0 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae (strain 70585)
B5E4P1 1.93e-175 500 58 3 431 3 eno Enolase Streptococcus pneumoniae serotype 19F (strain G54)
Q07ND9 2.16e-175 500 60 3 430 3 eno Enolase Rhodopseudomonas palustris (strain BisA53)
Q0A7K4 3.51e-175 499 62 2 425 3 eno Enolase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A6X0L8 3.84e-175 499 60 3 430 3 eno Enolase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B9JW75 4.22e-175 499 60 3 430 3 eno Enolase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8F4T8 5.18e-175 499 60 2 427 3 eno Enolase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72QZ8 5.18e-175 499 60 2 427 3 eno Enolase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B0SYX8 7.74e-175 498 60 2 432 3 eno Enolase Caulobacter sp. (strain K31)
Q03ZK4 7.91e-175 499 59 3 427 3 eno Enolase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A5IIQ6 1.01e-174 498 59 2 425 3 eno Enolase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
P42848 1.01e-174 498 59 2 425 1 eno Enolase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A8AY46 1.32e-174 498 58 3 429 3 eno Enolase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q73P50 1.34e-174 498 58 4 428 3 eno Enolase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A3CMA7 1.44e-174 498 58 3 429 3 eno Enolase Streptococcus sanguinis (strain SK36)
Q9RR60 1.46e-174 498 59 4 427 3 eno Enolase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
C1CXJ3 1.54e-174 497 58 4 427 3 eno Enolase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
B5EPM7 1.56e-174 498 59 3 425 3 eno Enolase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J6R4 1.56e-174 498 59 3 425 3 eno Enolase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A6L3M9 1.61e-174 498 60 5 433 3 eno Enolase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5WV02 1.74e-174 497 58 3 427 3 eno Enolase Legionella pneumophila (strain Lens)
A5VQQ7 1.85e-174 497 59 3 430 3 eno Enolase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q2NAQ1 2.01e-174 497 59 2 425 3 eno Enolase Erythrobacter litoralis (strain HTCC2594)
A5FUW3 2.18e-174 497 59 3 431 3 eno Enolase Acidiphilium cryptum (strain JF-5)
B3Q6L0 2.26e-174 497 61 3 430 3 eno Enolase Rhodopseudomonas palustris (strain TIE-1)
B1LCF4 2.48e-174 497 59 2 425 3 eno Enolase Thermotoga sp. (strain RQ2)
Q5ZTX1 2.87e-174 497 58 3 427 1 eno Enolase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q8G0G3 3.16e-174 497 59 3 430 3 eno Enolase Brucella suis biovar 1 (strain 1330)
A9M5E5 3.16e-174 497 59 3 430 3 eno Enolase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57D07 3.16e-174 497 59 3 430 3 eno Enolase Brucella abortus biovar 1 (strain 9-941)
Q2YPV0 3.16e-174 497 59 3 430 3 eno Enolase Brucella abortus (strain 2308)
B2S5Y3 3.16e-174 497 59 3 430 3 eno Enolase Brucella abortus (strain S19)
A3DBQ5 3.67e-174 497 61 2 423 3 eno Enolase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q6N5U6 4.65e-174 496 61 3 430 3 eno Enolase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q5X3L4 6.31e-174 496 58 3 427 3 eno Enolase Legionella pneumophila (strain Paris)
A7INB6 7.12e-174 496 60 2 423 3 eno Enolase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A5IDM2 7.94e-174 496 58 3 427 3 eno Enolase Legionella pneumophila (strain Corby)
Q11HU8 1.3e-173 495 60 3 431 3 eno Enolase Chelativorans sp. (strain BNC1)
B9DJJ9 1.45e-173 495 60 4 431 3 eno Enolase Staphylococcus carnosus (strain TM300)
C4XLR9 1.7e-173 495 59 2 425 3 eno Enolase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A4W2T1 2.11e-173 495 58 4 430 3 eno Enolase Streptococcus suis (strain 98HAH33)
