Homologs in group_2323

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17850 FBDBKF_17850 100.0 Morganella morganii S1 lysR DNA-binding transcriptional regulator, LysR family
EHELCC_09875 EHELCC_09875 100.0 Morganella morganii S2 lysR DNA-binding transcriptional regulator, LysR family
LHKJJB_07500 LHKJJB_07500 100.0 Morganella morganii S3 lysR DNA-binding transcriptional regulator, LysR family
HKOGLL_07050 HKOGLL_07050 100.0 Morganella morganii S5 lysR DNA-binding transcriptional regulator, LysR family
F4V73_RS15115 F4V73_RS15115 84.9 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS17745 PMI_RS17745 54.0 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2323

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2323

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0DUU5 5.58e-45 157 37 2 244 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q9I4X0 1.17e-17 85 28 5 259 1 mvfR Multiple virulence factor regulator MvfR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52696 7.19e-13 71 26 10 305 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
O68014 5.29e-12 68 26 6 245 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P73123 9.76e-12 68 24 4 281 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3MCB5 1.35e-11 67 25 5 264 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4G384 1.55e-11 67 23 4 311 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
Q765S2 3.2e-11 65 26 8 269 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P48271 4.17e-11 66 24 5 274 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
P76369 8.76e-11 65 24 4 252 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
P52693 1.44e-10 64 29 4 201 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P70785 1.68e-10 64 26 9 301 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
A2CI69 1.7e-10 64 27 4 198 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q8YQ82 2.19e-10 63 24 5 264 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8KA72 2.63e-10 63 29 4 176 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P20668 2.8e-10 63 26 9 272 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q85G62 9.94e-10 62 22 5 244 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P0ACR2 2.53e-09 60 27 3 180 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 2.53e-09 60 27 3 180 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
Q8X4M5 2.89e-09 60 25 8 276 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
O32255 3.4e-09 60 22 8 288 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P51205 3.88e-09 60 24 2 200 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
O78432 6.85e-09 59 23 2 200 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P96725 8.23e-09 58 23 4 261 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
Q1XDT2 1.03e-08 58 24 2 200 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P07774 1.21e-08 58 26 6 246 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P27111 2.1e-08 57 24 8 276 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q6B936 2.63e-08 57 25 3 203 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P52662 3.97e-08 57 31 2 144 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P0A9G1 7.25e-08 56 26 8 237 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 7.25e-08 56 26 8 237 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 7.25e-08 56 26 8 237 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
O34701 7.72e-08 56 24 8 266 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P52689 8.41e-08 56 27 9 263 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P0ACR0 1.24e-07 55 28 2 138 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 1.24e-07 55 28 2 138 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P25544 1.63e-07 55 28 2 144 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P77700 1.76e-07 55 23 7 273 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
P67660 2.08e-07 55 24 8 271 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 2.08e-07 55 24 8 271 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
Q8FK66 2.1e-07 55 28 2 138 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 2.1e-07 55 28 2 138 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A2Q4 2.22e-07 55 25 8 270 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 2.22e-07 55 25 8 270 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
Q1RF30 2.3e-07 54 28 2 138 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 2.3e-07 54 28 2 138 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P52677 2.86e-07 54 25 6 272 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
O87883 3.84e-07 52 28 0 142 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
P94403 5.41e-07 53 27 2 141 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
O19892 6.98e-07 53 24 3 203 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P0DV33 7.67e-07 53 31 0 97 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
A7Z5E4 7.81e-07 53 24 6 249 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P94501 8.98e-07 53 25 6 254 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
Q57S50 1.11e-06 52 28 2 138 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q9S4Y7 1.28e-06 52 28 2 138 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 1.28e-06 52 28 2 138 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P52678 1.37e-06 52 28 0 142 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P30864 1.58e-06 52 29 4 155 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
P52691 2.01e-06 52 27 10 273 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O87324 3.02e-06 51 24 6 266 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium marinum
Q8Z8R3 3.05e-06 51 28 2 138 3 allS HTH-type transcriptional activator AllS Salmonella typhi
O06703 4.95e-06 50 20 5 283 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P39592 5.04e-06 50 22 7 290 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P77309 8.43e-06 50 22 7 290 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
A0T0V5 1.04e-05 49 22 5 276 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P0ACR4 1.13e-05 49 25 1 144 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.13e-05 49 25 1 144 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.13e-05 49 25 1 144 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
Q04778 1.28e-05 49 22 5 248 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
P71318 1.38e-05 49 23 3 202 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
P42722 1.49e-05 49 30 3 147 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0ACQ4 1.64e-05 49 22 3 202 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 1.64e-05 49 22 3 202 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 1.64e-05 49 22 3 202 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
P50327 2.08e-05 48 28 5 190 3 nodD1 Nodulation protein D 1 Bradyrhizobium sp. (strain NC92)
Q08597 2.22e-05 48 29 2 122 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P13041 2.47e-05 48 32 1 90 1 mkaC Virulence genes transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9X725 2.47e-05 48 23 0 146 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P44821 2.77e-05 48 24 0 141 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P14145 2.79e-05 48 29 6 155 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P96194 3.69e-05 46 35 0 94 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
O69055 4.03e-05 47 36 0 73 3 ptxE Putative HTH-type transcriptional regulator protein PtxE (Fragment) Stutzerimonas stutzeri
P58332 4.18e-05 48 24 8 259 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
P56885 4.66e-05 47 24 8 263 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
P24417 4.79e-05 47 32 1 90 3 spvR Virulence genes transcriptional activator SpvR Salmonella dublin
P55181 5.88e-05 47 25 6 263 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P52661 6.04e-05 47 24 1 192 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P52669 6.51e-05 47 22 7 249 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q47005 7.02e-05 47 29 0 98 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
Q9JXW7 8.55e-05 47 30 0 128 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O34685 0.000121 46 24 2 165 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P46068 0.000125 46 29 4 144 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P44418 0.000148 46 24 2 177 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P55700 0.000174 46 33 2 96 1 nodD2 Nodulation protein D 2 Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9JPU9 0.000175 46 30 0 128 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P12233 0.000181 46 33 2 96 3 nodD2 Nodulation protein D 2 Bradyrhizobium japonicum
P45099 0.00026 45 32 5 150 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45105 0.000309 45 27 4 172 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O07906 0.000311 45 19 3 231 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P55576 0.000347 45 48 0 49 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9X5P2 0.000349 45 30 0 136 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P45463 0.000451 44 26 0 119 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 0.000456 44 26 0 119 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R6S1 0.000494 44 26 0 119 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 0.000494 44 26 0 119 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBK9 0.000503 44 26 0 119 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
P67662 0.000516 44 30 2 126 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 0.000516 44 30 2 126 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 0.000516 44 30 2 126 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P49518 0.000539 44 18 5 283 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
Q6HPH4 0.000669 44 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0R8S0 0.000756 44 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
Q81VJ1 0.000788 43 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
Q63H01 0.000854 43 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 0.000854 43 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
O35038 0.001 43 24 5 194 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
Q81IX0 0.001 43 33 0 75 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_10255
Feature type CDS
Gene lysR
Product DNA-binding transcriptional regulator, LysR family
Location 210720 - 211616 (strand: -1)
Length 897 (nucleotides) / 298 (amino acids)

