Homologs in group_1941

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14195 FBDBKF_14195 100.0 Morganella morganii S1 yfbU YfbU family protein
EHELCC_08085 EHELCC_08085 100.0 Morganella morganii S2 yfbU YfbU family protein
LHKJJB_05855 LHKJJB_05855 100.0 Morganella morganii S3 yfbU YfbU family protein
HKOGLL_05060 HKOGLL_05060 100.0 Morganella morganii S5 yfbU YfbU family protein
F4V73_RS02735 F4V73_RS02735 95.1 Morganella psychrotolerans - YfbU family protein
PMI_RS08675 PMI_RS08675 77.4 Proteus mirabilis HI4320 - YfbU family protein

Distribution of the homologs in the orthogroup group_1941

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1941

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C5B8J8 5.59e-103 295 82 0 164 3 NT01EI_2691 UPF0304 protein NT01EI_2691 Edwardsiella ictaluri (strain 93-146)
A1JLD8 7.77e-102 292 79 0 164 3 YE1336 UPF0304 protein YE1336 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2K828 1.62e-101 291 79 0 164 3 YPTS_2689 UPF0304 protein YPTS_2689 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q668Z3 1.62e-101 291 79 0 164 3 YPTB2594 UPF0304 protein YPTB2594 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDJ9 1.62e-101 291 79 0 164 3 YPO2563 UPF0304 protein YPO2563/y1624/YP_2374 Yersinia pestis
Q1CHP5 1.62e-101 291 79 0 164 3 YPN_2156 UPF0304 protein YPN_2156 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1C6A3 1.62e-101 291 79 0 164 3 YPA_2053 UPF0304 protein YPA_2053 Yersinia pestis bv. Antiqua (strain Antiqua)
A4TM42 1.62e-101 291 79 0 164 3 YPDSF_1971 UPF0304 protein YPDSF_1971 Yersinia pestis (strain Pestoides F)
A9R6M7 1.62e-101 291 79 0 164 3 YpAngola_A1823 UPF0304 protein YpAngola_A1823 Yersinia pestis bv. Antiqua (strain Angola)
B1JGK6 1.62e-101 291 79 0 164 3 YPK_1553 UPF0304 protein YPK_1553 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FGP6 1.62e-101 291 79 0 164 3 YpsIP31758_1445 UPF0304 protein YpsIP31758_1445 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4WCS3 4.75e-101 290 80 0 164 3 Ent638_2838 UPF0304 protein Ent638_2838 Enterobacter sp. (strain 638)
A8ADU4 2.52e-99 286 79 0 164 3 CKO_00501 UPF0304 protein CKO_00501 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XNU6 1.49e-98 284 79 0 164 3 KPK_1463 UPF0304 protein KPK_1463 Klebsiella pneumoniae (strain 342)
P60817 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60816 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella typhi
B5BCL1 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella paratyphi A (strain AKU_12601)
Q5PN45 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RCG0 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R316 5.37e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella enteritidis PT4 (strain P125109)
Q57M20 8.06e-98 282 78 0 164 3 yfbU UPF0304 protein YfbU Salmonella choleraesuis (strain SC-B67)
B2TW75 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LLP8 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain SMS-3-5 / SECEC)
B6I7L6 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain SE11)
B7N5Q6 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8W8 2.05e-97 281 78 0 164 1 yfbU UPF0304 protein YfbU Escherichia coli (strain K12)
B1IXP8 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8W9 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFF2 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1X905 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain K12 / DH10B)
C4ZVI7 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5X3 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O8 (strain IAI1)
B7MXH3 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O81 (strain ED1a)
B7NNX3 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXT4 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCV1 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O157:H7
B7LBE8 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain 55989 / EAEC)
B7MG58 2.05e-97 281 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UFV2 4.66e-97 280 78 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QS1 1.22e-96 279 77 0 164 3 yfbU UPF0304 protein YfbU Shigella flexneri
Q0T2J3 3.91e-96 278 77 0 164 3 yfbU UPF0304 protein YfbU Shigella flexneri serotype 5b (strain 8401)
A7ZPA8 4.14e-96 277 77 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O139:H28 (strain E24377A / ETEC)
Q6D2Q8 4.32e-95 275 75 0 164 3 ECA3037 UPF0304 protein ECA3037 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MH30 5.27e-95 275 76 0 164 3 ESA_00925 UPF0304 protein ESA_00925 Cronobacter sakazakii (strain ATCC BAA-894)
C6DA52 1.9e-94 273 75 0 164 3 PC1_2778 UPF0304 protein PC1_2778 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6LNI6 1.53e-73 221 62 1 166 3 PBPRA2768 UPF0304 protein PBPRA2768 Photobacterium profundum (strain SS9)
Q9KQX6 1.2e-72 218 63 1 166 3 VC_1871 UPF0304 protein VC_1871 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5E3V7 9.4e-72 216 60 1 166 3 VF_1794 UPF0304 protein VF_1794 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FG97 1.13e-71 216 60 1 166 3 VFMJ11_1926 UPF0304 protein VFMJ11_1926 Aliivibrio fischeri (strain MJ11)
B6EIJ8 1.26e-71 216 61 2 167 3 VSAL_I2183 UPF0304 protein VSAL_I2183 Aliivibrio salmonicida (strain LFI1238)
Q7MJ16 1.42e-71 216 59 1 166 3 VV2347 UPF0304 protein VV2347 Vibrio vulnificus (strain YJ016)
Q8DAU5 1.42e-71 216 59 1 166 3 VV1_2093 UPF0304 protein VV1_2093 Vibrio vulnificus (strain CMCP6)
Q87R08 7.78e-71 214 61 1 166 3 VP0990 UPF0304 protein VP0990 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MZN5 7.98e-69 209 60 1 166 3 VIBHAR_01542 UPF0304 protein VIBHAR_01542 Vibrio campbellii (strain ATCC BAA-1116)
B7VM08 1.43e-68 208 58 1 166 3 VS_1049 UPF0304 protein VS_1049 Vibrio atlanticus (strain LGP32)
B0UWD5 5.27e-64 196 50 0 164 3 HSM_1818 UPF0304 protein HSM_1818 Histophilus somni (strain 2336)
Q65QB3 1.76e-63 195 51 0 164 3 MS2240 UPF0304 protein MS2240 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CKV5 5.48e-63 194 50 0 164 3 PM1500 UPF0304 protein PM1500 Pasteurella multocida (strain Pm70)
A6VLS1 2.75e-61 189 50 0 164 3 Asuc_0543 UPF0304 protein Asuc_0543 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q60310 4.3e-20 84 31 5 169 3 MJECS11 UPF0304 protein MJECS11 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08410
Feature type CDS
Gene yfbU
Product YfbU family protein
Location 79938 - 80432 (strand: 1)
Length 495 (nucleotides) / 164 (amino acids)
In genomic island -