A5V3E8 2.32e-173 494 59 2 430 3 eno Enolase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
C0MH89 3.45e-173 494 57 4 432 3 eno Enolase Streptococcus equi subsp. zooepidemicus (strain H70)
B4U2B8 3.45e-173 494 57 4 432 3 eno Enolase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M6K5 3.45e-173 494 57 4 432 3 eno Enolase Streptococcus equi subsp. equi (strain 4047)
A8ZSY5 4.17e-173 494 62 3 418 3 eno Enolase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A1US94 4.52e-173 494 58 3 425 3 eno Enolase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
B6JFY2 4.76e-173 494 59 3 430 3 eno Enolase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q8YHF0 5.23e-173 494 59 3 430 3 eno Enolase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RJA3 5.23e-173 494 59 3 430 3 eno Enolase Brucella melitensis biotype 2 (strain ATCC 23457)
B0CGT2 5.71e-173 493 59 3 430 3 eno Enolase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q6G173 7.95e-173 493 59 3 425 3 eno Enolase Bartonella quintana (strain Toulouse)
Q1JML5 9.54e-173 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCN8 9.54e-173 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M12 (strain MGAS2096)
A0JU21 1.03e-172 493 60 3 426 3 eno Enolase Arthrobacter sp. (strain FB24)
A9IS50 1.06e-172 493 59 3 425 3 eno Enolase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q1MS78 1.19e-172 493 59 3 425 3 eno Enolase Lawsonia intracellularis (strain PHE/MN1-00)
B5XKM7 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M49 (strain NZ131)
P0DA95 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48UF7 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RFE3 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J7I5 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JHQ6 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M2 (strain MGAS10270)
P69951 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DA94 1.66e-172 493 57 4 432 3 eno Enolase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P69949 1.66e-172 493 57 4 432 1 eno Enolase Streptococcus pyogenes serotype M1
Q67SV9 1.68e-172 493 58 3 433 3 eno Enolase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5XD01 1.84e-172 493 57 4 432 1 eno Enolase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2RLT8 2.54e-172 492 60 2 427 3 eno Enolase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B1MVW3 2.97e-172 492 59 3 427 3 eno Enolase Leuconostoc citreum (strain KM20)
B5RLS2 2.98e-172 492 57 2 424 3 eno Enolase Borrelia duttonii (strain Ly)
Q5N3P4 3.17e-172 492 60 4 424 3 eno Enolase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QJ8 3.17e-172 492 60 4 424 1 eno Enolase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9XDS7 4.16e-172 492 57 3 431 3 eno Enolase Streptococcus intermedius
Q2W698 4.35e-172 491 59 2 426 3 eno Enolase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A8IBF3 8.14e-172 491 57 2 430 3 eno Enolase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
B5RRF1 8.6e-172 491 57 2 424 3 eno Enolase Borrelia recurrentis (strain A1)
B2TPW4 9.68e-172 491 59 2 425 3 eno Enolase Clostridium botulinum (strain Eklund 17B / Type B)
B9KA91 9.7e-172 491 59 2 423 3 eno Enolase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11985
Feature type CDS
Gene eno
Product phosphopyruvate hydratase
Location 173126 - 174424 (strand: -1)
Length 1299 (nucleotides) / 432 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1870
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00113 Enolase, C-terminal TIM barrel domain
PF03952 Enolase, N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0148 Carbohydrate transport and metabolism (G) G Enolase