Contig

Accession ZDB_524
Length 215957 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2323
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MPFNSDNLQLFLTVLEKGSFSAAARALHRVPSAVSMAVSNLEAELGFALFERSGRAPVPTERALALAPYAREITDKIHQLNVFTRELTQDVESTLAVGVATCVNPQDLFSALQILNQRYPLLKTEILSGSQDDILPLLHQGRIQLALVFGGLYVDPREQFHCIGHEALVATISATHPSLSQQQSVYIEDLVQAKQIVIASLHHSLTDVRSQMATKTWQTDNFSVALGLVKAGIGWGNLPESMIRAEVASGTLKVLSFRNTRNGLVLPVHIVSRKGDVLKRGAQECIGLLTESRVSEGN

Flanking regions ( +/- flanking 50bp)

TGATAATAAAAGTCAGCTACTATCAGATTTTCTGACAGGAAGGAGGGGGTATGCCGTTTAACAGTGATAACTTGCAGCTTTTTCTGACGGTGCTGGAGAAAGGATCATTTTCAGCCGCCGCAAGAGCGCTGCACCGCGTGCCGTCAGCGGTCAGTATGGCGGTCAGTAATCTGGAAGCTGAACTGGGTTTTGCACTGTTTGAACGTTCGGGCAGGGCACCGGTACCGACAGAAAGAGCCCTGGCGCTGGCACCGTATGCCAGAGAGATAACGGATAAAATTCATCAGCTGAATGTGTTTACCCGCGAGCTGACGCAGGATGTGGAGAGCACACTGGCGGTGGGGGTCGCAACCTGTGTGAATCCGCAGGACTTGTTTTCTGCTCTGCAGATACTGAATCAGCGTTATCCGTTGCTGAAAACAGAAATTTTATCCGGGTCACAGGATGACATTCTGCCGCTGCTGCATCAGGGGCGGATCCAGCTGGCACTGGTTTTCGGCGGGCTGTATGTGGATCCACGCGAGCAGTTTCACTGTATCGGTCATGAAGCTCTGGTGGCCACCATTTCAGCCACGCATCCTTCTTTATCTCAGCAACAGTCTGTTTATATTGAGGATTTGGTACAGGCAAAACAAATCGTTATTGCCAGTCTTCACCATTCTCTCACTGATGTGCGTTCACAGATGGCGACGAAAACCTGGCAGACTGATAATTTTTCGGTGGCGCTGGGACTGGTTAAAGCGGGTATCGGCTGGGGGAATCTGCCGGAATCGATGATCCGGGCGGAAGTGGCGTCCGGGACACTGAAAGTCCTGTCATTCCGCAATACCCGTAACGGTCTGGTGCTGCCGGTGCATATTGTCAGCCGGAAAGGGGATGTGCTTAAACGTGGTGCTCAGGAGTGCATCGGGCTGCTGACGGAAAGCCGTGTGTCTGAGGGAAATTAGTTGTTATGATAACGGGATAAATCAGCAGAGAGGAAAAGCGTATGTTTGAA