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1941
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03887 YfbU domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3013 Function unknown (S) S Uncharacterized conserved protein YfbU, UPF0304 family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09161 uncharacterized protein - -

Protein Sequence

MEMTNAQRLILSNQYKMMAMLDPDNAERYRRQQTIIERGFGLQMRELDRDFGELPEEICRRVIDMMEMYHALRISFDNLKEAKDIDPRRIHFLGFDAATEARYLSYVRFLVNTEGRYTHFDSGSHGFNSQTPMWDKYVRMLGAWHNCPRQYHLSEVEINQILNA

Flanking regions ( +/- flanking 50bp)

AATGCGATGATTCTGACCATACCCCAGATTACTTTTTCAGGAGATACACCATGGAAATGACCAATGCACAACGCCTTATCCTCTCTAACCAGTATAAAATGATGGCTATGCTGGATCCGGATAATGCCGAGCGCTACCGCCGCCAGCAGACTATTATTGAGCGCGGCTTCGGGCTGCAGATGCGCGAGCTGGATCGCGATTTCGGCGAGCTGCCGGAAGAAATCTGCCGCCGTGTGATTGATATGATGGAAATGTACCACGCACTGCGTATCTCCTTCGATAACCTGAAAGAAGCAAAAGATATCGACCCGCGCCGTATCCACTTCTTAGGTTTTGATGCGGCGACCGAAGCACGTTATTTAAGTTATGTGCGTTTTCTGGTAAATACGGAAGGGCGTTATACCCACTTTGACAGCGGCAGCCACGGCTTTAACTCCCAGACGCCGATGTGGGATAAATATGTCCGTATGCTCGGTGCATGGCATAACTGCCCGCGTCAGTATCACCTGAGTGAAGTGGAAATTAATCAGATCCTTAACGCATAATATTCCGGTATCCGTAACGGCGAGGCACGCATGGCACTGACTGCAAAAGG