Kegg Ortholog Annotation(s)

Protein Sequence

MSKIVKVIGREIIDSRGNPTVEAEVHLEGGFVGMAAAPSGASTGSREALELRDGDKSRFLGKGVLKAVGAVNGPIAQALLGQDAKDQAKVDQIMIDLDGTENKSNFGANAILAVSLANAKAAAASKGLPLYAHIAELNGTPGKYSMPLPMMNILNGGEHADNNVDIQEFMIQPVGAPSLKEAVRMGSEIFHHLAKVLKAKGMNTAVGDEGGYAPNLGSNAEALADIKEAVKAAGYELGKDVTLAMDCAASEFYNKETGMYELKGEGRTFTSQEFTHYLEELTKEYPIVSIEDGLDESDWDGFAYQTKVMGDKIQLVGDDLFVTNTKILKEGIEKGIVNSILIKFNQIGSLTETLAAIKMAKDAGYTAVISHRSGETEDATIADLAVGTAAGQIKTGSMSRSDRVAKYNQLIRIEEALGERAPFHGRKEIKGQ

Flanking regions ( +/- flanking 50bp)

TAAGTGCCGGTTACTTATCTGAAAATTTAACTTGTACTGAGGAAAACCTAATGTCCAAAATCGTTAAAGTGATCGGCCGTGAAATCATCGACTCCCGCGGTAACCCTACTGTAGAAGCTGAAGTACACCTGGAAGGCGGTTTTGTGGGTATGGCGGCTGCTCCGTCAGGCGCATCTACCGGTTCCCGTGAAGCGCTGGAACTGCGTGACGGTGATAAATCACGTTTCCTGGGTAAAGGTGTTCTGAAGGCAGTCGGCGCGGTAAATGGTCCGATCGCACAGGCGCTGCTGGGTCAGGATGCCAAAGATCAGGCAAAAGTTGACCAGATCATGATCGACCTGGATGGCACTGAAAACAAATCCAACTTCGGTGCAAACGCGATTCTGGCTGTGTCTCTGGCAAACGCCAAAGCCGCTGCCGCATCAAAAGGTTTACCTCTGTACGCACACATCGCAGAACTGAACGGCACTCCGGGCAAATACTCTATGCCGCTGCCGATGATGAACATCCTGAACGGTGGTGAGCACGCTGATAACAACGTGGACATCCAGGAATTCATGATCCAGCCTGTCGGCGCGCCATCTCTGAAAGAAGCTGTCCGCATGGGTTCTGAAATCTTCCATCACCTGGCAAAAGTGCTGAAAGCTAAAGGCATGAACACTGCGGTGGGTGATGAAGGTGGTTATGCACCAAACCTGGGTTCTAACGCAGAAGCGCTGGCTGACATCAAAGAAGCCGTTAAAGCAGCAGGCTACGAGTTAGGCAAAGACGTTACCCTGGCGATGGACTGTGCAGCATCTGAGTTCTACAACAAAGAAACCGGTATGTATGAACTGAAAGGCGAAGGCCGTACCTTTACCTCTCAGGAATTCACTCACTACCTGGAAGAGCTGACCAAAGAGTATCCGATCGTCTCTATCGAAGATGGTCTGGATGAATCTGACTGGGATGGTTTCGCGTATCAGACTAAAGTCATGGGCGATAAAATCCAGCTGGTCGGTGATGACCTGTTCGTGACCAATACCAAGATCCTGAAAGAAGGTATCGAAAAAGGTATCGTTAACTCCATTCTGATTAAATTCAACCAGATCGGTTCACTGACCGAAACACTGGCTGCTATCAAAATGGCGAAAGACGCCGGTTACACTGCCGTTATCTCTCACCGTTCCGGTGAAACCGAAGATGCCACGATTGCCGACCTGGCTGTCGGTACCGCAGCAGGCCAGATCAAAACCGGTTCTATGAGCCGTTCTGACCGTGTTGCCAAGTACAACCAACTGATCCGTATCGAAGAAGCGCTGGGCGAACGTGCTCCGTTCCACGGCCGCAAAGAGATCAAAGGTCAGTAATTGTTACTGTGAATGTTAAAAAAGGTGTGTCCGGCGGGCACACCTTTTTT