Homologs in group_1903

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14195 FBDBKF_14195 95.1 Morganella morganii S1 yfbU YfbU family protein
EHELCC_08085 EHELCC_08085 95.1 Morganella morganii S2 yfbU YfbU family protein
NLDBIP_08410 NLDBIP_08410 95.1 Morganella morganii S4 yfbU YfbU family protein
LHKJJB_05855 LHKJJB_05855 95.1 Morganella morganii S3 yfbU YfbU family protein
HKOGLL_05060 HKOGLL_05060 95.1 Morganella morganii S5 yfbU YfbU family protein
PMI_RS08675 PMI_RS08675 76.8 Proteus mirabilis HI4320 - YfbU family protein

Distribution of the homologs in the orthogroup group_1903

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1903

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
C5B8J8 6.38e-102 292 80 0 164 3 NT01EI_2691 UPF0304 protein NT01EI_2691 Edwardsiella ictaluri (strain 93-146)
A1JLD8 1.05e-100 289 78 0 164 3 YE1336 UPF0304 protein YE1336 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2K828 1.29e-99 286 78 0 164 3 YPTS_2689 UPF0304 protein YPTS_2689 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q668Z3 1.29e-99 286 78 0 164 3 YPTB2594 UPF0304 protein YPTB2594 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZDJ9 1.29e-99 286 78 0 164 3 YPO2563 UPF0304 protein YPO2563/y1624/YP_2374 Yersinia pestis
Q1CHP5 1.29e-99 286 78 0 164 3 YPN_2156 UPF0304 protein YPN_2156 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1C6A3 1.29e-99 286 78 0 164 3 YPA_2053 UPF0304 protein YPA_2053 Yersinia pestis bv. Antiqua (strain Antiqua)
A4TM42 1.29e-99 286 78 0 164 3 YPDSF_1971 UPF0304 protein YPDSF_1971 Yersinia pestis (strain Pestoides F)
A9R6M7 1.29e-99 286 78 0 164 3 YpAngola_A1823 UPF0304 protein YpAngola_A1823 Yersinia pestis bv. Antiqua (strain Angola)
B1JGK6 1.29e-99 286 78 0 164 3 YPK_1553 UPF0304 protein YPK_1553 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FGP6 1.29e-99 286 78 0 164 3 YpsIP31758_1445 UPF0304 protein YpsIP31758_1445 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4WCS3 5.25e-99 285 78 0 164 3 Ent638_2838 UPF0304 protein Ent638_2838 Enterobacter sp. (strain 638)
B5XNU6 8.9e-98 281 77 0 164 3 KPK_1463 UPF0304 protein KPK_1463 Klebsiella pneumoniae (strain 342)
A8ADU4 3.04e-97 280 76 0 164 3 CKO_00501 UPF0304 protein CKO_00501 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P60817 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P60816 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella typhi
B5BCL1 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella paratyphi A (strain AKU_12601)
Q5PN45 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RCG0 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R316 3.21e-96 278 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella enteritidis PT4 (strain P125109)
Q57M20 5.26e-96 277 76 0 164 3 yfbU UPF0304 protein YfbU Salmonella choleraesuis (strain SC-B67)
B2TW75 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LLP8 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain SMS-3-5 / SECEC)
B6I7L6 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain SE11)
B7N5Q6 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A8W8 1.22e-95 276 75 0 164 1 yfbU UPF0304 protein YfbU Escherichia coli (strain K12)
B1IXP8 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8W9 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFF2 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1X905 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain K12 / DH10B)
C4ZVI7 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5X3 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O8 (strain IAI1)
B7MXH3 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O81 (strain ED1a)
B7NNX3 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YXT4 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XCV1 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O157:H7
B7LBE8 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli (strain 55989 / EAEC)
B7MG58 1.22e-95 276 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UFV2 3.11e-95 275 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QS1 9.31e-95 274 75 0 164 3 yfbU UPF0304 protein YfbU Shigella flexneri
A7ZPA8 2.03e-94 273 75 0 164 3 yfbU UPF0304 protein YfbU Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T2J3 2.19e-94 273 75 0 164 3 yfbU UPF0304 protein YfbU Shigella flexneri serotype 5b (strain 8401)
Q6D2Q8 7.09e-93 269 72 0 164 3 ECA3037 UPF0304 protein ECA3037 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MH30 2.01e-92 268 73 0 164 3 ESA_00925 UPF0304 protein ESA_00925 Cronobacter sakazakii (strain ATCC BAA-894)
C6DA52 2.95e-92 268 72 0 164 3 PC1_2778 UPF0304 protein PC1_2778 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B6EIJ8 2.85e-72 217 60 1 166 3 VSAL_I2183 UPF0304 protein VSAL_I2183 Aliivibrio salmonicida (strain LFI1238)
Q6LNI6 1.89e-71 215 60 1 166 3 PBPRA2768 UPF0304 protein PBPRA2768 Photobacterium profundum (strain SS9)
Q5E3V7 2.16e-71 215 59 1 166 3 VF_1794 UPF0304 protein VF_1794 Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FG97 3.38e-71 214 59 1 166 3 VFMJ11_1926 UPF0304 protein VFMJ11_1926 Aliivibrio fischeri (strain MJ11)
Q9KQX6 1.36e-70 213 61 1 166 3 VC_1871 UPF0304 protein VC_1871 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MJ16 2.15e-70 213 57 1 166 3 VV2347 UPF0304 protein VV2347 Vibrio vulnificus (strain YJ016)
Q8DAU5 2.15e-70 213 57 1 166 3 VV1_2093 UPF0304 protein VV1_2093 Vibrio vulnificus (strain CMCP6)
Q87R08 8.52e-69 208 59 2 167 3 VP0990 UPF0304 protein VP0990 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7VM08 1.69e-67 205 57 1 166 3 VS_1049 UPF0304 protein VS_1049 Vibrio atlanticus (strain LGP32)
A7MZN5 4.89e-67 204 57 1 166 3 VIBHAR_01542 UPF0304 protein VIBHAR_01542 Vibrio campbellii (strain ATCC BAA-1116)
Q65QB3 1.35e-63 195 50 0 164 3 MS2240 UPF0304 protein MS2240 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0UWD5 3.16e-62 192 48 0 164 3 HSM_1818 UPF0304 protein HSM_1818 Histophilus somni (strain 2336)
Q9CKV5 1.34e-60 187 47 0 164 3 PM1500 UPF0304 protein PM1500 Pasteurella multocida (strain Pm70)
A6VLS1 2.26e-59 184 48 0 164 3 Asuc_0543 UPF0304 protein Asuc_0543 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q60310 2.6e-20 85 31 6 170 3 MJECS11 UPF0304 protein MJECS11 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS02735
Feature type CDS
Gene -
Product YfbU family protein
Location 576785 - 577279 (strand: 1)
Length 495 (nucleotides) / 164 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1903
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03887 YfbU domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3013 Function unknown (S) S Uncharacterized conserved protein YfbU, UPF0304 family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K09161 uncharacterized protein - -

Protein Sequence

MEMNNAQRLILSNQYKMMAMMDPDNAERYRRQQTIIERGFGLQMRELDRDFGELPEDICRRVIDMMEMYHALRISFDNLKNAADIDARRIHFLGFDAATEARYLSYVRFLVNTEGRYTHFDSGSHGFNSQTPMWDKYVRMLGAWHGCPRQYHLSEVEINQVLNA

Flanking regions ( +/- flanking 50bp)

TAATGCGATGATTCCGACATACACCGGATTACCTTTTCAGGAGATACACCATGGAAATGAATAACGCCCAACGCCTTATCCTCTCTAACCAATATAAAATGATGGCAATGATGGATCCGGATAATGCCGAGCGTTACCGCCGCCAGCAGACTATTATTGAACGTGGCTTCGGGTTACAGATGCGCGAATTGGATCGCGATTTCGGTGAATTACCGGAAGATATCTGCCGCCGCGTGATTGATATGATGGAAATGTACCATGCACTGCGTATCTCCTTTGATAACCTGAAAAATGCGGCTGATATTGATGCACGCCGTATCCACTTCTTAGGTTTCGATGCGGCGACTGAAGCCCGCTATTTAAGTTATGTCCGCTTCCTGGTTAATACCGAAGGGCGTTATACGCACTTTGACAGCGGCAGCCACGGTTTTAACTCCCAGACACCAATGTGGGATAAATATGTCCGTATGCTGGGTGCATGGCATGGCTGCCCGCGTCAGTATCACCTGAGCGAAGTGGAAATTAATCAGGTTCTTAACGCCTGATTTTAGCTGACCCCTTACTTTATCCGCATTCTGAGAGGCACAAATGGCAT